MBE Advance Access originally published online on May 19, 2007
Molecular Biology and Evolution 2007 24(8):1731-1743; doi:10.1093/molbev/msm098
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Articles |
Diversification of NRT2 and the Origin of Its Fungal Homolog
* Department of Biology, Clark University
E-mail: jslot{at}clarku.edu.
| Abstract |
|---|
|
|
|---|
We investigated the origin and diversification of the high-affinity nitrate transporter NRT2 in fungi and other eukaryotes using Bayesian and maximum parsimony methods. To assess the higher-level relationships and origins of NRT2 in eukaryotes, we analyzed 200 amino acid sequences from the Nitrate/Nitrite Porter (NNP) Family (to which NRT2 belongs), including 55 fungal, 41 viridiplantae (green plants), 11 heterokonts (stramenopiles), and 87 bacterial sequences. To assess evolution of NRT2 within fungi and other eukaryotes, we analyzed 116 amino acid sequences of NRT2 from 58 fungi, 40 viridiplantae (green plants), 1 rhodophyte, and 5 heterokonts, rooted with 12 bacterial sequences. Our results support a single origin of eukaryotic NRT2 from 1 of several clades of mostly proteobacterial NNP transporters. The phylogeny of bacterial NNP transporters does not directly correspond with bacterial taxonomy, apparently due to ancient duplications and/or horizontal gene transfer events. The distribution of NRT2 in the eukaryotes is patchy, but the NRT2 phylogeny nonetheless supports the monophyly of major groups such as viridiplantae, flowering plants, monocots, and eudicots, as well as fungi, ascomycetes, basidiomycetes, and agaric mushrooms. At least 1 secondary origin of eukaryotic NRT2 via horizontal transfer to the fungi is suggested, possibly from a heterokont donor. Our analyses also suggest that there has been a horizontal transfer of nrt2 from a basidiomycete fungus to an ascomycete fungus and reveal a duplication of nrt2 in the ectomycorrhizal mushroom genus, Hebeloma.
Key Words: nitrate transporter Hebeloma horizontal gene transfer gene duplication ectomycorrhizae
| Introduction |
|---|
|
|
|---|
Nitrogen is a limiting nutrient in most forest soils (Fernandez, Simmons, and Briggs 2000
|
Within fungi, nrt2 homologs have been discovered in diverse lineages of Ascomycota (Hansenula, Aspergillus, Gibberella, Neurospora, and Tuber) and Basidiomycota (Hebeloma, Ustilago, and Phanerochaete) (Perez et al. 1997
Interest in fungal NRT2 has increased with recent discoveries of these transporters in 2 ectomycorrhizal fungi, which form symbiotic associations, generally with roots of vascular plants, and appear to benefit the nitrogen nutrition of the host (Chalot et al. 2002
). The transporters were found in the basidiomycete Hebeloma cylindrosporum (Jargeat et al. 2003
), a model system for nutritional processes in ectomycorrhizal associations (Marmeisse et al. 2004
), and the ascomycete Tuber borchii (Montanini et al. 2006
), which forms economically important truffles.
Our investigations into NRT2 evolution in the fungi have focused on the euagaric (mushroom forming) genus, Hebeloma. Certain members of this ectomycorrhizal genus are adapted to high-nitrogen niches, such as mole latrines, decayed animal carcasses (Sagara 1995
; Suzuki et al. 2003
), and anthropogenic ammonium gradients (Lilleskov et al. 2002
), from which nitrogen can be delivered to the host plant. A clear understanding of Hebeloma phylogeny for evolutionary analyses of these ecological characters is not yet available (Aanen et al. 2000
; Boyle et al. 2006
). Future analyses of nrt2 nucleotide sequences may improve resolution in Hebeloma phylogeny and address the question of a selective influence of nitrate in these transitions. Here, we present phylogenetic analyses of new NRT2 amino acid sequences from Hebeloma and other fungi, as well as published sequences from diverse eukaryotes and prokaryotes, which raise provocative questions about the evolution of the nitrate acquisition apparatus in fungi: Is fungal nrt2 secondarily derived from other eukaryotic sequences? Has high affinity nitrate transport been acquired horizontally within the fungi?
| Materials and Methods |
|---|
|
|
|---|
DNA Extraction
We sampled cultures and fruiting bodies of 10 species of Basidiomycota from the genera Hebeloma, Gymnopilus, and Laccaria, which were identified with reference to Smith (1984)
Degenerate PCR and Sequencing
We designed degenerate primers (fig. 1B; Primers 5' to 3':F1 ggygcrccraarttyaartgg, F2 ggnggngcnacnttygcnathatg, F3 acnttygtnccntgycargcntgg, F4 aycayccngcnggnaartgg, R1.5 ytgraanarnrwngtcatdatngcg, HR2 gaggaccccaaaataaccgc, R2.2 agctgcgcccatgattagacc, R2.6 ngcraarttngcnccrttncc, R3 nswdatracncccatdatcc) based on the Hebeloma cylindrosporum NRT2 sequence (Jargeat et al. 2003
). We performed PCR on a MJ Research PTC200 thermocycler. The program used a 2-min initial denaturation step at 95°C followed by 40 cycles of 30 s at 94°C, 30 s at a temperature from 55°C to 45°C (depending on primers and success), 90 s at 72°C, and a final elongation step at 72°C for 10 min. PCR products were screened by agarose gel electrophoresis and cleaned with Pellet Paint NF coprecipitant (Novagen, San Diego, CA). Some products required gel purification to separate multiple bands, and we purified those products using a GENECLEAN kit (Bio101 Systems Products, Qbiogene, Vista, CA). We cloned all products into the TA or TOPO TA cloning kit (Invitrogen, Carlsbad, CA). For each cloning reaction, we screened at least 10 positive clones by PCR product size (using M13 primers) on an agarose gel, and sequenced 3–5 positive clones with full, bidirectional coverage on either an ABI 377 or 3700 automated DNA sequencer using ABI Prism Terminator BigDye ver1.1 or 3.1 (Applied Biosystems, Foster City, CA). Sequences were edited, and contigs were assembled using Sequencher version 4.1.2 (Gene Codes Corporation, Ann Arbor, MI, 1991-2000).
