MBE Advance Access originally published online on March 13, 2008
Molecular Biology and Evolution 2008 25(6):1067-1080; doi:10.1093/molbev/msn060
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Articles |
Altered miRNA Repertoire in the Simplified Chordate, Oikopleura dioica
Sars Centre for Marine Molecular Biology, Bergen High Technology Centre, University of Bergen, Bergen, Norway
E-mail: eric.thompson{at}sars.uib.no
 |
Abstract |
|---|
 TOP Abstract IntroductionMaterials and MethodsResultsDiscussionSupplementary MaterialAcknowledgementsReferences |
|---|
Recent studies reveal correlation between microRNA (miRNA) innovation and increased developmental complexity. This is exemplified by dramatic expansion of the miRNA inventory in vertebrates, a lineage where genome duplication has played a significant evolutionary role. Urochordates, the closest extant group to the vertebrates, exhibit an opposite trend to genome and morphological simplification. We show that the urochordate, larvacean, Oikopleura dioica, possesses the requisite miRNA biogenic machinery. The miRNAs isolated by small RNA cloning were expressed throughout the short life cycle, a number of which were stocked as maternal determinants prior to rapid embryonic development. We identify sex-specific miRNAs that appeared as male/female gonad differentiation became apparent and were maintained throughout spermatogenesis. Whereas 80% of mammalian miRNAs are hosted in introns of protein-coding genes, the majority of O. dioica miRNA loci were located in antisense orientations to such genes. Including sister group ascidians in analysis of the urochordate miRNA repertoire, we find that 11 highly conserved bilaterian miRNA families have been lost or derived to the point they are not recognizable in urochordates and a further 4 of these families are absent in larvaceans. Subsequent to this loss/derivation, at least 29 novel miRNA families have been acquired in larvaceans. This suggests a profound reorganization of the miRNA repertoire integral to evolution in the urochordate lineage.
Key Words: ncRNA • let-7 • P-body • Drosha • larvacean • ascidian
|
Introduction |
|---|
|
TOPAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary MaterialAcknowledgementsReferences |
|---|
MicroRNAs (miRNAs) are noncoding RNAs (ncRNAs) of
22 nt implicated in regulation of diverse biological processes in development, differentiation, growth, metabolism, and disease. They are transcribed as pri-miRNA precursors containing a stem loop of 80 bp and are processed in the nucleus by the RNase III enzyme Drosha and DGCR8/Pasha, to excise the pre-miRNA stem loop (Gregory et al. 2004
). In the cytoplasm, the RNase III enzyme, Dicer, cuts the pre-miRNA to generate the mature miRNA as part of a short RNA duplex (Hutvagner et al. 2001). The RNA is subsequently incorporated into a miRNA-induced silencing complex (miRISC) with Argonaute (AGO) protein as a core component (Martinez et al. 2002). Through the miRISC complex, miRNAs negatively regulate gene expression by base pairing to mRNA targets. Plant miRNA target sites are usually present in coding regions and exhibit extensive complementarity to mature miRNAs (Dugas and Bartel 2004), whereas animal miRNA sites exist predominantly in the 3' untranslated regions (UTR) of target mRNAs and generally show imperfect complementarity to corresponding mature miRNAs (Ambros 2004; Bushati and Cohen 2007). Plant miRNAs regulate principally through promoting degradation of target miRNAs (Llave et al. 2002), whereas animal miRNAs can impair translational efficiency, as well as destabilize target mRNAs (Bagga et al. 2005; Lim et al. 2005).
A recent study (Mathonnet et al. 2007) suggests that inhibition of translation initiation through targeting of m7G-cap recognition is the initial molecular event effected by miRNAs with subsequent deadenylation and degradation of target mRNAs consolidating silencing. Other studies have concluded that miRNAs can also act to block translational elongation (Nottrott et al. 2006; Petersen et al. 2006). The cytoplasmic location of target mRNAs is further mediated by miRNAs. P-body components contribute to translational repression by sequestering miRNA/target mRNA complexes away from polysomes (Liu et al. 2005) and may act as intermediate storage sites from which translationally repressed mRNAs could be targeted for degradation or, alternatively, returned to the active translational pool (Bhattacharyya et al. 2006; Chan and Slack 2006).
Accumulating evidence suggests that miRNAs have also had an important role in shaping metazoan phenotypic diversity and complexity (Niwa and Slack 2007). The revelation of miRNAs and associated biogenesis machinery in the unicellular alga Chlamydomonas reinhardtii (Zhao et al. 2007) indicates an ancient origin for miRNAs. As the menu of genome sequences increases, it is apparent that few novel transcription factor families have emerged since the divergence of plants and animals (Wray et al. 2003). On the other hand, miRNA creation seems to be an active, ongoing process. Three major episodes of miRNA innovation, correlating with significant developmental transitions among animals, have been identified thus far (Hertel et al. 2006). About 20 miRNAs were shown to be common to protostomes and deuterostomes and possibly characteristic of the advent of bilaterians. Subsequently, the addition of 56 new families occurred at the branch leading to the vertebrates and on the order of 40 new families are associated with the eutherian mammals. Furthermore, both primate-specific and human (Berezikov et al. 2006)-specific miRNAs have been identified. In addition to association of altered miRNA repertoires with major body plan changes, they have also been suggested to promote phenotypic variation in closely related species, indicating that miRNAs may in part drive animal evolution through phenotypic variation during development (Niwa and Slack 2007).
