MBE Advance Access originally published online on September 3, 2007
Molecular Biology and Evolution 2007 24(11):2474-2484; doi:10.1093/molbev/msm182
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Articles |
WOX Gene Phylogeny in Poaceae: A Comparative Approach Addressing Leaf and Embryo Development
* Institut für Entwicklungsbiologie, Universität zu Köln, Köln, Germany
Zentrum für Molekularbiologie für Pflanzen, Universität Tübingen, Tübingen, Germany
Entwicklungsbiologie und Biotechnologie, Universität Hamburg Biozentrum Klein Flottbek und Botanischer Garten, Hamburg, Germany
E-mail: werr{at}uni-koeln.de.
 |
Abstract |
|---|
 TOP Abstract IntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
The phylogeny based on the homeodomain (HD) amino acid sequence of the WOX (WUSCHEL-related homeobox gene family) was established in the 3 major radiations of the Poaceae family: Pooideae (Brachypodium distachyon), Bambusoideae (Oryza sativa), and Panicoideae (Zea mays). The genomes of all 3 grasses contain an ancient duplication in the WOX3 branch, and the cellular expression patterns in maize and rice indicate subfunctionalization of paralogues during leaf development, which may relate to the architecture of the grass leaf and the encircling of the stem. The use of maize WOX gene family members as molecular markers in maize embryo development for the first time allowed us to visualize cellular decisions in the maize proembryo, including specification of the shoot/root axis at an oblique angle to the apical–basal polarity of the zygote. All molecular marker data are compatible with the conclusion that the embryonic shoot/root axis comprises a discrete domain from early proembryo stages onward. Novel cell fates of the shoot and the root are acquired within this distinct morphogenic axis domain, which elongates and thus separates the shoot apical meristem and root apical meristem (RAM) anlagen in the maize embryo.
Key Words: WOX gene family • Poaceae • embryo patterning • leaf development
|
Introduction |
|---|
|
TOPAbstractIntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
Angiosperms, flowering plants, are the largest group of embryophytes with at least 260,000 living species. They consist of 2 classes—the monocotyledons and the dicotyledons—which diverged over 150 MYA (Wikstrom and Kenrick 2001). Despite their striking diversity, angiosperms share several synapomorphies (Doyle and Donoghue 1986
). For example, sexual reproduction is characterized by a double fertilization event where one sperm cell fuses with the egg cell that will develop into the embryo and the second fuses with the binucleate central cell to give rise to the endosperm. Whereas endosperm development starts with a syncitial phase, the zygote follows a defined cell division program (Johansen 1950; Wardlaw 1955). The first division of the zygote is asymmetric and always perpendicular to the micropylar/chalazal axis of the embryo sack in all plants and results in a small apical cell and a larger basal cell. The plant embryo develops from the small apical cell, and although cell divisions are mostly unpredictable, the resulting embryos fall into 5 categories (Johansen 1950). Early embryonic cell divisions in the model dicot plant Arabidopsis thaliana are exceptionally stereotypic and create a crucifer type of embryo (Wardlaw 1955), in which the basal cell does hardly contribute to embryo development. The 16-cell Arabidopsis embryo shares only a single cell contact with the subtending suspensor, the so-called hypophysis (Jurgens 1992; Berleth and Chatfield 2002). Its horizontal cell division gives rise to a quiescent center (QC) precursor cell and a subtending columella root cap initial (Scheres et al. 2002).
In contrast, the shoot apical meristem (SAM) is established at an apical position of the "embryo proper" (Long and Barton 1998); the activation of the WUSCHEL gene at the 16-cell stage provides a first molecular marker (Mayer et al. 1998). Shortly thereafter, the radial symmetry of the globular embryo is broken by the specification of 2 cotyledons. In the mature embryo of nearly all dicots except some Umbellifera and Ranunculus ficaria, the shoot apex is found between the bases of the cotyledons (Johansen 1950). Characteristics for the dicot embryo are thus 2 planes of bilateral symmetry, one through the cotyledon midribs and the second perpendicular, medial of the SAM. In contrast, monocot embryos have a single plane of bilateral symmetry as the SAM resides at a lateral position of the scutellum, considered the single (mono) cotyledon.
Monocots represent approximately 22% of all angiosperm species, and one of the largest monocot families, the Poaceae, comprises 17% of all 52,000 monocot species and contains all major cereal crops (Soltis PS and Soltis DE 2004). The Poaceae family is subdivided into 3 major radiations each containing species regarded as model systems for functional genomics: Pooideae, Bambusoideae, and Panicoideae.
Zea mays, a member of the Panicoideae family, is a monocot species where histological and genetic analyses as well as accumulating genome information are available today thus allowing the detailed study of embryonic patterning. The basis was laid early in the 20th century by a detailed histological description and staging of maize embryo development (Randolph 1936; Abbe et al. 1951), which at its end has elaborated a miniature plantlet with 5–6 true foliage leaves. Genetically, maize embryogenesis was revisited by the description of 51 embryo-specific mutations, which only affect patterning of the embryo, whereas endosperm development is normal (Clark and Sheridan 1991). One of these mutants (emb8516) has been cloned and encodes a plastid ribosomal protein (Magnard et al. 2004). Marker-assisted analyses of other mutants revealed that the acquisition of dorso/ventral polarity is a crucial transition prior to the activation of SAM markers (Elster et al. 2000).