Database Searches for nrt2 Homologs
We used the tBlastn program (Altschul et al. 1997
) with Aspergillus nidulans and Hebeloma cylindrosporum translated nrt2 sequences as queries against all public fungal genome projects and trace archives (as of June 2006), selecting sequences with greater than 50% similarity to the query at the amino acid level. We obtained 19 unique, putative nrt2 homologs from fungal genome projects of 15 species from 11 genera, including Laccaria bicolor (http://mycor.nancy.inra.fr/ectomycorrhizadb/), Coprinopsis cinerea (http://www.broad.mit.edu/annotation/genome/coprinus_cinereus/Home.html), Phanerochaete chrysosporium (http://genome.jgi-psf.org/whiterot1/whiterot1.home.html), Aspergillus terreus (http://www.broad.mit.edu/annotation/genome/aspergillus_terreus/Home.html), Aspergillus oryzae (http://www.bio.nite.go.jp/dogan/MicroTop?GENOME_ID=ao), Aspergillus flavus (http://www.aspergillusflavus.org/genomics/), Neosartorya fischeri (http://www.tigr.org/), Botryotinia fuckeliana (http://www.broad.mit.edu/annotation/genome/botrytis_cinerea/Home.html), Sclerotinia sclerotiorum (http://www.broad.mit.edu/annotation/genome/sclerotinia_sclerotiorum/Home.html), Phaeosphaera nodorum (http://www.broad.mit.edu/annotation/genome/stagonospora_nodorum/Home.html), Gibberella zeae (http://www.broad.mit.edu/annotation/genome/fusarium_graminearum/Home.html), Chaetomium globosum (http://www.broad.mit.edu/annotation/genome/chaetomium_globosum/Home.html), Magnaporthe grisea (http://www.broad.mit.edu/annotation/fungi/magnaporthe/), and Trichoderma reesei (http://genome.jgi-psf.org/Trire2/Trire2.home.html). An additional homolog was obtained from the rust fungus, Leucosporidium scottii EST database (https://fungalgenomics.concordia.ca/fungi/Lsco.php). We searched Glomus intraradices (http://darwin.nmsu.edu/
fungi/), Rhizopus oryzae (Zygomycota, http://www.broad.mit.edu/annotation/genome/rhizopus_oryzae/Home.html), and Batrachochytrium dendrobatis (Chytridiomycota, http://www.broad.mit.edu/annotation/genome/batrachochytrium_dendrobatidis) data in GenBank and elsewhere. Additionally, we obtained sequences from Galdieria sulphuraria (http://genomics.msu.edu/galdieria), Cyanidioschyzon merolae (http://merolae.biol.s.u-tokyo.ac.jp/), Phytophthora ramorum (http://genome.jgi-psf.org/Phyra1_1/Phyra1_1.home.html), and Phytophthora sojae (http://genome.jgi-psf.org/Physo1_1/Physo1_1.home.html) genome projects. We searched the Taxonomically Broad EST Database (TbestDB, http://tbestdb.bcm.umontreal.ca/). We also searched for hypothetical proteins from environmental sequences in the Sargasso Sea Marine Microbial Community genome project, and we searched GenBank for sequences annotated as eukaryotic and prokaryotic nitrate/nitrite transporter sequences (supplementary table 1) from the MFS. Sequences from these latter sources were included if they shared >40% (in an NNP family alignment, see below) or >50% (in a Eukaryotic NRT2 alignment) amino acid sequence similarity and possessed (when sequences were complete) 12 transmembrane helices (inferred by HMMTOP 2.0, Tusnády and Simon, 2001
, http://www.enzim.hu/hmmtop/) and NNP and MFS signature sequences. Sequences with lower similarity to the query were initially considered when found; however we determined by reciprocal Blast that these generally fell into other subfamilies within the MFS, lacked NNP family signature sequences, and were not alignable with NNP family sequences. The size of most retained sequences ranged from 60% to 100% of the estimated complete protein sequence.
Alignment
We inferred spliceosomal intron (fig. 1C) boundaries with reference to existing amino acid sequences from Basidiomycota (Jargeat et al. 2003
) and Ascomycota (Unkles et al. 1991) and translated the exons with the EXPASY Translate Tool (http://www.Expasy.org). A set of sequences representative of plant and fungal diversity was aligned with Clustal X (Thompson, Plewniak, and Poch 1999
) and adjusted manually in MacClade v. 4.07 (Maddison and Maddison 2001
). New sequences were added manually to the existing alignment. Prokaryotic sequences were analyzed for transmembrane helix topology (Tusnády and Simon 2001
) to aid alignment with eukaryotic sequences, and conserved NNP and MFS signature motifs in the fifth and eleventh transmembrane domains (Forde 2000
) were used as anchor positions for alignment of diverse prokaryotic clades. Ambiguously aligned positions were excluded from phylogenetic analyses.
Phylogenetic Analyses
We constructed 2 separate NRT2 alignments for phylogenetic analyses at different taxonomic scales, including (1) prokaryotes and eukaryotes (the NNP family alignment) and (2) eukaryotes only, rooted with closely related prokaryotes inferred from the larger analysis (Eukaryotic NRT2 alignment).
NNP Family Alignment
The NNP family alignment contained 200 amino acid sequences, including 55 fungal, 41 viridiplantae, 11 heterokont, and 87 bacterial sequences. We conducted a Bayesian analysis in MrBayes 3.1 (Huelsenbeck and Ronquist 2001
) using mixed protein models for 1 million generations sampling every 100 generations. Likelihood tree scores of 2 independent runs were plotted to estimate the point of convergence to a stable likelihood. Trees from both runs were combined, and Bayesian posterior probabilities were calculated by computing a 50% majority rule consensus of 10,000 trees remaining after 5,002 trees were removed as the burnin. We conducted an equally weighted maximum parsimony bootstrap analysis in Paup* 4.0b (Swofford 2002
) using a heuristic search, with TBR branch swapping and 1,000 stepwise addition replicates, saving 10 trees per replicate. Trees were rooted with a divergent clade of bacterial nitrate/nitrite transporter/extruder sequences from the Proteobacteria, Actinobacteria, and Deionococcus-Thermus groups. Clades that received greater than 0.95 Bayesian posterior probabilities (BPP) or 50% bootstrap support (MPB) were considered to have significant support.
Eukaryotic NRT2 Alignment
The eukaryote alignment contained 116 amino acid sequences including 58 from fungi, 40 from green plants and green algae, 1 from rhodophytes, 5 from heterokonts, and 12 bacterial sequences that were included for rooting purposes. We conducted a maximum parsimony analysis with 500 random addition sequence replicates, saving 10 trees per replicate, swapping branches via TBR on best trees. A Bayesian analysis and a maximum parsimony bootstrap analysis were conducted as described above. We also conducted parsimony analyses under constraints, which forced heterokont sequences to be monophyletic or forced heterokonts to form a clade with green plants (no other topological features were specified). Differences in parsimony scores for the resulting topologies were evaluated with the Kishino-Hasegawa test.
