Skip Navigation


MBE Advance Access originally published online on May 30, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
20/8/1260    most recent
msg141v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Burke, W. D.
Right arrow Articles by Eickbush, T. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burke, W. D.
Right arrow Articles by Eickbush, T. H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Mol. Biol. Evol. 20(8):1260-1270. 2003
DOI: 10.1093/molbev/msg141
© 2003 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038

R5 Retrotransposons Insert into a Family of Infrequently Transcribed 28S rRNA Genes of Planaria

William D. Burke, Daljit Singh1 and Thomas H. Eickbush

Department of Biology, University of Rochester

E-mail: eick{at}mail.rochester.edu.


    Abstract
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 Literature Cited
 
A small (100 bp) region of the 28S rRNA gene has been shown to serve as the target site for the insertion of non–long terminal repeat (non-LTR) retrotransposons in both arthropods and nematodes. Here we characterize a lineage of non-LTR retrotransposons that inserts into this target site in the phylum Platyhelminthes. Dugesiid planaria contain elements, named R5, that insert 8 bp upstream of the target site used by arthropod R2 elements. The complete sequence of this element from Girardia tigrina revealed that it encoded two open reading frames (ORFs). The second ORF contained reverse transcriptase and restriction enzyme–like endonuclease domains similar to those found in R2 and R4, the elements that insert into the 28S genes of nematodes. The closest relative of R5, however, was the element NeSL-1, which inserts into the spliced leader 1 exons of nematodes. The rRNA genes of dugesiid planaria are unusual in that they comprise two types of rDNA units that differ by 8%–10% in nucleotide sequence of the 18S and 28S coding regions. Type II units are transcribed in adult tissues at levels that are less than 1% that of the type I units. R5 elements were only found inserted in the type II units, where presumably they cause less harm to the host. A second unusual aspect of the dugesiid rRNA genes is that the target site for the R5 insertion is duplicated 300 bp upstream of the original insertion site. R5 elements were identified at both sites. These findings expand the distribution of non-LTR elements that are specialized for insertion into the 28S gene and suggest that still more elements exist in other eukaryotic taxa. Attempts to trace the phylogeny of R5 did not offer sufficient resolution to determine whether R2, R4, and R5 represent the same lineage or whether they represent independent specializations for the 28S gene.

Key Words: retrotransposons • insertion specificity • rRNA gene • transcription • phylogenetic analysis


    Introduction
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 Literature Cited
 
Transposable elements are abundant components of most eukaryotic genomes. Although most elements transpose with little specificity, a significant number integrate into specific locations within a genome. The evolution of target specificity can be advantageous to both the host and the element. First, specific insertions into the genome can cause less harm than the inevitable disruption of gene expression brought about by random insertions. Second, specific insertion sites can give rise to greater opportunities for an element to control expression of its many copies.

Presumably because of their long-term associations with host lineages, retrotransposons have evolved target specificity more frequently than transposons (Eickbush and Malik 2002). Long terminal repeat (LTR) retrotransposons have evolved site specificity by adapting their integrase to form specific interactions with chromosomal proteins. Well-characterized examples are the retrotransposon families of Saccharomyces cerevisiae, which insert either upstream of tRNA genes or within silent chromatin (Kirchner, Connolly, and Sandmeyer 1995; Devine and Boeke 1996; Zhu et al. 1999). In contrast, non-LTR retrotransposons have evolved site specificity by adapting the endonuclease that initiates the integration reaction to recognize specific DNA sequences (Xiong and Eickbush 1988; Feng, Schulmann, and Boeke 1998; Christensen, Pont-Kingdom, and Carroll 2000; Takahashi and Fugiwara 2002).

Two well-characterized site-specific non-LTR retrotransposons are the R1 and R2 elements of arthropods (Eickbush 2002). These elements insert into sites, 74 bp apart, in a highly conserved region of the 28S rRNA genes (fig 1A). The insertion of either element significantly reduces the transcription of the entire rRNA transcription unit (rDNA unit). Although they share similar insertion strategies, the elements are only distantly related, with R1 elements encoding an apurinic-like endonuclease (APE), while R2 elements encode an endonuclease with a restriction enzyme–like active site. Thus, these elements appear to have independently evolved target specificity for the 28S rRNA gene.