Thus far, the primary focus of inquiry into miRNAs in animal evolution has been toward the vertebrate lineage. Two rounds of genome duplication have profoundly shaped the vertebrate genome (Holland et al. 1994) and probably contributed to expansion of the vertebrate ncRNA inventory. In a recent analysis of molecular phylogeny (Delsuc et al. 2006), the urochordates have displaced the cephalochordates as the closest living relatives of vertebrates. Urochordates are morphologically and molecularly derived and characterized by a genomic simplification that contrasts with vertebrate duplication. On the other hand, the more distantly related cephalochordates might have retained more ancestral characters. Among larvaceans, 1 of 3 sister classes of urochordates, Oikopleura dioica exhibits high rates of molecular evolution and a strong drive to genome compaction with a genome size of 70 Mb and a high density of one gene per 4–5 kb (Seo et al. 2001). They are also the first metazoans after the nematode Caenorhabditis elegans known to transcribe genes in operons (Ganot et al. 2004). They undergo rapid embryonic development and have a short life cycle (4 days, 20 °C) with rapid growth through extensive recourse to endocycles (Ganot and Thompson 2002). Here, we show that O. dioica possesses the requisite miRNA biogenic machinery and that miRNAs are expressed throughout the entire life cycle, with some stocked as maternal determinants. We identify sex-specific miRNAs that appear as male/female gonad differentiation becomes apparent and are maintained throughout spermatogenesis. Including the ascidians Ciona intestinalis and Ciona savignyi in the miRNA analysis, and in concordance with the high rates of molecular evolution of protein-coding genes and the trends to genome and morphological simplification in the urochordates, we find 11 highly conserved miRNA families have either been lost or derived to the point they are no longer recognizable in this group. Subsequent to this loss/derivation, a further 4 conserved families have been lost and at least 29 novel miRNA families have been acquired, in the larvacean branch. This suggests reshaping of the miRNA repertoire as an integral part of evolution in the urochordate lineage.
|
Materials and Methods |
|---|
|
TOPAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary MaterialAcknowledgementsReferences |
|---|
Oikopleura Culture and Sampling
Oikopleura dioica were collected from fjords around Bergen, Norway, and maintained year round in culture at 14–15 °C (Clarke et al. 2007
). Animals were sampled at different developmental stages by transfer to watch glasses where they were rinsed in sterile-filtered seawater (SFSW), and houses were removed. To collect unfertilized oocytes, mature females were transferred to SFSW and the gonad was burst by gentle pipetting and oocytes were rinsed 3 times in SFSW. For in vitro fertilizations, a suspension of sperm was obtained from 1 to 2 mature male ejaculates in 5 ml SFSW. An aliquot of the sperm suspension was then added at a final dilution of 1:100 to oocytes collected from mature females in a watch glass. When 90% of the fertilized oocytes had emitted polar bodies, the embryos were rinsed 3 times in SFSW. Embryos were then left to develop at room temperature, and specific stages were sampled. Samples were immediately frozen in liquid nitrogen and stored at –80 °C.
RNA Isolation and Small RNA Cloning
For miRNA cloning, miRNA dot blot assay, and northern blot, small RNAs (
200 nt) were extracted using the mirVana miRNA isolation kit (Ambion, Austin, TX) according to the manufacturer's instructions. For reverse transcriptase–polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE), total RNA was isolated with Trizol (GIBCO-BRL, Carlsbad, CA) according to the manufacturer's instructions. To clone miRNAs, 20 µg small RNA was separated on a denaturing 15% polyacrylamide gel. The 18- to 28-nt band was excised, and the recovered RNA was dephosphorylated by alkaline phophatase. A 5'-phosphorylated 3' adapter oligonucleotide (5'-pCTGTAGGCACCATTCATCACx-3'; p, phosphate; x, 3'-amino-modifier C-7) was ligated using T4 RNA ligase (New England BioLabs, Ipswich, MA, 20 U) to the dephosphorylated RNA. The ligation product was separated from nonligated RNA on a denaturing 12% polyacrylamide gel, and ligated RNA was recovered from the gel and 5' phosphorylated. A 5' adapter oligonucleotide (5'-ATGTCGTGaggcaccugaaa-3', DNA/lowercase RNA) containing hydroxyl groups at both 5' and 3' ends was then ligated to the phosphorylated ligation product. The new ligation product was purified by ethanol precipitation. Reverse transcription (RT) was performed using an RT primer (5'-GATGAATGGTGCCTAC-3'), followed by polymerase chain reaction (PCR) with a 5' primer (5'-ATCGTGAGGCACCTGAAA-3') and a 3' primer (5'-ATTGATGGTGCCTACAG-3'). The PCR product was then digested with BanI and concatamerized using T4 DNA ligase. Concatamers with sizes >400 bp were separated on an agarose gel and recovered from the gel slice. The unpaired ends were filled by incubation with Taq polymerase, and the DNA product was directly ligated into pCR2.1-TOPO by TOPO TA cloning (Invitrogen, Carlsbad, CA).
The miRNA Expression
Antisense miRNA oligos (2 pg each) were spotted on N+ membranes to construct the miRNA array. Endogenous miRNA labeling was performed using the mirVana miRNA labeling kit (Ambion). The 18- to 28-nt RNA fraction was excised from a denaturing 15% polyacrylamide gel. After purification, the recovered RNA was used in the labeling reaction containing 10 µl 2x reaction buffer, 2 µl MnCl2 (25 mM), 1 µl deoxynucleoside triphosphates (10 mM), 1 µl [
-32P]adenosine triphosphate (ATP) (10 µCi/µl; Amersham, Buckinghamshire, UK), and 1 µl poly(A)polymerase (2 U/µl) at 37 °C for 15 min. Labeled miRNAs were purified according to the manufacturer's instructions and used to probe the dot blot array. Hybridization procedure for dot blots was the same as for northern blots. For identification of miRNA expression, a total of 15 µg small RNA pooled from different developmental stages was run on polyacrylamide gels. For developmental miRNA expression profiles, 2 µg small RNA from each developmental stage, oocytes, 5-min embryos, 25- to 40-min embryos, 1.5-h embryos, 1.8-h embryos, 4-h embryos, day 3 animals, day 5 animals, day 6 females, and day 6 males, were run on polyacrylamide gels. Developmental miRNA dot blot array analyses were performed in 2 separate experiments. One contained samples from oocytes, 5-min embryos, 25- to 40-min embryos, 1.5-h embryos, 1.8-h embryos, and 4-h embryos, the other contained samples from day 3, day 5, day 6 female, and day 6 male animals. In both experiments, all samples, from RNA extraction to miRNA dot blot, were processed simultaneously on the same population of animals.