| Results |
|---|
|
|
|---|
NRT2 Sequences
We obtained 27 unique partial NRT2 sequences, ranging between 194 and 484 amino acids in length, from Gymnopilus, Hebeloma, and Laccaria, including 2 divergent sequences obtained from Hebeloma helodes (tables 1 and 2). Sequences obtained from genome projects and whole genome shotgun sequences were generally complete with a length of approximately 500 amino acids (table 2). We obtained multiple sequences for individual strains of Ascomycota from genome projects. We recovered nrt2 homologs from all complete filamentous ascomycete and basidiomycete genomes listed in table 2, but not from Cryptococcus (Basidiomycota), Rhizopus (Zygomycota), Glomus (Glomeromycota), or most Saccharomycotina (Ascomycota) genomes/EST databases, with Pichia angusta as the exception. The amino acid sequence with greatest similarity to the query retrieved from Rhizopus oryzae was 45% similar to the second half of the query, and 50% similar to a monocarboxylate transporter from Aspergillus oryzae (GenBank accession XM_715677 [GenBank] ). The amino acid sequence with greatest similarity to the query from Batrachochytrium dendrobatis (November 2006) was 55% similar to approximately 150 amino acids from the second half of the query and 50% similar to a mammalian monoamine transporter (GenBank accession XM_001100696). All fungal sequences contained the fungus-specific large intracellular loop (Forde 2000
|
|
Spliceosomal Intron Positions in the Fungi
We inferred 22 intron positions (fig. 1C) in our analyses of fungal nrt2 sequences, all of which began with "gt-" and ended with "-ag." We assigned the introns identified by Jargeat et al. (2003)
In general, closely related fungi have similar intron patterns (fig. 1C). For example, all members of the euagarics clade (Hebeloma, Gymnopilus, Coprinopsis, Laccaria) share introns 1, 2, 3, 4, 5, 6, and 7. Gymnopilus also displays a potential eighth position (4C) between introns 4 and 5. In contrast, the basidiomycete Phanerochaete, a member of the Polyporales, has no intron positions in common with the euagarics, or the corn smut basidiomycete Ustilago maydis, which has only 1 intron, here labeled 4B. It is therefore significant that Ustilago maydis and Trichoderma reesei (asexual Ascomycota) have an identical pattern of introns, which supports a basidiomycetous origin of the T. reesei sequence (see below).
Phylogenetic Analyses
NNP Family Alignment
The amino acid alignment of prokaryotic and eukaryotic NNP family sequences was 1,983 positions long. Unambiguously aligned positions numbered 1,156, and 911 of these positions were parsimony informative. Alignment length was inflated by the presence of clade-specific extended N- and C-terminal domains that were excluded from analyses and by small regions that could be aligned within, but not between major clades. The average likelihood score for credible trees from both Bayesian analyses was –153798.09. Cyanobacteria sequences (98% MPB, 1.0 BPP) and a clade of predominantly actinobacteria sequences (75% MPB, 1.0 BPP) including sequences from the nitrogen-fixing Frankia sp. and the nitrogen-fixing alpha-proteobacterium, Bradyrhizobium japonicum, were each supported as monophyletic (fig. 2). Analyses also supported multiple distinct clades of proteobacterial proteins containing alpha-, beta-, gamma-, and delta- proteobacteria. Also supported by our analyses were 2 lineages of gamma proteobacteria sequences that form a clade with the cyanobacteria (100% MPB, 1.0 BPP). A eukaryotic clade including viridiplantae and other photosynthetic eukaryote, heterokont and fungal sequences received strong support from Bayesian analysis (1.0 BPP) and weak support from parsimony bootstrap analysis (59% MPB). A bacterial sister group to the eukaryotic sequences, including several beta and gamma proteobacteria including Burkholderia species and Cytophaga hutchinsonii and the alpha proteobacterium, Roseobacter, received support from maximum parsimony bootstrap analysis (98% MPB), while a less inclusive sister group including Burkholderia spp. (beta proteobacteria) received strong support from Bayesian analysis (1.0 BPP) and did not receive maximum parsimony bootstrap support.
|
Eukaryote Alignment (NRT2 Phylogeny)
The eukaryote NRT2 amino acid alignment was 1,079 positions long, of which we included 741 unambiguous positions. Parsimony informative characters numbered 622. Maximum parsimony analysis resulted in 26,804 most parsimonious trees with a score of 7,302. The average likelihood score for credible trees from both Bayesian analyses was –39432.766. Results of these analyses are presented (fig. 3). Viridiplantae received strong support (100% MPB, 1.0 BPP), and heterokonts + fungi received strong support from Bayesian analysis (BPP 1.0), but not by maximum parsimony bootstrap analysis. Plants, fungi, diatoms, and Phytophthora (oomycetes) all received strong support in the Bayesian analysis (1.0 BPP) and maximum parsimony (100% MPB). The heterokonts were resolved as paraphyletic, with the fungi nested within the clade. The Kishino-Hasegawa test did not detect a significant difference between the optimal (unconstrained) topology and topologies that forced heterokonts to be monophyletic or sister to green plants. Three well-supported clades in the viridiplantae include mosses, represented by 5 sequences from Physcomitrella (87% MPB, 1.0 BPP), dicots (68% MPB, .97 BPP), including Brassicales, Papillionoideae, and Euasterids, and monocots, represented by the Poaceae (98% MPB, 1.0 BPP).
|
NRT2 Phylogeny within Fungi
Within the Fungi, Ascomycota (90% MPB, 1.0 BPP) and Basidiomycota (73% MPB, 1.0 BPP) NRT2 sequences were strongly supported as monophyletic. The 1 exception was the Trichoderma reesei (Ascomycota) sequence, which formed a clade (100% MPB, 1.0 BPP) with Ustilago maydis (Basidiomycota). Within Ascomycota, our analyses recovered the Sordariomycetes (90% MPB, 1.0 BPP), Aspergillus/Neosartorya (94% MPB, 1.0 BPP), and Helotiales (100% MPB, 1.0 BPP) as monophyletic, with the exception of the aforementioned Trichoderma sequence, which did not form a clade with other Sordariomycetes, contrary to expectation based on organismal phylogeny. The Pezizomycetes and Dothideomycetes each had only 1 representative species (Tuber borchii and Phaeosphaeria nodorum, respectively), and both received moderate support for monophyly with Eurotiomycetes (represented by Aspergillus and Neosartorya) and Leotiomycetes (represented by Botryotinia and Sclerotinia).
Basidiomycota NRT2 phylogeny included 4 genera of euagarics, 1 polypore, 1 pucciniomycete (Leucosporidium scottii), and 1 ustilaginomycete (Ustilago maydis). Agaricales (euagarics clade) received strong support for monophyly (99% MPB, 1.0 BPP). A Hebeloma clade (96% MPB, 1.0 BPP) and a Laccaria clade (100% MPB, 1.0 BPP) also received support. Hebeloma helodes, H. tomentosum-like, H. velutipes, H. radicosum, and H.truncatum formed a clade that was poorly supported by maximum parsimony bootstrap analysis but well supported by Bayesian analysis (52% MPB, 1.0 BPP) that excluded H. edurum and H. cylindrosporum.
| Discussion |
|---|
|
|
|---|
Where resolved, the NRT2 phylogeny in eukaryotes generally tracks accepted organismal relationships, but the NNP phylogeny in prokaryotes conflicts with accepted taxonomy. These findings suggest a more complex history involving ancient duplications and/or horizontal gene transfer. Below, we first discuss relationships of the entire NNP family across prokaryotes and eukaryotes, then consider evolution of NRT2 in fungi and other eukaryotes.