View larger version (79K):
[in this window]
[in a new window]
 
FIG. 1. Sequence of the 28S gene region containing the R5 element insertion sites in three species of planaria. A. Diagram of a typical rRNA gene transcription unit (rDNA unit) found in eukaryotes. The size and approximate location of the 18S, 5.8S, and 28S rRNA genes are indicated. The region of the 28S gene shown in panel B is indicated. B. Nucleotide sequence of the 28S rRNA gene region. Sequence differences between 28S genes are indicated by reverse type. The 28 bp duplications found in the type II units of G. tigrina and G. dorotocephala, as well as the original copy in all units, are all boxed and shaded. Arrows indicate the locations of G. tigrina PCR and RT-PCR primers used in this report

 
Phylogenetic analysis of R1 and R2 elements from organisms throughout the phylum arthropoda suggest that these elements have been inserting into the 28S rRNA genes since the origin of this phylum (Burke et al. 1998; Gentile et al. 2001). Within insects, the R1 lineage has given rise to elements that have changed their insertion specificity for sites within the rDNA unit or for sites outside the rDNA unit (Besansky et al. 1992; Kojima and Fujiwara 2003). A third rDNA element, R3, inserts a short distance upstream of the R2 site in some insects, but to date no complete element has been found (Kerrebrock, Srivastava, and Gerbi 1989; Burke et al. 1993). The only non-arthropod element identified to date which inserts into the rDNA unit is the R4 element of nematodes. R4 elements insert into the large subunit rRNA gene at a site midway between the R1 and R2 insertion sites and are similar in structure to R2 elements (Neuhaus et al. 1987; Burke, Müller, and Eickbush 1995).

In this report we describe another R2-like element, named R5, which inserts into the large subunit rRNA gene of the more primitive organism, planaria (phylum Platyhelminthes). An unusual aspect of this system is that the rDNA units of the planaria host are composed of two diverging families (Carranza, Baguna, and Riutort 1999). One family of units is actively transcribed, whereas the second family is only infrequently transcribed. R5 elements were found only in the rarely transcribed rDNA units.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 Literature Cited
 
Organisms and Nucleic Acid Extraction
Girardia tigrina, Girardia dorotocephala, and Procotyla fluviatilis were obtained from Ward's Biological Supplies (Rochester, N.Y.). Nucleic acid was isolated from 4–5 animals by the same procedures used in the isolation of genomic DNA from Drosophila (Perez-Gonzalez and Eickbush 2002), except that the worms were first ground into a powder in liquid nitrogen. After initial precipitation with ethanol, DNA was isolated by digestion of one half of the nucleic acid at 37°C for 40 minutes with 50 units RNase A (Ambion, Inc.). RNA was isolated from the remainder by digestion with 20 units RNase-free DNase I (Ambion, Inc.). The individual digestions were phenol extracted and ethanol was precipitated for a second time. The integrity and yield of the RNA and DNA preparations were checked on 1% agarose gels.

PCR Amplification and DNA Sequencing
A 1.0-kb region of the 28S rRNA genes was subjected to polymerase chain reaction (PCR) amplification using primers GGAAGTCGGC AAATTAGAT (ribo up420) and AAGAGCCGACATCGAAGGATC, which anneal to highly conserved regions in domains five and six of eukaryotic large subunit rRNA genes (nomenclature as in Hancock, Tautz, and Dover 1988). To confirm that the 28S rRNA genes with insertions corresponded to the type II rDNA units identified by Carranza, Baguna, and Riutort (1999), the primer TCTAGTCTAAGAAATGGC, which annealed specifically to the type II 18S rRNA sequences of G. tigrina, was used in combination with the primer CCGAGG AAAGCTCAAGTC, which annealed specifically to the 28S gene sequences with R5 insertions.

Evidence for the R5 element in G. tigrina was first obtained by inverse PCR (Ochman, Gerber, and Hartl 1988) using Sau3a-digested genomic DNA and divergently oriented primers that anneal to 28S gene sequences downstream of the insertion region (Jakubczak, Burke, and Eickbush 1991). After this initial amplification recovered ~190 bp at the 3' end of the element, the 3' half of the element was obtained by PCR amplification using the primer GCNTWWGC NGAYGAY (N = any nucleotide, , ), which encodes the highly conserved amino acid sequence AF/YADD found in most non-LTR retrotransposons, and the primer GTTATAACATTACAACGAGGT, located in the region of the R5 recovered by inverse PCR. Based on the sequence of the 3' half of R5, the primer CTGCAGGTCTTTGT GGGAGTC located downstream of the AYADD region and directed toward the 5' end of the element was used in combination with the primer TCTGCCCAGTGCCATGAATGTC, which anneals to the 28S gene 70 bp upstream of the R5 insertion site. To insure that full-length R5 elements were cloned, the reverse primer GCAAGAATTCGAAACCTCTGCTC which anneals to a sequence ~2.0 kb upstream of the AYADD region was used in combination with the ribo up420 28S primer. To clone multiple 3' junctions of the R5 element, a primer near the 3' end of the R5 element, ACCCGATATCACAATGGAATC, was used in combination with the primer CGTTAATCCATTCGAG CACG (ribo down60 REV). All PCR amplifications were for 30 cycles with 55°C annealing temperatures in 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 0.2 mM dNTPs, 1 mM MgCl2, 0.25 µM of each primer, and 1.25 units of Taq DNA polymerase (Gibco-BRL) (Perez-Gonzalez and Eickbush 2002). PCR products to be sequenced were cloned into a modified mp18 vector (Burke, Müller, and Eickbush 1995). GenBank accession numbers for the 28S gene sequences are: G. tigrina type I; AY216702; G. tigrina type II, AY216703; G. dorotocephala type I, AY216704; G. dorotocephala type II, AY216705; P. fluviatilis AY216706, and for the G. tigrina R5 element, AY216701.