For northerns, 10 µg small RNA or 20 µg total RNA was run on 10% acrylamide-8 M urea gels, transferred to N+ membranes (Amersham) and UV cross-linked. Oligonucleotide probes for 5S rRNA (CGGTCACCCATGTAAGTACTAAC), miR-1b (TGGAATGTTAAGAAGTGTGACT), and miR-7 (TCAACAAAATCACTAGTCTTCCA) were labeled using T4 polynucleotide kinase and [
-32P]ATP (10 µCi/µl; Amersham). Membranes were hybridized in 5x standard saline citrate (SSC)/5x Denhardt's solution/0.5% sodium dodecyl sulfate (SDS)/100 µg of yeast tRNA (Sigma, St. Louis, MO)/ml with 32P 5'-end-labeled probes at 42 °C. The final stringency washing was done with 0.1x SSC at 25 °C. Membranes were reprobed after boiling in 0.1% SDS. Autoradiographs were analyzed on a phosphorimager (Fuji, Tokyo, Japan).
Quantitative reverse transcriptase–polymerase chain reaction and RACE
Total RNAs were subjected to a second RQ1-DNase treatment (1 U per µg total RNA). For RT-PCR, 2 µg of total RNA from each stage was subjected to RT using 100 pmol random hexamers. Real-time PCRs (DNA Engine Opticon 2; MJ Research, Waltham, MA) contained cDNA synthesized from an equivalent of 10 ng of total RNA, 10 µl of Quantitect qPCR 2x Master Mix (Qiagen, Hilden, Germany), 0.2 µM concentrations of primers in a total volume of 20 µl. After initial denaturation for 15 min at 95 °C, 40 cycles of 95 °C for 15 s, 58 °C for 30 s, and 72 °C for 30 s were conducted, with a final extension for 5 min at 72 °C. RT negative controls were run to 40 cycles of amplification. In all qRT-PCRs, RbL23 was used as a normalization control (Chioda et al. 2004). The 3'-RACE was conducted using the GeneRacer kit (Invitrogen) according to the manufacturer's protocol. The PCR products were gel purified, cloned, and sequenced. Primer sequences for RT-PCR, qPCR, and 3'-RACE are given in supplementary table 1 (Supplementary Material online).
In Silico Analyses
Cloned sequences were used as queries in Blast searches of the O. dioica database (http://www.genoscope.cns.fr/externe/English/Projets/Projet_HG/organisme_HG.html). All known miRNAs in miRBase (http://microrna.sanger.ac.uk/sequences/) were also used as queries in Blast searches of the O. dioica genome and those of the sister class ascidians, C. intestinalis (http://www.ensembl.org and http://ghost.zool.kyoto-u.ac.jp/indexr1.html) and C. savignyi (http://www.ensembl.org). The trace databases for the 2 ascidian species at National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/Traces/trace.cgi) were also searched. In addition, the 64 newly identified O. dioica miRNAs were used as queries in Blast searches of the C. intestinalis and C. savignyi databases. Sequences with more than 15-nt matches or core seed matches were selected for further analysis. RNA secondary structures were calculated by using Mfold version 3.1 using default parameters, and divergent genes were predicted by GENSCAN (http://www.hgmp.mrc.ac.uk).
Whole-Mount In Situ Hybridization
Locked Nucleic Acid (LNA) -modified DNA oligonucleotide probes (Proligo, St. Louis, MO) (supplementary table 2, Supplementary Material online) were 3'-end labeled with the digoxigenin-ddUTP kit (Roche, Basel, Switzerland) according to the manufacturer's recommendations and purified using sephadex G25 Microspin columns (Amersham). Whole-mount in situ hybridizations were performed essentially as described (Seo et al. 2004), with the following modifications. Samples were treated with proteinase K (Sigma; 3 µg/µl in 50 mM Tris–HCl, pH 8.0, heated to 37 °C immediately prior to use) for 1 min (4- to 10-h specimens), 3 min (12- to 15-h specimens), 5 min (day 1–day 3 specimens), or 7 min (day 4–day 6 specimens). Hybridizations were performed in 300 µl of hybridization mix. The temperature of hybridization and subsequent washing steps was adjusted to approximately 20–25 °C below the predicted melting temperatures of the LNA-modified oligo.
Nucleotide Sequence Accession Numbers for O. dioica Sequences
AM765852, DGCR8; AM765853
[GenBank]
, Dicer; AM765854
[GenBank]
, Myosin (MYH6); AM765855
[GenBank]
, dihydrolipoamide S acetyltransferase; AM765856
[GenBank]
, cyclic adenosine monophosphate (cAMP) -dependent protein kinase type I-alpha regulatory subunit; AM886169
[GenBank]
, Drosha; AM886170
[GenBank]
, Ago1; AM886171
[GenBank]
, Ago2; and AM886172, Ago3.
|
Results |
|---|
|
TOPAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary MaterialAcknowledgementsReferences |
|---|
Oikopleura dioica Possesses the Requisite miRNA Processing Machinery
Blast searches of the O. dioica genomic database revealed homologs of Drosha, DGCR8, Dicer, and 3 AGO proteins. RT-PCR and RACE were performed to isolate full-length proteins. Domain organizations of these proteins (fig. 1) were similar to their respective homologs in other species though overall sequence similarity was modest. Oikopleura dioica Drosha was 47% identical to human Drosha and contained 2 RNase III domains (RIBOcs) and 1 double-stranded RNA-binding domain (DSRM, fig. 1A). DGCR8 was 31% identical to human DGCR8 and possessed 2 RIBOcs and 1 WW domain, a protein module with 2 highly conserved tryptophans that bind proline-rich peptide motifs. The O. dioica Dicer contained 2 RIBOcs, a DSRM, and a PAZ domain, which had a long N-terminus and showed 37% overall identity to the human homolog. The 3 AGO proteins all had similar domain structures.
|
As Drosha is required for pri-miRNA processing in miRNA biogenesis, we examined its developmental expression profile by qPCR (fig. 1B). Drosha was expressed at all development stages, indicating the potential to express miRNAs throughout the O. dioica life cycle, including very early development. We then searched the O. dioica genome with known miRNA sequences from miRBase. Among a few conserved miRNA sequences that were identified, we performed northern blotting for miR-1 and miR-7 (fig. 1C). Expression of miR-1 was detected in the small RNA fraction pooled from a variety of developmental stages, whereas miR-7 was not, possibly due to low and/or tissue-specific expression. The above evidence was consistent with the use of miRNAs in this urochordate.