NNP Phylogeny
Ancient NNP family divergence events are apparent in the prokaryotes, leading to well-supported clusters of nitrate transport–associated proteins that are not necessarily restricted to specific clades of bacteria. Proteobacterial sequences represent the majority of the apparent diversity of these transporters. Bayesian and maximum parsimony analyses (fig. 2) support a single bacterial origin of the eukaryotic NRT2 protein, with the closest prokaryotic relatives in a well-supported clade of nitrate transporters including the alpha proteobacterium, Roseobacter. This is consistent with an endosymbiotic transfer of nrt2 from the mitochondrion (of alpha-proteobacterial lineage) to the nucleus, or with a more recent transfer from endoproteobacteria, such as Burkholderia spp. The only marginally similar Archaea sequence available, from Haloarcula marismortui (AY596297
[GenBank]
), shared 38% sequence similarity at the amino acid level, and consequently we have no evidence of a nuclear origin of the gene. Our analysis is consistent in overall phylogenetic topology with Forde's (2000)
analysis of nitrate transporters in plants, and also with Pao, Paulsen, and Saier's (1998) analysis of the Nitrate Nitrite Porter Family, although we excluded Mycoplasma sequences due to high divergence and ambiguous alignment. Highly similar sequences are notably absent from fungi outside the Ascomycota and Basidiomycota (together the Dikarya clade) and animal genome databases. This suggests either that the early lineages of opisthokonts (animals, choanoflagellates, microsporidia and fungi) lacked nrt2, which was independently acquired in the common ancestor of Ascomycota and Basidiomycota, or that there were at least 7 losses in the opisthokonts according to a recent molecular phylogeny of this clade (James et al. 2006
). We discuss fungal origins in more detail below.
NRT2 Phylogeny in Photosynthetic Eukaryotes
NRT2 phylogeny in viridiplantae (fig. 3) tracks accepted organismal phylogeny. On a broad basis, our analyses support plants as monophyletic, while green algae form a paraphyletic group from which the plants are derived. Mosses (represented by Physcomitrella) receive good support to be sister to vascular plants, and the division of monocots and eudicots also receives strong support. These results are consistent with morphological and molecular taxonomy in the plants (Palmer, Soltis, and Chase 2004
). Within the grass clade (99% MPB, 1.0 BPP) in our dataset, Oryza received weak support as monophyletic with Zea and Phragmites (64% MPB, 1.0 BPP), which is in conflict with the suggestion of a BEP (Bambusoideae, Ehrhartoideae, and Pooideae) clade (Gaut 2002
) including rice, oats, barley, and wheat inferred from certain chloroplast genes. The placement of Daucus within a strongly supported clade of Solanaceae (99% MPB, 1.0 BPP) is consistent with the Asterid clade of dicots (Hilu et al. 2003
). While maximum parsimony did not support deep relationships between green plants, rhodophytes, heterokonts, and fungi, Bayesian analysis suggests that certain heterokonts, represented by the oomycete lineage, Phytophthora, may be sister to the fungi (0.97 BPP), causing heterokonts to be paraphyletic. Improved sampling of rhodophyte and heterokont NRT2 may improve support for deep relationships in the eukaryotes.
The Origins of Eukaryotic and Fungal NRT2
Our analyses suggest a heterokont (diatoms + oomycetes) origin of fungal nrt2 (fig. 3). Within the fungi, NRT2 appears to track currently accepted organismal phylogeny, with 1 exception, discussed below, which suggests horizontal gene transfer.
Eukaryotic organismal phylogeny remains poorly resolved in deeper nodes (Baldauf 2003
; Keeling et al. 2005
). The phylogeny of Cavalier-Smith (2002
; adapted in fig. 4) suggests that the chromalveolate (heterokonts + alveolates) clade is the sister group of Plantae (rhodophytes + green plants), and that the opisthokonts (fungi, animals, and choanoflagellates) form a separate clade. The chromalveolate + Plantae clade has received weak support from molecular analyses (Steenkamp, Wright, and Baldauf 2006
). The chromalveolate clade has received some support from multigene phylogenies (e.g. Harper, Waanders, and Keeling 2005
; Steenkamp, Wright, and Baldauf 2006
), and the opisthokonts form a strongly supported clade that is distinct from plants and heterokonts (Steenkamp, Wright, and Baldauf 2006
). The most parsimonious explanation (fig. 4-1) for the occurrence of nrt2 under this topology requires 2 gains of nrt2 (in Dikarya and chromalveolate + Plantae) and 1 loss (in alveolates). We leave the alveolate dinoflagellate Heterocapsa triquetra EST sequence out of this discussion, because its placement is not resolved in the NNP phylogeny, and also because it is uncertain whether its nrt2 sequence is of host or plastid origin. To assume a single eukaryotic origin under this topology (fig. 4-2) would require at least 8 losses (1 in alveolates and 7 in the opisthokont clade). It is equally parsimonious to infer vertical inheritance of nrt2 in the heterokonts as to infer secondary origin from another source. To not assume a chromalveolate + Plantae clade might require a less parsimonious reconstruction of nrt2 origins if the sister of either clade lacked nrt2, thereby implying additional losses. However, the topology could be explained less parsimoniously in this case by acquisition of nrt2 from a rhodophyte plastid that was subsequently lost in oomycetes (Andersson and Roger 2002
; Nozaki et al. 2004
). A recent phylogeny of glutamine synthetase II (GSII), a protein involved in nitrogen assimilation with a more universal eukaryotic distribution, supported the opisthokont and heterokont + Plantae clades (Robertson and Tartar 2006
), but is also consistent with a GSII transfer to the heterokonts from the red algal endosymbiont.
|
Based on our survey of genome and EST data and sequences in GenBank, nrt2 appears to be absent from nonphotosynthetic and parasitic Alveolata and most major clades of Opisthokonts, other than the Dikarya. These observations, coupled with the eukaryote phylogeny illustrated in fig. 4, suggest 5 hypotheses that could explain the present distribution of nrt2 in the eukaryotes:
- NRT2 was acquired once in the eukaryotes, in a common ancestor of the Chromalveolata + Plantae. There was at least 1 loss of NRT2, on the lineage leading to Alveolata, and 1 horizontal transfer event, from the heterokonts to Dikarya (Fungi). This scenario requires 1 origin in eukaryotes, 1 loss, and 1 horizontal transfer (3 events).