Reverse Transcriptase-PCR Reactions
For the reverse transcriptase (RT) reaction ~0.1 µg aliquots of total RNA from each species were annealed with the primer 5'-CAGTCGGATTCCTCTAGTCC-3' (RT PCR REV) by first heating to 70°C for 5 min and then cooling to room temperature. Primer extension reactions were conducted in 30 µl volumes with 15 units of AMV reverse transcriptase (Promega) in 50 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2, 5 mM DTT, 0.5 mM spermidine and 250 µM of each dNTP for 1 hour at 42°C. The extension reaction was diluted 3-fold and 1 µl aliquots were PCR amplified as described above for genomic DNA using primer RT PCR REV and Ribo up420, except that the RT PCR REV primer was P32-end labeled (Perez-Gonzalez and Eickbush 2002) and only 18 cycles of amplification were conducted. The products were separated on high voltage denaturing 8% polyacrylamide gels. Dried gels were exposed to PhosphorImager cassette and the relative intensities of each band determined on a Molecular Dynamics Storm Analyzer using Imagequant 1.2.

Phylogenetic Analysis
All sequences used in the phylogenetic analysis were obtained from our previous reports (Malik, Burke, and Eickbush 1999; Burke et al. 2002) except for R5 and EhRLE from Entamoeba histolytica (Sharma et al. 2001). Protein domains of the elements were aligned using the multiple alignment options in CLUSTAL X (Thompson et al. 1997), followed by minor manual adjustments of gaps. Phylogenetic trees were generated by the Neighbor-Joining method using the PAM250 matrix of PHYLIP (Felsenstein 1993), and maximum parsimony heuristic options as implemented in PAUP* version 4.0d64 (tree-bisection-reconnection branch swapping with maximum number of trees saved at each step limited to five). Bootstrapping was also carried out using PAUP* version 4.0d64 (Swofford 1999).


    Results
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 Literature Cited
 
Two Types of 28S rRNA Genes in Planaria
Previous experiments by Carranza and co-workers (Carranza et al. 1996; Carranza, Beguna, and Riutort 1999) have suggested that the rDNA units of species from the family Dugesidae can be divided into two distinct families (type I and type II). Species from the sister families Planariidae and Dendrocoelidae contain a single type of rDNA unit. Nucleotide divergence within each rDNA type from the dugesiid species is minimal, whereas divergence between the rDNA types in a species averaged 9% for the 18S rRNA coding region. Comparison of the ITS regions between the two rDNA types revealed numerous indels, which made alignment of the sequences difficult.

We have extended this analysis to the region of the 28S gene that includes the R1–R4 insertion sites in arthropods and nematodes (fig. 1A). Primers to conserved regions within domains 5 and 6 of the 28S gene were used to amplify 28S sequences from three species of planaria. This amplified region extends from 400 bp upstream of the R1–R4 insertion region to 600 bp downstream of this region. Multiple individually cloned products were then sequenced. Sequence comparison of the 5' half of this region including the R1–R4 insertion sites is shown in figure 1B. Two distinct 28S gene sequences were found in Girardia tigrina and Girardia dorotocephala, but only one 28S gene sequence was recovered from the more distant Procotyla fluviatilis.