Identification of Conserved and Novel O. dioica miRNAs
To further identify O. dioica miRNAs, we cloned and sequenced a library prepared from small RNAs isolated at different developmental stages (fig. 2). Stages included: oocytes, 1-cell zygote, 2–8 cell embryos, blastulas, gastrulas, hatched tadpoles (4-h post fertilization [pf]), early tadpoles (7-h pf), tail-shifted tadpoles (12- to 14-h pf), and day 1, day 3, day 5, and 6 animals. Among 3,066 sequenced small RNA clones, 1,629 (53%) were annotated as miRNA candidates. Remaining small RNAs were fragments of rRNA, tRNA, and mRNA. To further analyze putative miRNAs, we included 65 nt of genomic sequence flanking each side and processed these sequences using Mfold v3.1. This yielded a nonredundant set of 69 potential miRNAs.
|
Expression of potential miRNAs was examined by dot blot. The 18- to 28-nt RNA fraction from pooled developmental stages was labeled and hybridized. Expression of 55 miRNAs was detected (fig. 2B). Substantial differences in expression levels were observed: miR-1478, miR-1482, miR-1487/1488, and miR-1497 displayed high expression, whereas most of the remaining miRNAs showed modest or weak expression. The 14 candidates with no detectable signal are either not miRNAs or may be expressed at very low levels or in limited cell types or circumstances. The 55 expressed miRNAs were used in a Blast search of the O. dioica genome. This revealed 4 additional miR-1497 members. The list of miRNAs, including those identified by homology using known miRNA sequences, is given in table 1 and includes 49 miRNA families.
|
The miRNA size distribution (fig. 2C) ranged from 20 to 27 nt, the majority between 21–24 nt (93%), with 22 nt the most abundant (36%). The miRNAs as long as 27 nt have also been observed in humans and Drosophila (miRBase v10.1). The majority of miRNAs had a uridine residue at the 5' terminus (61%), as observed in other organisms. From the dot blot array, 2 highly expressed miRNAs (miR-1482 and miR-1487) and 2 modestly expressed miRNAs (let-7d and miR-1473) were analyzed by northern blotting. Expression of all 4 miRNAs was detected (fig. 2D) and levels corresponded to their cloning frequency (table 1).
Five compact clusters containing 15 miRNAs were identified, and the distance between adjacent members was systematically less than 100 bp. With the exception of the miR-1473/let-7d cluster, clusters contained only homologous miRNAs, suggestive of recent gene duplication. The miR-1497 family consisted of 8 genes encoded in 4 different genomic regions in O. dioica, one of which contained a tight cluster of 6 genes (supplementary fig. 1, Supplementary Material online).
Developmental Expression of O. dioica miRNAs
Developmental expression profiles of miRNAs were determined by dot blot at indicated developmental stages (supplementary fig. 2, Supplementary Material online), and representative profiles are summarized in figure 3. Whereas some miRNAs, such as miR-1497, were expressed throughout development, others showed more restricted profiles. In preparation for the extremely rapid embryogenesis of O. dioica, many maternal miRNAs were detected in unfertilized oocytes. Maternal miRNAs have also been described in Drosophila (Leaman et al. 2005) and have been implicated in early mouse embryonic development through deletion of Dicer in growing oocytes (Tang et al. 2007). The majority of miRNAs were expressed during embryogenesis with zygotic expression of miRNAs detected at least as early as the blastula stage (e.g., miR-1487 and miR-1488). Sex-specific expression of miRNAs was also observed (fig. 3B). The miR-1478 was highly expressed in day 6 females and in oocytes, suggesting a maternally stocked miRNA. In contrast, members of the miR-1487/1488 cluster were predominantly expressed in day 6 males and were not detected in oocytes. To our knowledge, this is the first identification of sex-specific expression of miRNAs.
|
Increased Divergence of O. dioica miRNAs
Relatively few conserved miRNAs were identified in O. dioica. To explore whether this might be characteristic of urochordates as a whole, we searched ascidian, C. intestinalis and C. savignyi genomes with miRNAs from miRBase, as well as O. dioica miRNAs identified here. Sequences retrieved with high similarity were subsequently analyzed with Mfold for secondary structures. It has been proposed that miRNA families, rather than single miRNAs, are evolutionarily conserved (Alvarez-Garcia and Miska 2005
). The miRNAs from model organisms representing vertebrates, insects, and nematodes were classified in families using the bootstrap based Phylogeny-Bootstrap-Cluster (PBC) pipeline on full stem-loop sequences (Huang and Gu 2007) (fig. 4). Using these criteria, miRNAs from C. intestinalis and C. savignyi (supplementary table 3, Supplementary Material online) grouped into 29 and 22 families, respectively. Among the 29 miRNA families in C. intestinalis, 20 were conserved with known families, with 14, 9, 20, and 4 families conserved with respect to vertebrates, insects, tunicates, and nematodes, respectively. Similarly, in C. savignyi, 13 miRNA families were conserved with known families.
|
Among the 49 miRNA families we identified in O. dioica, there were 20 conserved families including let-7, miR-1, miR-7, miR-31, miR-92, miR-124, miR-281, miR-1468, miR-1473, miR-1475, miR-1477, miR-1478, miR-1480, miR-1486, miR-1494, miR-1498, miR-1500, miR-1501, and miR-1506. Among these families, reduced conservation of mature miRNA sequence was observed compared with other organisms. For example, within the miR-124 family, the O. dioica sequences were the only ones to show internal substitutions (fig. 4B). A conserved clustering of miR-1473 and let-7d was observed in the urochordates (fig. 4C) with the spacing between the genes greatly reduced in O. dioica as compared with the ascidian species, in keeping with the more compact genome of the former (Seo et al. 2001
).