- NRT2 was acquired once in eukaryotes, in the lineage leading to the Plantae, followed by horizontal transfer to the heterokonts, and then to the Diakrya. This scenario requires 1 origin in eukaryotes and 2 horizontal transfers (3 events).
- NRT2 was acquired once in the common ancestor of the Dikarya, with 1 horizontal transfer to the common ancestor of Chromalveolata and Plantae, and 1 loss in the Alveolata. This scenario also requires 1 origin in eukaryotes, 1 loss, and 1 horizontal transfer (3 events).
- NRT2 was acquired independently 3 times within eukaryotes, with no losses or horizontal transfers (3 events). Both plants and fungi are known to harbor intracellular proteobacteria related to taxa shown in the eukaryotic phylogeny (Coenye and Vandamme 2003
; Bertaux et al. 2005
; Artursson, Finlay, and Janson 2006
). In this scenario, a certain level of convergent modification to the sequences in the eukaryotic hosts, or failure to sample the relevant proteobacterial sequences would be required to explain the support for more similar eukaryotic sequences.
- NRT2 was acquired once in the lineage leading to the common ancestor of Fungi, Plantae, and Chromalveolata, with multiple losses within eukaryotes. Major environmental events could have provided substantial selective pressure to favor the loss of the ability to assimilate nitrate in favor of assimilation of more highly reduced forms of nitrogen. This scenario requires 1 origin in eukaryotes and at least 8 losses (at least 9 events). The lineages in which we found nrt2 homologs are osmotrophic (except for the mixotrophic chlorarachniophyte, Bigelowiella natans), whereas the lineages in which we did not are phagotrophic (with the exception of certain fungi). It is possible that the loss of nrt2 coincided with a transition to phagotrophy in some lineages (animals, alveolates, etc.) Alternatively, the gain of nrt2, and other osmotrophy-related sequences may have coincided with the transition to osmotrophy in the fungi.
Hypotheses 1–4 each require 3 events (horizontal transfers or gene losses), whereas hypothesis 5 is by far the least parsimonious scenario. Hypotheses 1–3 each suggest a single origin of nrt2 in the eukaryotes, which is consistent with the monophyly of eukaryotic nrt2 sequences. Hypotheses 1 and 2 are most consistent with the phylogeny of nrt2 in eukaryotes, which suggests that fungal sequences are nested within heterokont sequences. A further argument against hypothesis 3 (origin within Dikarya) is that the Intracellular loop that is unique to Fungi would have to be lost prior to the transfer from Fungi to the common ancestor of Chromalveolata + Plantae, which would imply a reduced probability of maintaining folding kinetics and pore formation after excision of the internal sequence; it is simpler to infer that this unique sequence element evolved once within the Fungi and has not been lost. By this reasoning, hypotheses 1 and 2 are equally plausible scenarios. Thus, we infer that there was a single origin of NRT2 in the Dikarya, and that it was derived from heterokonts via horizontal transfer.
The gain of a high-affinity nitrate transporter in Dikarya could have conferred selective advantage to certain fungi in an environment with increased nitrification due to elevating atmospheric oxygen. It has been convincingly argued that the accumulation of oxygen in the neoproterozoic (Kennedy et al. 2006
) contributed to an explosion of metabolic complexity that is independent of organismal phylogeny (Falkowski 2006
; Raymond and Segrè 2006
). Molecular clock analyses of nuclear proteins and ribosomal genes suggest that the divergence of Dikarya from other fungi occurred during (Douzery et al. 2004
; Berney and Pawlowski 2006
) or before (Heckman et al. 2001
; Hedges et al. 2004
; Padovan et al. 2005
) this period of massive oxygen accumulation and may correspond to a fungus-plant colonization of land (Heckman et al. 2001
). It is in Dikarya as well that we find the greatest fungal diversity of symbioses with oxygen-producing autotrophs, and we observe
98% of the known diversity of filamentous fungi in ascomycetes and basidiomycetes (James et al. 2006
). The fact that glomalean fungal symbionts of plants utilize nitrate as well (Govindarajulu et al. 2005
), apparently without this particular transporter, could argue for the selective advantage of utilizing the oxidized form of nitrogen in an oxygen-rich environment. Fungi appear to have colonized dry land more than once (James et al. 2006
), perhaps facilitated by acquisition of novel metabolic traits from bacterial symbionts. It is possible that another nitrate transporter is active in Glomus; however, in searches of the Glomus EST database (data not shown) we were unable to find a homolog of the formate-nitrate transporter (FNT), another known conduit of nitrate. Glomus intraradices prefers ammonium nitrogen to nitrate (Toussaint, St-Arnaud, and Charest 2004
), and an ammonium transporter has recently been characterized (López-Pedrosa et al. 2006
). We were also able to recover a single homolog of fungal amino acid transporters (AMT).
Fungi are particularly versatile in the acquisition of nitrogen from the environment. They express genes for uptake of inorganic (nitrate and ammonium) and organic (urea, amino acids, methylammonium, and peptides) forms of nitrogen (Marzluf 1997; Divon and Fluhr 2007). A diversity of nitrogen acquisition strategies appears to apply to pathogenic and mutalistic (mycorrhizal and lichen-forming) fungi alike (Hawkins, Johansen, and George 2000
; Chalot et al. 2002
; Dahlman, Persson, and Palmqvist 2004
; Divon and Fluhr 2007), and a search of the genome of the wood-rotting fungus Phanerochaete chrysosporium genome project (http://genome.jgi-psf.org/Phchr1/Phchr1.home.html) reveals nitrate, ammonium, amino acid, and peptide transporter homologs (data not shown). Plants and green algae, in contrast, devote substantially more regulation to nitrate and ammonium transporters of differential affinities and possibly subfunctions (Glass et al. 2002
; Orsel, Krapp, and Daniel-Vedele 2002
; Forde and Cole 2003
; Couturier et al. 2007
), suggesting they are more specialized on these inorganic forms of nitrogen. Soil nitrogen makeup is highly dynamic and subject to patchiness (Steltzer and Bowman 1998
) and seasonal variation in nitrification (Gosz and White 1986
). In most soils, nitrogen is a limiting nutrient (Fernandez, Simmons, and Briggs 2000
), so a diversity of uptake mechanisms may make fungi more competitive as nitrogen pools shift with temperature and moisture variation. Nitrate assimilation in fungi is highly regulated and repressed by the presence of more readily utilized forms of nitrogen such as ammonium (Marzluf 1997; Jargeat et al. 2003
). That the acquisition of nitrate should be so widespread in Dikarya suggests it is at times favorable to invest the additional energy to reduce nitrate to ammonium. For example, lichens have been shown to absorb nitrate leached from their host trees during winter precipitation (Levia 2002
).