Mutants and resulting molecular markers associated with the acquisition of cell fates in the shoot and root meristems have proven most informative in understanding the patterning of the Arabidopsis embryo. The KNOTTED1 (KN1) gene in maize, which is considered to be the orthologue to SHOOT MERISTEMLESS (STM) in Arabidopsis (Kerstetter et al. 1997), starts to be transcribed at a lateral position (adaxial relative to the axis of the ear inflorescence) during the transition stage of the maize embryo (Smith et al. 1995). The activation of KN1 when the maize embryo consists of several hundred cells is rather late compared with that of STM in Arabidopsis, which is activated at the 32-cell stage (Long and Barton 1998). Although later in development the gene expression patterns appear to be conserved, there is no prepatterning of the prospective SAM domain in the maize embryo. A root endodermis marker is provided by ZmSCR, the maize orthologue of SCARECROW in Arabidopsis in the coleoptilar stage embryo (Lim et al. 2005). The SAM and RAM transcriptional markers show perception of adaxial and central positional information for establishment of the shoot/root axis in the maize embryo.
In Arabidopsis, members of the WUSCHEL homeobox (WOX) gene family comprise earliest cell fate markers from the first zygotic divisions on Haecker et al. (2004). Most members of the maize WOX gene family have been identified in the course of the phylogenetic identification of WUS orthologues from rice and maize (Nardmann and Werr 2006). Their analysis has revealed major adaptations in WUS expression patterns in both grass species relative to the Arabidopsis model and more importantly suggest significant freedom for the specification of the shoot stem cell niche during angiosperm evolution. However, the WOX gene phylogeny also revealed that this gene family existed prior to the separation of monocot and dicot species. Based on pioneering work in Arabidopsis, members of the WOX gene family, therefore, were attractive candidates to be tested as molecular markers of embryonic patterning in maize. Here we describe the transcription patterns of patterning WOX gene family members in the maize embryo. They uncover a significant degree of pattern conservation between maize and Arabidopsis embryos and reveal that the shoot/root axis in maize comprises a rather discrete domain from the proembryo stage on, which is distinct from that of the prospective scutellum.
|
Materials and Methods |
|---|
|
TOPAbstractIntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
WOX Family Members from Brachypodium distachyon and Computational or Database Analysis
Homeobox-encoding amplicons of the Brachypodium distachyon WOX family members were obtained in polymerase chain reactions (PCRs) on genomic DNA with primers listed in table 1. Analysis of DNA and protein sequences was performed using the Wisconsin GCG software package version 7.0 (University of Wisconsin Genetics Computer Group). Homology searches used TBlastN at http://www.ncbi.nlm.nih.gov/blast/, http://www.ddbj.nig.ac.jp, or http://www.gov/blast.org with default parameters. Multiple sequence alignment was achieved using ClustalW (http://www.ebi.ac.uk/clustalw). PHYLIP (http://www.evolution.genetics.washington.edu/phylip.html) was used for phylogenetic and molecular evolutionary analyses based on the maximum likelihood method. MEGA version 3.1 (Kumar et al. 2001
) was used for phylogenetic and molecular evolutionary analyses based on the Neighbor-Joining (NJ) and maximal parsimony (MP) methods. Sequences selected for the phylogenetic tree in figure 1 are as follows (accession numbers in parentheses): ZmNS1 (AJ536578
[GenBank]
), ZmNS2 (AJ472083
[GenBank]
), and OsWOX5 (Q8WOF1); AtWOX1—AtWOX14 as published recently (Haecker et al. 2004); and all other accession numbers are listed in table 2.
|
|
|
In Situ Hybridization
Nonradioactive in situ hybridization followed the protocol of Jackson (1991)
. For fixation, maize kernels were trimmed on both sides of the embryo axis; nucellar explants for early embryos were obtained 45–48 h after pollination. Paraffin-embedded tissue was sectioned by the use of the Leica RM 2145 rotary microtome (7 µm). Probes for in situ hybridization comprising sequences downstream of the homeobox (table 3) were cloned in sense or antisense orientation to the T7 promoter, and digoxigenin-labeled RNA probes were obtained as described by Bradley et al. (1993). The KN1 probe corresponded to accession AY312169
[GenBank]
(Vollbrecht et al. 1991).
|
Reverse Transcriptase–Polymerase Chain Reaction Analysis
For expression analysis of ZmWOX2A and ZmWOX9A-C, the µMACS One-step cDNA Kit was used for isolation of total RNA from egg cells and zygotes and for subsequent cDNA synthesis according to the manufacturer's protocol (Miltenyi, Bergisch Gladbach, Germany). Total RNA of later embryonic stages was isolated using the RNeasy plant mini kit according to the manufacturer's protocol (Qiagen, Hilden, Germany). Two micrograms of DNAse I–treated RNA was used as a template for the first-strand cDNA synthesis with SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA). Subsequent PCRs were performed using standard procedures with 35 or 40 cycles of amplification. ZmWOX2A primers fw (5'-CCGCTGCCCGTGCTCTCCATG) and rev (5'-GATCGGCACAGGCTTCTTCCAG) (Tm = 59 °C, 40 cycles); ZmWOX9A fw (5'GATCACCATCAGCACCACAAGC) and rev (5'-AATCGGCACACAACACCTACG) (Tm = 59 °C, 35 cycles); ZmWOX9B fw (5'-CGGCAAGAACAACAACACC) and rev (5'-GCCAGCTGATACCCTAAACC) (Tm = 59 °C, 35 cycles); ZmWOX9C fw (5'-GTGACGCCTCCCAGGAACC) and rev (5'-CCCCAGCCTGGACTTCTCG) (Tm = 57 °C, 35 cycles). Reverse transcriptase–polymerase chain reaction (RT–PCR) on the GAPDH cDNA transcript with primers GAPDH fw (5'-CATTCCTAGCAGCACCGGTG) and rev (5'-CAAGCAGCAACCATCCATGAG) served as a control.