Genomic Locations of O. dioica miRNAs
Most miRNAs are single-copy loci in the O. dioica genome. Four miRNAs, miR-1490a, miR-1493, miR-1497d, and miR-1504, are present as 2 copies, and miR-1497d-1 and miR-1497d-2 are included in the large miR-1497 cluster. In human and mouse genomes, on the order of 80% of miRNAs are located on the sense strand of introns within genes (Rodriguez et al. 2004; Kim YK and Kim VN 2007). In contrast, many O. dioica miRNAs were found to be located in the antisense orientation of a protein-coding gene, often opposite the sense strand of an intron (fig. 5). There were also cases were the miRNA was located in the antisense strand, immediately downstream of the 3' UTR of a protein-coding gene (fig. 5C). Real-time PCR was performed to investigate expression of miRNAs and their host or adjacent genes. Expression of miR-1474 and miR-1501 was not detected though expression of the associated protein-coding genes was observed at various developmental stages. Expression of miR-1468, miR-1473, and miR-1487/1488 cluster showed no clear positive or negative correlation with the expression of the corresponding antisense protein-coding genes. In addition, the male-specific expression pattern of the miR-1487/1488 cluster was not related to expression of the immediately adjacent antisense, ABCA3 gene, as the latter was expressed at essentially equivalent levels in both day 6 males and females. Among the few miRNAs located in the sense strand of introns, possible target sites were identified in the 3' UTRs of the corresponding host genes (table 2).
|
|
Temporal–Spatial Expression Patterns of O. dioica miRNAs
In total, LNA probes to 35 O. dioica miRNAs were used in whole-mount in situ hybridization, with 12 miRNA loci showing detectable temporal–spatial patterns. During extensive organogenesis (4- to 7-h pf), in situ patterns of 8 miRNAs were discernable (fig. 6). Expression patterns were very weak and/or diffuse at 4 h, except for miR-92a and miR-92b in the notochord, and a general trend to stronger, more defined patterns was noted at 7 h. At 7 h, expression of let-7d and miR-1485 was restricted to 1 and 2 trunk cells, respectively. Ubiquitous expression of miR-1497 was observed in the trunk and tail, at higher levels in the trunk, with the exception of the trunk epithelium, where it appeared largely absent.
|
Previous studies have shown that conserved miRNAs do not necessarily exhibit conserved expression patterns. For example, the let-7 family is expressed in developing limbs in mouse and chicken embryos (Darnell et al. 2006
), whereas in zebrafish it is restricted to neuronal tissues (Ason et al. 2006). The 4 let-7 family members identified in O. dioica displayed distinct expression patterns (figs. 6 and 7). Though tightly clustered, let-7a was not expressed during embryonic development (fig. 7B), whereas let-7b was very weakly and diffusely expressed in the trunk at this time (fig. 7C). Later in development, expression of let-7b was not detected, whereas let-7a showed a clearly defined pattern in the trunk epithelium.
|
We also observed a differential pattern of expression of the miR-1487, miR-1488 cluster both during early development and with respect to sexual differentiation of the gonad (fig. 8). The miR-1487 was highly and ubiquitously expressed in tadpoles in contrast to the coclustered miR-1488 that was not detected at these stages. Postmetamorphosis, miR-1487 was expressed in the oikoplastic epithelium and in the endostyle. This pattern was also observed for miR-1488 but was delayed until later adult stages and was not observed up to day 4. Both miR-1487 and miR-1488 were strongly expressed in testes but not in ovaries. The expression of miR-1487 was first evident in the gonad at day 3, around the time when the first discernable signs of germline differentiation occur (Ganot et al. 2007
). At this time, 46 of 105 (44%) gonads showed expression and a similar ratio of 25 out of 44 (57%) gonads exhibited expression at day 5. In contrast, only 2 out of 18 (11%) gonads showed a very weak expression of miR-1488 at day 3. This suggests that miR-1487 may be implicated in the process germline differentiation and it was present throughout spermatogenesis. Postmetamorphosis, the coclustered miR-1488 showed similar spatial patterning to miR-1487 but was significantly delayed in time.