Fungal NRT2 sequences in our sample form 2 well-supported clades under multiple analyses that correspond to the Ascomycota and Basidiomycota with the exception of the well-supported placement of the Sordariomycete, Trichoderma reesei, NRT2 with Ustilago maydis, near the root of the Basidiomycota. Trichoderma, the asexual phase of the genus Hypocrea (Samuels 2006
) is well supported to be in the Sordariomycetes (James et al. 2006
). NRT2 from all other Sordariomycetes cluster together with strong support within Ascomycota. Thus, the placement of T. reesei suggests horizontal transmission of nrt2 from Basidiomycota to Ascomycota. Within Ascomycota, our analyses have recovered strong support for Eurotiomycetes, Sordariomycetes, and Leotiomycetes with a limited sample according to the clades described in Lutzoni et al. (2004)
. Within the Basidiomycota, this analysis provided little support for higher-level relationships, although there is strong support for a single origin of NRT2 in the Agaricales and in the 2 Agaricales genera represented by more than 1 taxon, Laccaria and Hebeloma.
Gene Duplications
Gene duplications are a source of evolutionary novelty (Zhang 2003
). The diversification of nrt2 in fungi is not surprising considering the example of plants where diversification of this gene has led to divergent function (Orsel, Krapp, and Daniel-Vedele 2002
; Little et al. 2005
). Nrt2 paralogs in Aspergillus nidulans were shown to code for proteins of differential affinity for nitrate (Unkles et al. 2001
). The NRT2 phylogeny we present here suggests at least 3 duplications have occurred in the fungi (fig. 3). One duplication is supported to have occurred prior to diversification of Aspergillus, with 4 species maintaining both paralogs. Aspergillus flavus may contain an additional paralog; however these are 2 incomplete sequences that do not overlap, and so appear to be the same gene based on phylogenetic proximity. Montanini et al. (2006)
did not report paralogous forms in Tuber, which is sister to Aspergillus in our analysis; however this could be due to gene loss or failure to detect, and consequently we cannot rule out a more ancient duplication. The other Ascomycete duplication suggested by the phylogeny appears prior to the diversification of the Sordariomycetes, with 2 distinct copies found in Chaetomium globosum; however there are currently no sequences from additional species to confirm that this is the point of duplication.
The duplication of nrt2 that we have discovered in Hebeloma helodes is the first such report in mycorrhizal fungi and in the basidiomycetes. Amino acid analyses place the second copy as sister to the remaining Hebeloma sequences. However, we recovered no paralogous forms in other Hebeloma species as would be expected with an early duplication. Furthermore, Jargeat et al. (2003)
suggested that there is only 1 copy in H. cylindrosporum. We could have failed to detect additional paralogs with our methods and should confirm these results with Southern blots to determine copy number in other Hebeloma. Due to the possibility of differential rates of evolution between paralogs due to selection, we cannot rule out a more recent duplication of nrt2 in Hebeloma, and preliminary nucleotide analyses may suggest this is the case (Slot, unpublished data). Analyses of an expanded dataset of nrt2 nucleotides and expression patterns will attempt to improve our understanding of Hebeloma phylogeny and address functional divergence and lineage sorting of nitrate transporter isoforms in Hebeloma.
| Acknowledgements |
|---|
|
|
|---|
We thank Dr. Manfred Binder and Dr. Zheng Wang for help with analysis and critical discussion. We also thank Dr. Deborah Robertson for discussions of the evolution of eukaryotes and nitrogen metabolism genes, and 2 anonymous reviewers for their detailed, constructive comments. This work was made possible by a National Science Foundation Doctoral Dissertation Improvement grant (DEB0608017, to D.S.H. and J.C.S.) and the Assembling the Fungal Tree of Life project (supported by NSF award DEB0228657, to D.S.H.).
| Footnotes |
|---|
Charles Delwiche, Associate Editor
| References |
|---|
|
|
|---|
Aanen DK, Kuyper TW, Boekhout T, Hoekstra RF. Phylogenetic relationships in the genus Hebeloma based on ITS1 and 2 sequences, with special emphasis on the Hebeloma crustuliniforme complex. Mycologia (2000) 92:269–281.[CrossRef][Web of Science]
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. (1997) 25:3389–3402.
Amarasinghe BH, de Bruxelles GL, Braddon M, Onyeocha I, Forde BG, Udvardi MK. Regulation of GmNRT2 expression and nitrate transport activity in roots of soybean (Glycine max). Planta (1998) 206:44–52.[CrossRef][Web of Science][Medline]
Andersson JO, Roger AJ. A cyanobacterial gene in non-photosynthetic protists-and early chloroplast acquisition in eukaryotes? Curr Biol. (2002) 12:115–119.[CrossRef][Web of Science][Medline]
Araki R, Mori M, Mori M, Hasegawa H. Genetic differences in nitrate uptake in two clones of the common reed, Phragmites australis. Breed Sci. (2005) 55:297–302.[CrossRef]
Artursson V, Finlay RD, Janson JK. Interactions between arbuscular mycorrhizal fungi and bacteria and their potential for stimulating plant growth. Envir Microbiol. (2006) 8:1–10.[CrossRef]
Baldauf SL. The deep roots of eukaryotes. Science (2003) 300:1703–1706.
Berney C, Pawlowski J. A molecular time-scale for eukaryote evolution recalibrated with the continuous microfossil record. Proc Biol Sci. (2006) 273:1867–1872.
Bertaux J, Schmid M, Hutzler P, Hartmann A, Garbaye J, Frey-Klett P. Occurrence and distribution of endobacteria in the plant-associated mycelium of the ectomycorrhizal fungus Laccaria bicolor. Envir Microbiol. (2005) 7:1786–1795.[CrossRef]
Boyle H, Zidmars B, Renker C, Buscot F. A molecular phylogeny of Hebeloma species from Europe. Mycol Res. (2006) 110:369–380.[CrossRef][Web of Science][Medline]
Cavalier-Smith T. The phagotrophic origin of eukaryotes and phylogenetic classification of Protozoa. Int J Syst Evol Microbiol. (2002) 52:297–354.[Abstract]
Chalot M, Javelle A, Blaudez D, Lambilliote R, Cooke R, Sentenac H, Wipf D, Botton B. An update on nutrient transport processes in ectomycorrhizas. Plant Soil (2002) 244:165–175.[CrossRef][Web of Science]
Coenye T, Vandamme P. Diversity and significance of Burkholderia species occupying diverse ecological niches. Environ Microbiol. (2003) 5:719–721.[CrossRef][Medline]
Collier MD, Fotelli MN, Nahm M, Kopriva S, Rennenberg H, Hanke DE, Geßler A. Regulation of nitrogen uptake by Fagus sylvatica on a whole plant level—interactions between cytokinins and soluble N compounds. Plant Cell Envir (2003) 12:1549–1560.