Egg Cell and Zygote Isolation
All plant materials were isolated from line A 188. Unfertilized egg cells were isolated and selected as described in Kranz (1999). In vivo fertilized egg cells were isolated as described in Okamoto et al. (2005). It was estimated that fertilization occurred 17–20 h before zygote isolation. After washing in mannitol solution (0.650 osmolar), cells were transferred into tubes, snap frozen in liquid nitrogen, and stored at –80 °C until use.
Light Microscopy and Image Processing
Images were taken using an Axioskop microscope equipped with an Axiocam camera (Zeiss, Oberkochen, Germany). Pictures were processed using Adobe Photoshop version 7.0.
|
Results |
|---|
|
TOPAbstractIntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
Phylogeny of WOX HDs
The WOX phylogenetic tree based on the homeodomain (HD) amino acid sequence (fig. 1) contains members of the 3 major radiations of the Poaceae family: Pooideae (B. distachyon; Bd), Bambusoideae (Oryza sativa; Os), and Panicoideae (Zea mays; Zm). Arabidopsis thaliana, Populus trichocarpa, and O. sativa members were obtained from the established genome sequences. The isolation of maize WOX gene family members was described recently (Nardmann and Werr 2006
). WOX gene sequences of B. distachyon were newly isolated by PCR approach with degenerate primers targeting conserved polypeptide sequences in WUS or WOX HDs. The informative HD sequences are 41 amino acid long in WOX proteins or 42 amino acid in WUS orthologues due to an extra Y residue. The phylogenetic tree (fig. 1A) was calculated by the maximum likelihood method (http://www.evolution.genetics.washington.edu/phylip.html), although branches in the WOX3 and WOX8/9 subgroup are more consistently resolved by the NJ or MP methods (Kumar et al. 2001). The duplication of the maize genome is evident as 2 maize paralogues are often accompanied by only a single rice or Brachypodium orthologue in individual subbranches (WUS, WOX2, WOX5, or WOX13). The situation is different in the WOX3 branch; PRS in Arabidopsis and the ZmNS1/ZmNS2 paralogues represent homologous functions single orthologous genes exist in rice (OsNS) and in Brachypodium (BdNS). However, in contrast to Arabidopsis, the grass genomes contain further members, which root outside of the PRS/NS branch. This duplication existed prior to the allotetraploidization of the maize genome because 2 maize paralogues (ZmWOX3A/B) relate to a single rice (OsWOX3) or Brachypodium (BdWOX3) orthologue. Significant divergence also exists in the WOX8/9 branch; no close AtWOX8 relative exists in Populus or grasses, but all genomes contain AtWOX9 orthologues. Close relatives to AtWOX1 or AtWOX6 are absent in grasses, whereas orthologues are found in Populus. However, the Populus and the grass genomes lack orthologues to AtWOX10/AtWOX14, which indicates a branch unique to the Arabidopsis lineage. In contrast, AtWOX5/AtWOX7 or AtWOX11/AtWOX12 are close relatives in Arabidopsis but root with orthologues in Populus or grasses and therefore may occupy ancient branches in the WOX gene family.
ZmWOX2A Expression Prepatterns the SAM Position and Shifts from an Apical to a Lateral Position in the Embryo Proper
In Arabidopsis, AtWOX2 provides a molecular marker for the apical domain of the globular embryo, which gives rise to the SAM (Haecker et al. 2004). Gene expression becomes restricted to the apical cell of the 2-cell stage embryo and is later confined to the upper cell tier in the 8-cell embryo. RNA in situ hybridization experiments on the maize embryo revealed that ZmWOX2A is transcribed in the apical domain of the early embryo proper (45–48 h after fertilization to 4 days after pollination (dap); fig. 2A and B). Slightly later, ZmWOX2A expression becomes confined to a few cells at a lateral position of the proembryo facing toward the axis of the ear (fig. 2C). At the late proembryo/early transition stage, the expression domain shifts more to the base of the embryo and transcripts become restricted to the L1 layer (fig. 2D). Transcriptional activity ceases thereafter, which coincides with the activation of KN1 transcription in a lateral domain of the transition stage embryo (Smith et al. 1995). ZmWOX2A transcripts are again detected when the SAM has been established in leaf stage embryos. Transcripts accumulate in the outer cell layers of the SAM predominantly lateral to the apical tip (fig. 2E). Such hybridization signals are only observed in a subfraction of series of tissue sections, indicating that ZmWOX2A transcriptional activity is transient, possibly relating to the initiation of new leaf primordia. In analogy to Arabidopsis, we also tested for transcription of ZmWOX2A in the egg cell and the zygote by performing RT–PCR experiments. ZmWOX2A transcripts were found in the zygote, but in contrast to AtWOX2 expression in Arabidopsis (Haecker et al. 2004), transcripts were not detected in the unfertilized egg cell (data not shown), therefore, ZmWOX2A expression is zygotic.