|
The different expression profiles of closely associated constituent members of the let-7a/7b and miR-1487/1488 clusters indicated consequent posttranscriptional regulation of miRNA levels in O. dioica. In terms of subcellular localization, we observed concentration of miR-1487, miR-1488, miR-1497, and let-7a, in large cytoplasmic granules in endocycling cells of the oikoplastic epithelium. These are suggestive of cytoplasmic GW/P-bodies known to sequester miRNAs and their target mRNAs in other organisms (Liu et al. 2005
). |
Discussion |
|---|
|
TOPAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary MaterialAcknowledgementsReferences |
|---|
The current consensus view is that with some exceptions, miRNAs confer robustness to, rather than acting as switches in, developmental programs. In vertebrates, the timing and spatial expression of homologous miRNAs is not strictly conserved and variation increases as differences in the physiology of the respective organisms is more pronounced (Ason et al. 2006
). Implication of miRNAs in the temporal robustness of developmental programs is exemplified by the role of miR-430 in sharpening the maternal to zygotic transition in zebrafish embryos (Giraldez et al. 2006), and targets of the miR-16 family are known to regulate cell cycle progression (Linsley et al. 2007). Thus, at least in vertebrates, miRNAs seem to be more involved in stabilizing differentiation outcomes and in regulating physiological processes as opposed to determining basic patterning events. In the related urochordate, O. dioica, development is very rapid with cleavage cycles as short as 5 min and the majority of cell cycles up to hatching being less than an hour in duration. During tadpole larval development, increasing numbers of cells show specifically timed entry into endocycles and postmetamorphosis, exquisite, differentially timed, and coordinated regulation of endocycles (Ganot and Thompson 2002) in the oikoplastic epithelium underlies repetitive secretion of the filter-feeding apparatus (Spada et al. 2001; Thompson et al. 2001). This suggests that temporal robustness of the developmental program may be critical to this urochordate's rapid life-history strategy. We found O. dioica possesses the requisite miRNA biogenic machinery and that Drosha, a requisite component, was expressed at all stages of the life cycle. Numerous miRNAs were stocked as maternal determinants in oocytes prior to rapid embryonic development and several, including let-7a, showed specific expression patterns in the endocycling oikoplastic epithelium, an organ in which many homeobox patterning genes are also expressed during its genesis (Chourrout D, personal communication). We also revealed sex-specific expression of miR-1487 and miR-1488. Expression was first detected in the gonad of about half of day 3 animals around the time of germline differentiation and was maintained throughout spermatogensis but was never detected in ovaries.
In contrast to their chordate relatives, the vertebrates, where 80% of miRNAs are located in the introns of protein-coding genes and cotranscribed with these genes, we found a minority (22–27%) of O. dioica miRNAs located in such a genomic context. Many were found on the antisense strand of protein-coding genes, some in close proximity to the ends of 3' UTRs, again on the antisense strand. In O. dioica, there has been a strong pressure toward genome compaction. Many introns have been reduced to less than 50 bp in size, preserving minimal cis-splicing elements, perhaps in large part accounting for the predominance of O. dioica miRNAs in antisense contexts. Caenorhabditis elegans, another organism with a compact genome and short introns shows a similar distribution to O. dioica, with only 15% of miRNAs occurring in the sense strand of introns, whereas Drosophila with an intermediate level of genome compaction and intron size has 31% of miRNAs in this context (miRBase v10.1). Compared with these 3 organisms, vertebrates exhibit expansion in the size of both introns and intergenic regions. Over this limited phylogenetic data set, there is a clear tendency of miRNAs to preferentially colonize transcriptional units of coding genes as more nonprotein-coding genomic space is available. In Drosophila, it was proposed that many genes involved in fundamental cell activities avoid miRNA regulation by reducing 3' UTR length (Stark et al. 2005). Genes coexpressed with miRNAs tend to avoid 3' UTR target sites for these miRNAs, and genes carrying predicted targets were expressed in adjacent tissue domains to the corresponding miRNAs. On the other hand in mammals, a recent paper (Tsang et al. 2007) shows that brain-enriched miRNAs target brain-enriched mRNAs. This type of regulatory circuit, in which the target and the miRNA are driven by an upstream activator away from their steady states in the same direction, would allow the miRNA to tune the production of the target in an opposite direction to the fluctuation of the activator, ensuring more uniform expression of the target mRNA in a given cell population. Thus, in the minority of cases where O. dioica miRNAs were found in the introns of protein-coding genes, it is of interest as to whether there may have been any selective pressure to maintain these arrangements in the face of global genome compaction. Indeed, in the few cases where this organization was found, possible, though unverified, target sites of the miRNA were noted in the 3' UTR of the host gene (table 2). One such example is the let7a gene in an intron of adenosine kinase, a gene involved in cellular energy homeostasis through regulation of the food intake cascade (Foufelle and Ferre 2005).
The let-7 gene was initially characterized in the nematode C. elegans as a regulator of developmental timing (Reinhart et al. 2000). It is not found in basal nonbilaterian metazoans such as ctenophores, cnidarians, and poriferans or in lower bilaterian acoels (Pasquinelli et al. 2003). In other bilaterians, the expression pattern appears to be broadly conserved. It is detectable by the adult stage but absent at earlier developmental stages (Pasquinelli et al. 2000). This is also true of let-7a in O. dioica where expression was not detected during embryogenesis but was observed in the postmetamorphic oikoplastic epithelium. Accumulation of let-7a in subcellular structures reminiscent of P-bodies was also observed in a specific subset of cells in the dorsal posterior region of the oikoplastic epithelium. The role of let-7a in the tissue responsible for controlled, repetitive secretion of the filter-feeding house structure that regulates food intake should be an intriguing area of future investigation.
It is estimated that miRNAs comprise 1–5% of metazoan genes, placing them among the most abundant classes of gene regulators (Lim et al. 2003). They regulate a large number of targets of diverse biological function as opposed to a few key factors. The relatively limited base pairing requirements for small miRNAs to interact with their targets, and the corresponding ease with which new miRNAs and their target sites can be acquired or lost, promote them as potential vectors in evolution. Whereas the taxonomic distribution of protein-coding genes does not match the considerable increase in morphological complexity during metazoan evolution, the greatly expanding repertoire of miRNAs and their targets is correlated with major body plan innovations (Mattick 2004; Sempere et al. 2006). Using an extensive phylogenomic data set, 2 key findings of Delsuc et al. (2006) were that urochordates, rather than cephalochordates, are the closest extant group to the vertebrates and urochordates have been undergoing rapid rates of evolution. We ran miRNA sequences present in the miRBase against the O. dioica genome and performed the same analysis with inclusion of all O. dioica miRNAs against the genomes of the sister class ascidians C. intestinalis and C. savignyi. We found that 11 conserved families of bilaterian miRNAs were either lost or no longer recognizable in the urochordates with loss of a further 4 conserved families in the larvacean lineage (fig. 9). We also have identified 4 novel miRNA families unique to urochordates and 29 novel miRNA families unique to larvaceans. Thus, the genomic and morphological simplification evident in the urochordates has been accompanied by a profound reorganization of their miRNA repertoire. This reorganization has continued in the pelagic, motile, short-lived larvaceans compared with the benthic, sedentary, longer-lived sister class ascidians. These data are consistent with the idea that miRNAs are important in shaping both animal evolution and in adapting radically different life-history strategies from a common larval body plan.