Couturier J, Montanini B, Martin F, Brun A, Blaudez D, Chalot M. The expanded family of ammonium transporters in the perennial poplar plant. New Phytol (2007) 174:137–150.[CrossRef][Web of Science][Medline]
Dahlman L, Persson J, Palmqvist K. Organic and inorganic nitrogen uptake in lichens. Planta (2004) 219:459–467.[Web of Science][Medline]
Divon HH, Fluhr R. Nutrition acquisition strategies during fungal infection of plants. FEMS Microbiol Lett. (2007) 266:65–74.[CrossRef][Web of Science][Medline]
Douzery EJ, Snell EA, Bapteste E, Delsuc F, Philippe H. The timing of eukaryotic evolution: Does a relaxed molecular clock reconcile proteins and fossils? Proc Natl Acad Sci USA (2004) 101:15386–15391.
Falkowski PG. Tracing oxygen's imprint on Earth's metabolic evolution. Science (2006) 311:1724–1725.
Faure-Rabasse S, Le Deunff E, Lainé P, Macduff JH, Ourry A. Effects of nitrate pulses on BnNRT1 and BnNRT2 genes: mRNA levels and nitrate influx rates in relation to the duration of N deprivation in Brassica napus L. J Exp Bot (2002) 53:1711–1721.
Fernandez IJ, Simmons JA, Briggs RD. Indices of forest floor nitrogen status along a climate gradient in Maine. USA. Forest Ecol Manag (2000) 134:177–187.[CrossRef]
Forde BG. Nitrate transporters in plants: Structure, function and regulation. Biochim Biophys Acta (2000) 1465:219–235.[Medline]
Forde BG, Cole JA. Nitrate finds a place in the sun. Plant Physiol (2003) 131:395–400.
Fraisier V, Gojon A, Tillard P, Daniel-Vedele F. Constitutive expression of a putative high-affinity nitrate transporter in Nicotiana plumbaginifolia: Evidence for post-transcriptional regulation by a reduced nitrogen source. Plant J (2000) 23:489–496.[CrossRef][Web of Science][Medline]
Gao-Rubinelli F, Marzluf GA. Identification and characterization of a nitrate transporter gene in Neurospora crassa. Biochem Genet. (2004) 42:21–34.[CrossRef][Web of Science][Medline]
Gaut BS. Evolutionary dynamics of grass genomes. New Phytol (2002) 154:15–28.[CrossRef][Web of Science]
Glass ADM, Britto DT, Kaiser BN. (11 co-authors). The regulation of nitrate and ammonium transport systems in plants. J Exp Bot (2002) 53:855–864.
Gosz JR, White CS. Seasonal and annual variation in nitrogen mineralizationand nitrification along an elevational gradient in New Mexico. Biogeochemistry (1986) 2:281–297.
Govindarajulu M, Pfeffer PE, Jin H, Abubaker J, Douds DD, Allen JW, Bücking H, Lammers PJ, Shackar-Hill Y. Nitrogen transfer in the arbuscular mycorrhizal symbiosis. Nature (2005) 435:819–823.[CrossRef][Medline]
Hansen L, Knudsen H, Dissing H. Nordic macromycetes (1992) Copenhagen: Nordsvamp.
Harper JT, Waanders E, Keeling PJ. On the monophyly of chromalveolates using a six-protein phylogeny of eukaryotes. Int J Syst Evol Microbiol. (2005) 55:487–496.
Hawkins H, Johansen A, George E. Uptake and transport of organic and inorganic nitrogen by arbuscular mycorrhizal fungi. Plant Soil (2000) 226:275–285.[CrossRef][Web of Science]
Heckman DS, Geiser DM, Eidell BR, Stauffer RL, Kardos NL, Hedges SB. Molecular evidence for the early colonization of land by fungi and plants. Science (2001) 293:1129–1133.[CrossRef][Web of Science][Medline]
Hedges SB, Blair JE, Venturi ML, Shoe JL. A molecular timescale of eukaryote evolution and the rise of complex multicellular life. BMC Evol Biol. (2004) 4:2.[CrossRef][Medline]
Hildebrandt U, Schmelzer E, Bothe H. Expression of nitrate transporter genes in tomato colonized by an arbuscular mycorrhizal fungus. Physiol Plant (2002) 115:125–136.[CrossRef][Medline]
Hilu KW, Borsch T, Müller K. (13 co-authors). Angiosperm phylogeny based on matK sequence information. Am J Bot (2003) 90:1758–1776.
Huelsenbeck JP, Ronquist FR. MrBayes: Bayesian inference of phylogeny. Bioinformatics (2001) 17:754–755.
James TY, Kauff F, Schoch C. (70 co-authors). Reconstructing the early evolution of Fungi using a six-gene phylogeny. Nature (2006) 443:818–822.[CrossRef][Medline]
Jargeat P, Rekangalt D, Verner M, Gay G, DeBaud J, Marmeisse R, Fraissinet-Tachet L. Characterisation and expression analysis of a nitrate transporter and nitrite reductatse genes, two members of a gene cluster for nitrate assimilation from the symbiotic basidiomyctete Hebeloma cylindrosporum. Curr Genet. (2003) 43:199–205.[Web of Science][Medline]
Keeling PJ, Burger G, Durnford DG, Lang BF, Lee RW, Pearlman RE, Roger AJ, Gray MW. The tree of eukaryotes. Trends Ecol Evol. (2005) 20:670–676.[CrossRef][Medline]
Kennedy M, Droser M, Mayer LM, Pevear D, Mrofka D. Late Precambrian oxygenation: Inception of the clay mineral factory. Science (2006) 311:1446–1449.
Koltermann M, Moroni A, Gazzarini S, Nowara D, Tischner R. Cloning, functional expression and expression studies of the nitrate transporter gene from Chlorella sorokiniana (strain 211–8k). Plant Mol Biol. (2003) 52:855–864.[CrossRef][Web of Science][Medline]
Levia DF Jr. Nitrate sequestration by corticolous macrolichens during winter precipitation events. Int J Biometeorol (2002) 46:60–65.[CrossRef][Web of Science][Medline]
Lilleskov EA, Fahey TJ, Horton TR, Lovett GM. Below ground ectomycorrhizal fungal community change over a nitrogen deposition gradient in Alaska. Ecology (2002) 83:104–115.[CrossRef][Web of Science]
Little DY, Rao H, Oliva A, Daneil-Vedele F, Krapp A, Malamy JE. The putative high-affinity nitrate transporter NRT2.1 represses lateral root initiation in response to nutritional cues. Proc Natl Acad Sci USA (2005) 102:13693–13698.