|
Expression Patterns of ZmWOX5 Paralogues and Root Development
The maize genome contains 2 WOX5 paralogues, ZmWOX5A and ZmWOX5B. Based on the transcriptional activity in the root QC, an orthologue to AtWOX5 is encoded by the ZmWOX5B gene (fig. 3A–C). Expression is first detected in a central domain of the embryo proper above the uppermost tier of vacuolized suspensor cells at the proembryo stage, when ZmWOX2A is already expressed in a lateral adaxial domain (fig. 3A). During later stages of embryo development, ZmWOX5B is transcribed in cells of the QC. However, in contrast to ZmSCR, which is transcribed in the endodermis and in a single row of cells through the maize root QC (Lim et al. 2005
), the ZmWOX5B expression domain initially extends into the tissue above (fig. 3C). The position of this ZmWOX5B domain in the coleoptilar stage embryo is striking relative to the expression pattern of KN1. Side-by-side RNA in situ hybridizations show that the ZmWOX5B domain is located internally to an inverted cup-shaped KN1 expression domain (fig. 3C and D). This KN1/ZmWOX5B expression domain comprises the entire shoot/root axis of the maize embryo from the L2 layer of the SAM towards the root QC. Later in the elaborated root of the maturing embryo or the vegetative seedling, ZmWOX5B transcripts mark not only a single row of cells in the root QC but also the base of provascular bundles specified immediately above the QC (fig. 3B). ZmWOX5B in maize is expressed outside the root QC in the cambial cells of the basal vascular system, differently to AtWOX5 in Arabidopsis and QHB in rice (Kamiya et al. 2003; Haecker et al. 2004).
|
The ZmWOX5A paralogue has acquired a completely different expression pattern and is not detected in the embryo prior to early leaf stage 1. Expression starts in the suspensor region in 4–6 cell layers below the root QC (fig. 3E), the intervening cells express the coleorhiza/calyptrogen marker ZmNAC5 (Zimmermann and Werr 2005
). Although the coleorhiza delaminates from the primary embryonic root laterally, it remains connected to the subtending embryonic suspensor at its basal end. The ZmWOX5A gene is transcribed in cells subtending the central coleorhiza domain, which forms a continuous cell array with the root (fig. 3F). Concerning the function of these cells in the suspensor, the transcriptional activity of ZmWOX5A in the early endosperm may provide a hint. Prior to the expression in the embryo, high levels of ZmWOX5A transcripts are transiently detected in the endosperm shortly after cellularization of the basal transfer layer (fig. 3G). This specialized endosperm domain is essential for nutrient supply from maternal into the filial tissue, that is, endosperm and embryo (Hueros et al. 1995). By analogy, ZmWOX5A transcriptional activity in the suspensor could indicate a cell type specialized for acropetal transport through the root into the embryonic plantlet. In the seedling, ZmWOX5A expression is detectable in the rhizodermis, which is involved in uptake of ions and water from the rhizosphere into the root (fig. 3H).
ZmWOX4 Expression Marks Provascular Cells of the Hypocotyl
Similar to ZmWOX5A in the embryo, ZmWOX4 expression is first detectable during leaf stage 1. Transcription is confined to the morphogenetic axis in the maize embryo and starts in a broad domain between the SAM and RAM (fig. 4A). During later leaf stages, transcripts are restricted to the vascular system, marking vascular strands at the height and above the scutellar node (fig. 4B). No expression was detected in the emerging vascular system at the base of the root, which is marked by ZmWOX5B expression or in the prominent vascular strand connecting the embryonic axis with the scutellum. ZmWOX4, therefore, provides a marker specific for the vascular system of the hypocotyl.
|
As the expression pattern of the Arabidopsis orthologue AtWOX4 has not been reported previously, we analyzed its transcriptional activity in the dicot embryo. The resulting expression pattern is similar to that described for AtWOX1, although both HDs, AtWOX4 and AtWOX1, group into distant subbranches of the WOX phylogenetic tree (fig. 1). AtWOX4 activity is detected at the apical tip of the cotyledons in heart stage Arabidopsis embryos (fig. 4C) for a short interval and ceases thereafter. The AtWOX4 and ZmWOX4 expression patterns exhibit no obvious similarities but ZmWOX4 marks provascular strands in the prospective hypocotyl domain of the shoot root axis.
The WOX3 Branch and Grass Leaf Development
All 3 grass genomes contain WOX3 relatives, which root outside of the PRS/NS branch (Matsumoto and Okada 2001; Nardmann et al. 2004; Nardmann and Werr 2006). Expression analyses here focus on the newly identified branch members. Gene-specific RT–PCR experiments revealed that both maize paralogues, ZmWOX3A and ZmWOX3B, are transcribed. However, the sequence similarity between both maize paralogues is so high that we used a cross-hybridizing ZmWOX3A probe to establish the cellular expression pattern. ZmWOX3A/B transcripts are first detected in the anlage of the coleoptile where the marginal cell file is marked (fig. 5A). This ZmWOX3A/B expression pattern is reminiscent of that of ZmNS1 expression (Nardmann et al. 2004) and may explain why ns1/ns2 double mutants exhibit no phenotype in the coleoptile other than in leaves and leaf-like floral organs.
|
During later stages of embryogenesis and during the vegetative phase, ZmWOX3A/B expression is detected in the margins of developing true foliage leaves, another aspect shared with ZmNS1/NS2 (fig. 5B). However, significant differences exist between the expression patterns of both gene pairs in the SAM. ZmWOX3A/B transcription marks a ring-shaped expression domain of cells recruited for the P0/P1 leaf primordium (fig. 5B–D). In addition, ZmWOX3A/B are transcribed at the base of developing phytomers opposite to the midrib where the axillary meristem resides and intermingling leaf margins are attached to the node (compare side-by-side sections in fig. 5E and F). Similar expression patterns were obtained with the rice orthologues in young Oryza seedlings. Whereas OsNS is confined to lateral leaf margins (fig. 5H), the single OsWOX3 orthologue is expressed in the SAM at the base of young phytomers (fig. 5G). The discrepancy to the published OsNS patterns in rice (Dai et al. 2007
) may reside in cross hybridization between the 2 rice WOX3 paralogues. Consistently, in maize and rice the grass-specific branching of the WOX3 lineage correlates with differences in expression patterns thus indicating subfunctionalization.