|
|
Supplementary Material |
|---|
|
TOPAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary MaterialAcknowledgementsReferences |
|---|
Supplementary figures 1 and 2 and tables 1–3 are available at Molecular Biology and Evolution online (http://www.mbe.oxfordjournals.org/).
|
Acknowledgements |
|---|
|
TOPAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary MaterialAcknowledgementsReferences |
|---|
We thank the staff from Appendic Park for supplying animals. This work was supported by grant 133335/V40 from the Norwegian Research Council (E.M.T.).
|
Footnotes |
|---|
William Jeffery, Associate Editor
|
References |
|---|
|
TOPAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary MaterialAcknowledgementsReferences |
|---|
Alvarez-Garcia I, Miska EA. MicroRNA functions in animal development and human disease. Development (2005) 21:4653–4662.
Ambros V. The functions of animal microRNAs. Nature (2004) 431:350–355.[CrossRef][Medline]
Ason B, Darnell DK, Wittbrodt B, Berezikov E, Kloosterman WP, Wittbrodt J, Antin PB, Plasterk RH. Differences in vertebrate microRNA expression. Proc Natl Acad Sci USA (2006) 103:14385–14389.
Bagga S, Bracht J, Hunter S, Massirer K, Holtz J, Eachus R, Pasquinelli AE. Regulation by let-7 and lin-4 miRNAs results in target mRNA degradation. Cell (2005) 122:553–563.[CrossRef][Web of Science][Medline]
Bentwich I, Avniel A, Karov Y, et al, (13 co-authors). Identification of hundreds of conserved and nonconserved human microRNAs. Nat Genet (2005) 37:766–770.[CrossRef][Web of Science][Medline]
Berezikov E, Thuemmler F, van Laake LW, Kondova I, Bontrop R, Cuppen E, Plasterk RH. Diversity of microRNAs in human and chimpanzee brain. Nat Genet (2006) 38:1375–1377.[CrossRef][Medline]
Bhattacharyya SN, Habermacher R, Martine U, Closs EI, Filipowicz W. Relief of microRNA-mediated translational repression in human cells subjected to stress. Cell (2006) 125:1111–1124.[CrossRef][Web of Science][Medline]
Bushati N, Cohen SM. microRNA functions. Annu Rev Cell Dev Biol (2007) 23:175–205.[CrossRef][Medline]
Chan SP, Slack FJ. microRNA-mediated silencing inside P-bodies. RNA Biol (2006) 3:97–100.[Medline]
Chioda M, Spada F, Eskeland R, Thompson EM. Histone mRNAs do not accumulate during S phase of either mitotic or endoreduplicative cycles in the chordate Oikopleura dioica. Mol Cell Biol (2004) 24:5391–5403.
Clarke T, Bouquet JM, Fu X, Kallesoe T, Schmid M, Thompson EM. Rapidly evolving lamins in a chordate, Oikopleura dioica, with unusual nuclear architecture. Gene (2007) 396:159–169.[CrossRef][Web of Science][Medline]
Darnell DK, Kaur S, Stanislaw S, Konieczka JH, Yatskievych TA, Antin PB. MicroRNA expression during chick embryo development. Dev Dyn (2006) 235:3156–3165.[CrossRef][Web of Science][Medline]
Delsuc F, Brinkmann H, Chourrout D, Philippe H. Tunicates and not cephalochordates are the closest living relatives of vertebrates. Nature (2006) 439:965–968.[CrossRef][Medline]
Dugas DV, Bartel B. MicroRNA regulation of gene expression in plants. Curr Opin Plant Biol (2004) 7:512–520.[CrossRef][Web of Science][Medline]
Foufelle F, Ferre P. Role of adenosine monophosphate-activated protein kinase in the control of energy homeostasis. Curr Opin Clin Nutr Metab Care (2005) 8:355–360.[Web of Science][Medline]
Ganot P, Kallesoe T, Reinhardt R, Chourrout D, Thompson EM. Spliced-leader RNA trans splicing in a chordate, Oikopleura dioica, with a compact genome. Mol Cell Biol (2004) 24:7795–7805.
Ganot P, Kallesoe T, Thompson EM. The cytoskeleton organizes germ nuclei with divergent fates and asynchronous cycles in a common cytoplasm during oogenesis in the chordate Oikopleura. Dev Biol (2007) 302:577–590.[CrossRef][Web of Science][Medline]
Ganot P, Thompson EM. Patterning through differential endoreduplication in epithelial organogenesis of the chordate, Oikopleura dioica. Dev Biol (2002) 252:59–71.[CrossRef][Web of Science][Medline]
Giraldez AJ, Mishima Y, Rihel J, Grocock RJ, Van Dongen S, Inoue K, Enright AJ, Schier AF. Zebrafish MiR-430 promotes deadenylation and clearance of maternal mRNAs. Science (2006) 312:75–79.
Gregory RI, Yan KP, Amuthan G, Chendrimada T, Doratotaj B, Cooch N, Shiekhattar R. The Microprocessor complex mediates the genesis of microRNAs. Nature (2004) 432:235–240.[CrossRef][Medline]
Hertel J, Lindemeyer M, Missal K, Fried C, Tanzer A, Flamm C, Hofacker IL, Stadler PF. The expansion of the metazoan microRNA repertoire. BMC Genomics (2006) 7:25.[CrossRef][Medline]
Holland PW, Garcia-Fernandez J, Williams NA, Sidow A. Gene duplications and the origins of vertebrate development. Development (1994) (Suppl):125–133.