López-Pedrosa A, González-Guerrero M, Valderas A, Azcón-Aguilar C, Ferrol N. GintAMT1 encodes a functional high-affinity ammonium transporter that is expressed in the extraradical mycelium of Glomus intratradices. Fungal Genet Biol. (2006) 43:102–110.[CrossRef][Web of Science][Medline]
Lutzoni F, Kauff F, Cox CJ. (43 co-authors). Assembling the fungal tree of life: Progress, classification, and evolution of subcellular traits. Am J Bot (2004) 91:1446–1480.
Maddison DR, Maddison WP. (2001) MacClade 4, version 4.03.Sunderland, Mass: Sinaur Associates.
Marmeisse J, Guidot A, Gay G, Lambiolliotte R, Sentenac H, Combier J, Melaya D, Fraissinet-Tachet L, Debaud JC. Tansley Review: Hebeloma cylindrosporum- a model species to study ectomycorrhizal symbiosis from gene to ecosystem. New Phytol (2004) 163:481–498.[CrossRef][Web of Science]
Mazluf GA. Genetic regulation of nitrogen metabolism in the fungi. Microbiol Mol Biol R (1997) 61:17–32.[Abstract]
Montanini B, Viscomi AR, Bolchi A, Martin Y, Siverio JM, Balestrini R, Bonafante P, Ottonello S. Functional properties and differential mode of regulation of the nitrate transporter from a plant symbiotic ascomycete. Biochem J (2006) 394:125–34.[CrossRef][Web of Science][Medline]
Nozaki H, Matsuzaki M, Misumi O, Kuroiwa H, Hasegawa M, Higashiyama T, Shin- IT, Kohara Y, Ogasawara N, Kuroiwa T. Cyanobacterial genes transmitted to the nucleus before the divergence of red algae in the chromista. J Mol Evol. (2004) 59:103–113.[Web of Science][Medline]
Orsel M, Krapp A, Daniel-Vedele F. Analysis of the NRT2 nitrate transporter family in Arabidopsis. Structure and gene expression. Plant Physiol (2002) 129:886–896.
Padovan AC, Sanson GF, Brunstein A, Briones MR. Fungi evolution revisited: Application of the penalized likelihood method to a Bayesian fungal phylogeny provides a new perspective on phylogenetic relationships and divergence dates of Ascomycota groups. J Mol Evol. (2005) 60:726–735.[CrossRef][Web of Science][Medline]
Palmer JD, Soltis DE, Chase MW. The plant tree of life: An overview and some points of view. Am J Bot (2004) 91:1437–1445.
Pao SS, Paulsen IT, Saier MH Jr. Major Facilitator Superfamily. Microbiol Mol Bio R (1998) 62:1–34.
Perez MD, Gonzalez C, Avila J, Brito N, Siverio JM. The YNT1 gene encoding the nitrate transporter in the yeast Hansenula polymorpha is clustered with genes YNI1 and YNR1 encoding nitrite and nitrate reductase and its disruption causes inability to grow in nitrate. Biochem J (1997) 321:397–403.[Web of Science][Medline]
Prosser IM, Massonneau A, Smyth AJ, Waterhouse RN, Forde BG, Clarkson DT. Nitrate assimilation in the forage legume Lotus japonicus L. Planta (2006) 223:821–834.[CrossRef][Web of Science][Medline]
Quesada A, Hidalgo J, Fernandez E. Three Nrt2 genes are differentially regulated in Chlamydomonas reinhardtii. Mol Gen Genet. (1998) 258:373–377.[CrossRef][Web of Science][Medline]
Raymond J, Segrè D. The effect of oxygen on biochemical networks and the evolution of complex life. Science (2006) 311:1764–1767.
Robertson DL, Tartar A. Evolution of glutamine synthetase in heterokonts: Evidence for endosymbiotic gene transfer and the early evolution of photosynthesis. Mol Biol Evol. (2006) 23:1048–1055.
Sagara N. Association of ectomycorrhizal fungi with decomposed animal wastes in forest habitats: A cleaning symbiosis? Can J Bot (1995) 73:S1423–S1433.[CrossRef]
Samuels GJ. Trichoderma: Systematics, the sexual state, and ecology. Phytopathology (2006) 96:195–206.[CrossRef][Web of Science][Medline]
Smith AH. Studies of species of Hebeloma (Fr.) Kummer from the Great Lakes region of North America I. Sydowia (1984) 37:271–283.
Steenkamp ET, Wright J, Baldauf SL. The protistan origins of animals and fungi. Mol Biol Evol. (2006) 23:93–106.
Steltzer H, Bowman WD. Differential influence of plant species on soil nitrogen transformations within moist meadow alpine tundra. Ecosystems (1998) 1:464–474.[CrossRef]
Suzuki A, Fukiharu T, Tanaka C, Ohono T, Buchanan PK. Saprobic and ectomycorrhizal ammonium fungi in the Southern Hemisphere. New Zeal J Bot (2003) 41:391–406.
Swofford DL. PAUP*. In: Phylogenetic analysis using parisimony (*and other methods), version 4 (2002) Sunderland, Mass: Sinauer Associates.
Thompson JD, Plewniak F, Poch O. A comprehensive comparison of multiple sequence alignment programs. Nucleic Acids Res. (1999) 27:2682–2690.
Toussaint J, St-Arnaud M, Charest C. Nitrogen transfer and assimilation between the arbuscular mycorrhizal fungus Glomus intraradices Schenck & Smith and Ri T-DNA roots of Daucus carota L. in an in vitro compartmented system. Can J Microbiol. (2004) 50:251–260.[CrossRef][Web of Science][Medline]
Tusnády GE, Simon I. The HMMTOP transmembrane topology prediction server. Bioinformatics (2001) 17:849–850.
Unkles SE, Hawker K, Grieve C, Campbell EI, Kinghorn JR. crnA encodes a nitrate transporter in Aspergillus nidulans. [correction appears in Proc Nat Acad Sci USA. (1995) 92:3076]. Proc Nat Acad Sci USA (1991) 88:204–208.
Unkles SE, Zhou D, Siddiqi MY, Kinghorn JR, Glass ADM. Apparent genetic redundancy facilitates ecological plasticity for nitrate transport. EMBO J (2001) 20:6246–6255.[CrossRef][Web of Science][Medline]
Vidmar JJ, Zhuo D, Siddiqi MY, Schjoerring JK, Touraine B, Glass AD. Regulation of high-affinity nitrate transporter genes and high-affinity nitrate influx by nitrogen pools in roots of barley. Plant Physiol (2000) 123:307–18.
Zhang J. Evolution by gene duplication: An update. TREE/Trends Ecol Evol. (2003) 18:292–298.[CrossRef]
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