ZmWOX9A/B/C
In Arabidopsis, AtWOX9 is activated after fertilization and together with AtWOX8 marks the large basal suspensor cell but is absent in the small apical embryo proper cell (Haecker et al. 2004). Cellular expression patterns of the 3 ZmWOX9 paralogues are detectable only during late embryonic stages. At leaf stage 1, ZmWOX9A–C are transcribed in the suspensor region with ZmWOX9B expression throughout the suspensor (fig. 6A) and a ZmWOX9C preference for outer cell layers (fig. 6C). The expression pattern of ZmWOX9A is similar to that of ZmWOX9B (data not shown). At leaf stage 4, these outer/inner expression pattern differences persist underneath the coleorhiza subtending the root QC (fig. 6B–D). All 3 ZmWOX9 genes are already transcribed during early embryonic stages as analyzed by RT–PCR experiments (fig. 6E). Transcripts were detected 3, 5, and 7 dap although corresponding RNA in situ hybridization experiments revealed no reliable pattern information earlier than leaf stage 1.
|
In Arabidopsis, AtWOX9/STIMPY acts partially redundantly to WUS (Wu et al. 2005
). It was therefore notable to see that ZmWOX9B is transcribed not only in the suspensor but also in the SAM. At late coleoptilar stage, ZmWOX9B transcripts are found in a few cells at a lateral position of the protruding SAM proximal to the coleoptile (fig. 6F). Therefore, like members of the WOX3 branch, the 2 maize WUS paralogues and presumably ZmWOX2A, one maize member of the WOX9 branch, may contribute to SAM function. |
Discussion |
|---|
|
TOPAbstractIntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
The WOX Gene Family Is Ancient in the Angiosperm Lineage
The grass part of the WOX phylogenetic tree (fig. 1) contains members of the 3 major radiations of the Poaceae family: Pooideae (B. distachyon), Bambusoideae (O. sativa), and Panicoideae (Z. mays). The tree is therefore representative for true grasses or Gramineae, which comprise 600 genera and between 9,000 and 10,000 species. Regarding dicots, the tree contains WOX family members from A. thaliana and P. trichocarpa and because both genomes have been sequenced should provide the whole WOX gene complement for 2 eudicot species, as is the case of WOX family members in rice.
The phylogeny reveals significant differences between the 3 grass and the 2 eudicot species. There is no evidence that grass genomes contain orthologues of WOX1, 6, 7, 8, 10, and 14. In contrast, orthologues of WOX1, 6, and 7 are found in the genome of P. trichocarpa. Populus and Arabidopsis both belong to the core eudicots but are members of the Salicaceae and Brassicaceae group, respectively, and fall into eurosids I and II. The WOX1, 6, or 7 orthologues in both species possibly indicate a common ancestry, consistent with the assumption that rosids comprise a monophyletic group (Jansen et al. 2006). As eurosids I and II are the major radiations among rosids, the differences concerning WOX10 and 14 family members may relate to the depth of branching between both clades but this would need substantiation from other clade members. In contrast, the homogeneity among grasses implies few changes between Pooideae, Bambusoideae, and Panicoideae. This is consistent with estimations that Poales represent a rather young monophyletic group dating back to the late Cretaceous (>65 Myr; Bremer 2002), whereas the first undisputed evidence of angiosperms appears in the fossil record of the early Cretaceous period with a rapid diversification in the mid-Cretaceous (approximately 100 MYA).
Despite a possible loss of individual WOX family members, all 3 grass genomes contain an interesting duplication in the WOX3 subbranch. The rice and Brachypodium genomes both contain 2 WOX3 members, whereas the maize genome encodes 2 pairs of paralogues. The duplication in the WOX3 branch, therefore, existed prior to the duplication of the maize genome. For maize and rice, it has been shown that NS orthologues and additional WOX3 relatives both relate to leaf development but are expressed in different domains. These expression patterns provide evidence that the WOX3 duplication could be preserved by subfunctionalization (Lynch and Force 2000), possibly relating to the peculiar architecture of the grass leaf, with a basal sheath enclosing the stem. Suggestively, PRS and ZmNS1/2, OsNS, and BdNS group in a unique branch of the phylogenetic tree, whereas the grass-specific WOX3 paralogues do not find an obvious counterpart in eudicots.
Early Embryonic Patterning in Maize
The isolation of maize WOX genes was performed to raise molecular markers for patterning of the grass embryo. The RNA in situ hybridization analyses presented here show that WOX family members provide such markers on the transcriptional level and allow the comparison to cellular decisions in the Arabidopsis embryo (fig. 7). ZmWOX transcriptional gene activity was absent in the egg cell but starts in the zygote with ZmWOX2A. From the few-celled stage onward, transcripts are exclusively detected in the apical embryo proper domain. This expression domain is maintained throughout most of the proembryo stage before the transcriptional activity becomes confined to the adaxial face of the embryo proper, where the SAM will later emerge. Ultimately, at the late proembryo/early transition stage, ZmWOX2A transcription is restricted to the L1 layer at the adaxial side of the embryo. In relation to Arabidopsis, it is striking that both ZmWOX2A and AtWOX2 are active in the zygote, mark the apical cell fate and prepattern the position of the SAM (fig. 7). This similarity of expression patterns makes it tempting to consider that ZmWOX2A and AtWOX2 represent orthologous gene functions. However, this conclusion implies that WOX2 provides an ancient angiosperm function associated with the embryo proper cell fate and SAM anlage prior to the separation of monocots and dicots. The confinement of transcription from an early pattern throughout the embryo proper to the adaxial face might be interpreted that dorso/ventral polarity does not exist in the early proembryo but is established later.