Huang Y, Gu X. A bootstrap based analysis pipeline for efficient classification of phylogenetically related animal miRNAs. BMC Genomics (2007) 8:66.[CrossRef][Medline]
Hutvagner G, McLachlan J, Pasquinelli AE, Balint E, Tuschl T, Zamore PD. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science (2001) 293:834–838.
Kim YK, Kim VN. Processing of intronic microRNAs. EMBO J (2007) 26:775–783.[CrossRef][Web of Science][Medline]
Leaman D, Chen PY, Fak J, Yalcin A, Pearce M, Unnerstall U, Marks DS, Sander C, Tuschl T, Gaul U. Antisense-mediated depletion reveals essential and specific functions of microRNAs in Drosophila development. Cell (2005) 121:1097–1108.[CrossRef][Web of Science][Medline]
Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP. Vertebrate microRNA genes. Science (2003) 299:1540.
Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS, Johnson JM. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature (2005) 433:769–773.[CrossRef][Medline]
Linsley PS, Schelter J, Burchard J. (15 co-authors). Transcripts targeted by the microRNA-16 family cooperatively regulate cell cycle progression. Mol Cell Biol (2007) 27:2240–2252.
Liu J, Valencia-Sanchez MA, Hannon GJ, Parker R. MicroRNA-dependent localization of targeted mRNAs to mammalian P-bodies. Nat Cell Biol (2005) 7:719–723.[CrossRef][Web of Science][Medline]
Llave C, Xie Z, Kasschau KD, Carrington JC. Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science (2002) 297:2053–2056.
Martinez J, Patkaniowska A, Urlaub H, Luhrmann R, Tuschl T. Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell (2002) 110:563–574.[CrossRef][Web of Science][Medline]
Mathonnet G, Fabian MR, Svitkin YV. (13 co-authors). MicroRNA inhibition of translation initiation in vitro by targeting the cap-binding complex eIF4F. Science (2007) 317:1764–1767.
Mattick JS. RNA regulation: a new genetics? Nat Rev Genet (2004) 5:316–323.[CrossRef][Web of Science][Medline]
Niwa R, Slack FJ. The evolution of animal microRNA function. Curr Opin Genet Dev (2007) 17:145–150.[CrossRef][Web of Science][Medline]
Nottrott S, Simard MJ, Richter JD. Human let-7a miRNA blocks protein production on actively translating polyribosomes. Nat Struct Mol Biol (2006) 13:1108–1114.[CrossRef][Web of Science][Medline]
Pasquinelli AE, McCoy A, Jimenez E, Salo E, Ruvkun G, Martindale MQ, Baguna J. Expression of the 22 nucleotide let-7 heterochronic RNA throughout the Metazoa: a role in life history evolution? Evol Dev (2003) 5:372–378.[CrossRef][Web of Science][Medline]
Pasquinelli AE, Reinhart BJ, Slack F. (19 co-authors). Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature (2000) 408:86–89.[CrossRef][Medline]
Petersen CP, Bordeleau ME, Pelletier J, Sharp PA. Short RNAs repress translation after initiation in mammalian cells. Mol Cell (2006) 21:533–542.[CrossRef][Web of Science][Medline]
Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, Rougvie AE, Horvitz HR, Ruvkun G. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature (2000) 403:901–906.[CrossRef][Medline]
Rodriguez A, Griffiths-Jones S, Ashurst JL, Bradley A. Identification of mammalian microRNA host genes and transcription units. Genome Res (2004) 14:1902–1910.
Sempere LF, Cole CN, McPeek MA, Peterson KJ. The phylogenetic distribution of metazoan microRNAs: insights into evolutionary complexity and constraint. J Exp Zoolog B Mol Dev Evol (2006) 306:575–588.[Medline]
Seo HC, Edvardsen RB, Maeland AD, et al, (12 co-authors). Hox cluster disintegration with persistent anteroposterior order of expression in Oikopleura dioica. Nature (2004) 431:67–71.[CrossRef][Medline]
Seo HC, Kube M, Edvardsen RB, et al, (11 co-authors). Miniature genome in the marine chordate Oikopleura dioica. Science (2001) 294:2506.
Spada F, Steen H, Troedsson C, Kallesoe T, Spriet E, Mann M, Thompson EM. Molecular patterning of the oikoplastic epithelium of the larvacean tunicate Oikopleura dioica. J Biol Chem (2001) 276:20624–20632.
Stark A, Brennecke J, Bushati N, Russell RB, Cohen SM. Animal microRNAs confer robustness to gene expression and have a significant impact on 3'UTR evolution. Cell (2005) 123:1133–1146.[CrossRef][Web of Science][Medline]
Tang F, Kaneda M, O'Carroll D, Hajkova P, Barton SC, Sun YA, Lee C, Tarakhovsky A, Lao K, Surani MA. Maternal microRNAs are essential for mouse zygotic development. Genes Dev (2007) 21:644–648.
Thompson EM, Kallesoe T, Spada F. Diverse genes expressed in distinct regions of the trunk epithelium define a monolayer cellular template for construction of the oikopleurid house. Dev Biol (2001) 238:260–273.[CrossRef][Web of Science][Medline]
Tsang J, Zhu J, van Oudenaarden A. MicroRNA-mediated feedback and feedforward loops are recurrent network motifs in mammals. Mol Cell (2007) 26:753–767.[CrossRef][Web of Science][Medline]
Wray GA, Hahn MW, Abouheif E, Balhoff JP, Pizer M, Rockman MV, Romano LA. The evolution of transcriptional regulation in eukaryotes. Mol Biol Evol (2003) 20:1377–1419.
Zhao T, Li G, Mi S, Li S, Hannon GJ, Wang XJ, Qi Y. A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii. Genes Dev (2007) 21:1190–1203.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  S. C. Bannister, M. L.V. Tizard, T. J. Doran, A. H. Sinclair, and C. A. Smith Sexually Dimorphic MicroRNA Expression During Chicken Embryonic Gonadal Development Biol Reprod, July 1, 2009; 81(1): 165 - 176. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||