|
The second marker, which is informative in a temporal and spatial pattern, is ZmWOX5B; it is activated in central cells at the base of the embryo proper in the 6 dap proembryo. The expression pattern is dynamic during subsequent stages of embryo development. However, restriction of expression to the root QC implies that ZmWOX5B expression marks the anlage of the root meristem. ZmWOX5B expression appears later than that of ZmWOX2A, and this activation coincides with the start of the restriction of the ZmWOX2A transcription domain to the adaxial face of the embryo proper. Whereas ZmWOX2A interprets adaxial positional information, the early pattern of ZmWOX5B expression indicates the perception of centro/radial information. Based on 2 ZmWOX markers and on ZmSCR (Lim et al. 2005
), the RAM and SAM anlagen seem to be established coordinately in time and at an oblique angle relative to the initial apical/basal polarity of the zygote.
The Root/Shoot Axis, a Discrete Embryo Domain
The adaxial ZmWOX2A and the central ZmWOX5B expression domains comprise a distinct centrolateral domain of the embryo proper, whereas the prospective scutellum fate at the abaxial face is marked by ZmDRN transcription (Zimmermann and Werr 2007). The view that already in the proembryo the root/shoot axis is set apart from the rest of the embryo, for example, suspensor and scutellum, gains support from the KN1 expression pattern. KN1 is activated at a late proembryo/early transition stage at the adaxial face of the embryo, when ZmWOX2A transcription ceases in the L1 layer (Smith et al. 1995). In contrast to STM, which is considered the orthologous gene function in Arabidopsis (Kerstetter et al. 1997), KN1 expression is not only confined to the SAM of the maize embryo but also transcription extends centrally and basally toward the boundary between embryo proper and suspensor (fig. 7). At the coleoptilar stage, the KN1 expression domain comprises an inverted cup-shaped domain, enclosing the ZmWOX5B expression domain, which becomes confined to the QC and basal provascular strands during subsequent developmental stages. In the basal cell layer of the ZmWOX5B transcription domain, ZmSCR is coexpressed and overlaps with the KN1 expression domain in the periphery (data not shown).
At this intermediate stage of primary embryonic axis development, all cells of the prospective root/shoot axis—from SAM (except the L1 layer) to QC—express either KN1 or ZmWOX5B and thus based on transcriptional molecular markers are different from adjacent scutellum cells. Starting with the restriction of ZmWOX2A expression to the adaxial embryo proper domain and the activation of ZmWOX5B, the root/shoot axis of the maize embryo comprises a discrete domain, which elongates and where KN1 activity may indicate a meristematic ground state. From an initially broad transcription pattern inside this KN1 domain, expression of ZmWOX4 focuses to provascular strands, similar to ZmWOX5B in subtending cells above the root QC. The ZmWOX4 and ZmWOX5B patterns in the embryo are nonoverlapping and according to the position of the scutellar node may correspond to the hypocotyl and primary root of the maize seedling.
The first evidence for further differentiation of the SAM is provided by ZmWOX3 paralogues. Together with ZmNS1 (Nardmann et al. 2004), the grass-specific ZmWOX3A/B paralogues are expressed in marginal cells in the emerging coleoptile above the prospective SAM. This coexpression of NS1/ZmWOX3A/B may indicate functional redundancy and may explain why ns1/ns2 double mutants are aphenotypic in the coleoptile. However, the expression patterns differ largely during leaf development. Whereas ZmNS1/2 activity in the shoot apex is restricted to small foci where lateral leaf domains are initiated and will detach from the apex (Nardmann et al. 2004), ZmWOX3A/B expression marks a ring of SAM cells recruited for the P0 primordium. Expression starts and ceases first at the midrib position of a new leaf primordium and extends to the opposite face of the SAM, where the axillary meristem is initiated. In median longitudinal sections through the maize seedling, consequently, 1 or 2 foci of expression become evident at the flank of the SAM (fig. 5B), which correspond to different stages during P0 development. In contrast to ZmNS1/2 transcripts, which are restricted to basal lateral margins, transcription of ZmWOX3A/B is also detected in the apical domain of the P1 leaf (fig. 5D). Although we have not analyzed the pattern of OsNS and OsWOX3 in the rice embryo, all the seedling patterns consistently agree with the maize data, except that maize has 2 paralogues, whereas rice has a single orthologue. It should be noted that in addition to ZmNS1/2 and ZmWOX3A/B also ZmWOX9B is transiently expressed at the flank of the embryonic SAM. The anlage of the complex maize leaf around the SAM circumference, therefore, involves the activity of at least 5 ZmWOX genes, not taking into consideration the 2 maize WUS paralogues ZmWUS1 and ZmWUS2 which may contribute to leaf development (Nardmann and Werr 2006). Only ZmWUS1 is transiently expressed in the embryo, at the end of coleoptilar stage, when the SAM starts to initiate leaves.
Presently there is no evidence for ZmWOX gene activity in the scutellum, whereas 12 ZmWOX genes are transiently expressed in the embryonic shoot/root axis or the subtending suspensor. This is in contrast to the development of the cotyledons in Arabidopsis, where several WOX family members are expressed (Haecker et al. 2004, fig. 4). Beside ZmNS1 or ZmWOX3A/B and AtWOX3/PRS, which only share marginal expression patterns in coleoptile and cotyledons (Nardmann et al. 2004), also AtWOX1 and 4 are expressed in the cotyledons. Whereas the expression patterns established here demonstrate that ZmWOX genes may contribute to various aspects of shoot/root axis development pattern in the maize embryo, there seems no contribution in the scutellum. This relates to the controversial and long-standing discussion whether the cotyledons and the scutellum represent orthologous organs (Weatherwax 1920).
However, the alternative hypothesis that the scutellum may be an invention of grasses and consequently may find no counterpart in dicot embryos has also been raised (Reeder 1953). The ZmWOX expression data support this view as the WOX patterns shared between the Arabidopsis and the maize embryo involve only the shoot/root axis including the coleoptile of the grass embryo. Strikingly, the WOX2/5 phylogeny and the patterns of ZmWOX2A and ZmWOX5B relative to those in Arabidopsis suggest that the embryonic axis is specified early, in an adaxial–central domain of the embryo proper. Further, cell-type specifications in this shoot/root axis involve WOX family members in maize as is observed during globular–heart stage transition in the Arabidopsis embryo including the cotyledons (see fig. 7). The ZmWOX data, therefore, suggest that during the early proembryo stage, the maize embryo proper is regionalized into 2 domains; the adaxial shoot/root axis and an abaxial domain determined to be the scutellum. Both the early discrete scutellum domain and the absence of WOX gene activity, which is detected in the cotyledons or the coleoptile of Arabidopsis and maize embryos, respectively, support the initial assumption that the scutellum may be an organ without counterpart in dicot embryos and thus a new acquisition of grasses.
In conclusion, analysis of the WOX gene family reveal interesting phylogentic differences between monocots and dicots and confirm that individual family members provide sophisticated transcriptional markers for plant development. The use of maize WOX gene family members as molecular markers in maize embryo development allowed us to visualize cellular decisions in the maize proembryo for the first time, including specification of the shoot/root axis at an oblique angle to the apical–basal polarity of the zygote. All molecular marker data are compatible with the conclusion that the embryonic shoot/root axis comprises a discrete domain from the early proembryo stage on. All cell fates of the shoot and the root are established within this distinct morphogenic axis domain, which elongates and separates the anlagen of SAM and RAM in the course of embryo development.
|
Acknowledgements |
|---|
|
TOPAbstractIntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
We thank Dr J. Chandler for suggestions, stimulating discussions, and critically reading the manuscript. The project was supported by the European Commission (QLK3-2000-00196 and QLRT-2000-00302) and the Deutsche Forschungsgemeinschaft (WE 1262/5-1) and through SFB 680.
|
Footnotes |
|---|
Neelima Sinha, Associate Editor
|
References |
|---|
|
TOPAbstractIntroductionMaterials and MethodsResultsDiscussionAcknowledgementsReferences |
|---|
Abbe EC, Phinney BO, Baer DF. The growth of the shoot apex in maize: internal features. Am J Bot (1951) 38:744–752.[CrossRef][Web of Science]
Berleth T, Chatfield S. Embryogenesis: pattern formation from a single cell. In: The Arabidopsis Book—Somerville CR, Meyerowitz EM, eds. (2002) Rockville (MD): American Society of Plant Biologists. 1–22.
Bradley D, Carpenter R, Sommer H, Hartley N, Coen E. Complementary floral homeotic phenotypes result from opposite orientations of a transposon at the plena locus of Antirrhinum. Cell (1993) 72:85–95.[CrossRef][Web of Science][Medline]
Bremer K. Gondwanan evolution of the grass alliance of families (Poales). Evolution Int J Org Evolution (2002) 56:1374–1387.[CrossRef][Web of Science][Medline]
Clark JK, Sheridan WF. Isolation and characterization of 51 embryo-specific mutations of maize. Plant Cell (1991) 3:935–951.
Dai M, Hu Y, Zhao Y, Liu H, Zhou D-X. A WUSCHEL-LIKE HOMEOBOX Gene Represses a YABBY Gene Expression Required for Rice Leaf Development. Plant Physiol (2007) 144:380–390.
Doyle JA, Donoghue MJ. Seed plant phylogeny and the origin of the angiosperms: an experimental cladistic approach. Bot Rev (1986) 52:321–431.[CrossRef]
Elster R, Bommert P, Sheridan WF, Werr W. Analysis of four embryo-specific mutants in Zea mays reveals that incomplete radial organization of the proembryo interferes with subsequent development. Dev Genes Evol (2000) 210:300–310.[Web of Science][Medline]
Haecker A, Gross-Hardt R, Geiges B, Sarkar A, Breuninger H, Herrmann M, Laux T. Expression dynamics of WOX genes mark cell fate decisions during early embryonic patterning in Arabidopsis thaliana. Development (2004) 131:657–668.
Hueros G, Varotto S, Salamini F, Thompson RD. Molecular characterization of BET1, a gene expressed in the endosperm transfer cells of maize. Plant Cell (1995) 7:747–757.[Abstract]
Jackson D. In situ hybridization in plants. In: Molecular plant pathology: a practical approach—Bowles DJ, Gurr SJ, McPerson M, eds. (1991) Oxford: Oxford University Press. 163–174.
Jansen RK, Kaittanis C, Saski C, Lee SB, Tomkins J, Alverson AJ, Daniell H. Phylogenetic analyses of Vitis (Vitaceae) based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids. BMC Evol Biol (2006) 6:32.[CrossRef][Medline]
Johansen DE. Plant embryology: embryogeny of the Spermatophyta (1950) Waltham (MA): Chronica Botanica Company.
Jurgens G. Pattern formation in the flowering plant embryo. Curr Opin Genet Dev (1992) 2:567–570.[CrossRef][Medline]
Kamiya N, Nagasaki H, Morikami A, Sato Y, Matsuoka M. Isolation and characterization of a rice WUSCHEL-type homeobox gene that is specifically expressed in the central cells of a quiescent center in the root apical meristem. Plant J (2003) 35:429–441.[CrossRef][Web of Science][Medline]
Kerstetter RA, Laudencia-Chingcuanco D, Smith LG, Hake S. Loss-of-function mutations in the maize homeobox gene, knotted1, are defective in shoot meristem maintenance. Development (1997) 124:3045–3054.[Abstract]
Kranz E. In vitrofertilization with isolated single gametes. In: Methods in molecular biology, 111, Plant cell culture protocols—Hall R, ed. (1999) Totowa (NJ): Humana Press Inc. 259–267.
Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics (2001) 17:1244–1245.
Lim J, Jung JW, Lim CE, Lee MH, Kim BJ, Kim M, Bruce WB, Benfey PN. Conservation and diversification of SCARECROW in maize. Plant Mol Biol (2005) 59:619–630.[CrossRef][Web of Science][Medline]
Long JA, Barton MK. The development of apical embryonic pattern in Arabidopsis. Development (1998) 125:3027–3035.[Abstract]
Lynch M, Force A. The probability of duplicate gene preservation by subfunctionalization. Genetics (2000) 154:459–473.
Magnard JL, Heckel T, Massonneau A, Wisniewski JP, Cordelier S, Lassagne H, Perez P, Dumas C, Rogowsky PM. Morphogenesis of maize embryos requires ZmPRPL35-1 encoding a plastid ribosomal protein. Plant Physiol (2004) 134:649–663.
Matsumoto N, Okada K. A homeobox gene, PRESSED FLOWER, regulates lateral axis-dependent development of Arabidopsis flowers. Genes Dev (2001) 15:3355–3364.
Mayer KF, Schoof H, Haecker A, Lenhard M, Jurgens G, Laux T. Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell (1998) 95:805–815.[CrossRef][Web of Science][Medline]
Nardmann J, Ji J, Werr W, Scanlon MJ. The maize duplicate genes narrow sheath1 and narrow sheath2 encode a conserved homeobox gene function in a lateral domain of shoot apical meristems. Development (2004) 131:2827–2839.
Nardmann J, Werr W. The shoot stem cell niche in angiosperms: expression patterns of WUS orthologues in rice and maize imply major modifications in the course of mono- and dicot evolution. Mol Biol Evol (2006) 23:2492–2504.
Okamoto T, Scholten S, Lörz H, Kranz E. Identification of genes that are up- or down-regulated in the apical or basal cell of maize two-celled embryos and monitoring their expression during zygote development by a cell manipulation- and PCR-based approach. Plant Cell Physiol (2005) 46:332–338.
Randolph LF. Developmental morphology of the caryopsis in maize. J Agric Res (1936) 53:881–916.
Reeder JR. The embryo of streptochaeta and its beaing on the homology of the coleoptile. Am J Bot (1953) 40:77–80.[CrossRef][Web of Science]
Scheres B, Benfey P, Dolan L. Root development. In: The Arabidopsis Book (2002).
Smith GL, Jackson D, Hake S. Expression ofknotted1marks shoot meristem formation during maize embryogenesis. Dev Genet (1995) 16:344–348.[CrossRef][Web of Science]
Soltis PS, Soltis DE. The origin and diversification in angiosperms. Am J Bot (2004) 91:1614–1626.
Vollbrecht E, Veit B, Sinha N, Hake S. The developmental gene knotted-1 is a member of a maize homeobox gene family. Nature (1991) 350:241–243.[CrossRef][Medline]
Wardlaw CW. Embryogenesis in plants (1955) New York: John Wiley & Sons, Inc.
Weatherwax P. The homologies of the position of the coleoptile and the scutellum in maize. Bot Gaz (1920) 69:73–90.
Wikstrom N, Kenrick P. Evolution of Lycopodiaceae (Lycopsida): estimating divergence times from rbcL gene sequences by use of nonparametric rate smoothing. Mol Phylogenet Evol (2001) 19:177–186.[CrossRef][Web of Science][Medline]
Wu X, Dabi T, Weigel D. Requirement of homeobox gene STIMPY/WOX9 for Arabidopsis meristem growth and maintenance. Curr Biol (2005) 15:436–440.[CrossRef][Web of Science][Medline]
Zimmermann R, Werr W. Pattern formation in the monocot embryo as revealed by NAM and CUC3 orthologues from Zea mays L. Plant Mol Biol (2005) 58:669–685.[CrossRef][Web of Science][Medline]
Zimmermann R, Werr W. Transcription of the putative maize orthologue of the Arabidopsis DORNROSCHEN gene marks early asymmetry in the proembryo and during leaf initiation in the shoot apical meristem. Gene Expr patterns (2007) 158–164.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  T. Kawashima, X. Wang, K. F. Henry, Y. Bi, K. Weterings, and R. B. Goldberg Identification of cis-regulatory sequences that activate transcription in the suspensor of plant embryos PNAS, March 3, 2009; 106(9): 3627 - 3632. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||