G. tigrina and G. dorotocephala are closely related species in the family Dugesidae (Carranza, Beguna, and Riutort 1999). The family association of P. fluviatilis is not known, but based on its 28S gene sequence divergence from the other two species, it is unlikely to be a member of the Dugesidae family. The level of nucleotide divergence between the type I and type II 28S genes from the same species was 7.2% (G. dorotocephala) and 8.0% (G. tigrina). Most of the nucleotide substitutions between type I and type II units in G. tigrina and G. dorotocephala were located within an expansion region D8 of the 28S gene (nucleotides 70–260 in fig. 1B). Expansion regions of rRNA genes are under reduced selective constraint and often contain length variation between species (reviewed in Hillis and Dixon 1991). A 23-bp insertion was found in the type II 28S genes of both G. tigrina and G. dorotocephala that corresponded to the duplication of a region located nearly 300 bp downstream (boxed regions in fig. 1B).

The type II 18S genes in Dugesidae were found to be accumulating nucleotide substitutions 2.3 times faster than type I repeats (Carranza, Baguna, and Riutort 1999). The 28S gene sequences reported here also suggested a faster rate of divergence for the type II units. In the ~1,000 bp region sequenced from the 28S genes there were nine nucleotide substitutions between the type II repeats of G. tigrina and G. dorotocephala while there were no substitutions between the type I repeats of these two species. While the type II units are evolving faster, no data were obtained to suggest that the type II units are inactive. Most nucleotide substitutions were clustered in the expansion segment, and secondary structure predictions of the rRNA from both type I and type II units reveal co-variation conserving the secondary structure (Carranza, Buguna, and Riutort 1999; and data not presented).

Previous attempts to monitor expression of the 18S gene from the type I and II units revealed no type II transcripts on Northern blots of RNA (Carranza et al. 1996), but low levels of RNA using the more sensitive reverse transcriptase (RT)-PCR approach (Carranza, Baguna, and Riutort 1999). Unfortunately, these RT-PCR experiments were not conducted in a manner that enabled a determination of the relative level of 18S rRNA transcripts from the two types of units. We have also used RT-PCR to monitor transcripts from the two types of rDNA units. In the case of the 28S gene transcripts, the presence of the 23-bp indel between the two genes has provided the means to directly compare the relative levels of transcripts from the two types of genes. The primer (RT PCR REV, fig. 1B) was used to prime reverse transcription of rRNA derived from both 28S genes. After reverse transcription the cDNA was amplified using the same primer (RT PCR REV) in combination with the primer Ribo up420. Because of the 23-bp indel between the two types of 28S genes, the relative proportion of the two transcripts could be estimated. Shown in figure 2 are the results of such RT-PCR reactions compared with direct PCR amplification of genomic DNA.



View larger version (71K):
[in this window]
[in a new window]
 
FIG. 2. An RT-PCR assay showing the relative transcript levels of the type I and type II 28S genes. cDNA was first made by reverse transcription of total RNA using the primer RT-PCR REV (see fig. 1). This cDNA was then PCR amplified using the primers Ribo up420 and RT PCR REV with the latter P32 end-labeled. For each species: lane 1, complete RT-PCR reaction; lane 2, RT-PCR reaction but no reverse transcriptase added in the first step; lane 3, direct PCR amplification of genomic DNA. Products from transcripts of the type II genes are barely visible at levels less than 0.5% of that from type I genes. The DNA sequencing ladder of the m13 vector at right provides a size standard

 
Polymerase chain reaction analysis of the genomic DNA confirmed that type I and II 28S genes were present in G. tigrina and G. dorotocephala but not in P. fluviatilis. Type II genes were twice as abundant as the type I genes in G. tigrina, whereas type I and II genes in G. dorotocephala were more equal in number. In the case of the RT-PCR reactions, transcripts of the type I 28S genes were readily detected in G. tigrina and G. dorotocephala whereas transcripts of the type II genes were at best only weakly visible above the background of the gel. Quantitation of the relative levels of the two bands indicated that type II 28S gene transcripts were present at levels that were 0.5% that of the type I 28S gene transcripts.

In summary, our findings confirmed that the two types of rDNA units in dugesiid planaria also contain 28S genes that differ substantially in sequence. The 28S genes of both units appear to be under selective constraint, but under normal growth conditions the levels of RNA transcripts from the type II units are abut 200-fold lower than the levels of the type I units.

Insertion Properties of the R5 Elements
Our first evidence for the presence of an insertion in the 28S rRNA genes of G. tigrina was obtained by inverse PCR (see Materials and Methods). The G. tigrina insertion appeared to be a non-LTR retrotransposon because it ended in a series of short tandem repeats, similar to the tandem repeats found at the 3' end of some non-LTR retrotransposons (Eickbush and Malik 2002). To clone and sequence a complete R5 element, PCR amplification was conducted with a degenerate primer to the highly conserved AY/FADD protein motif within the reverse transcriptase domain of non-LTR retrotransposons and a primer to the sequenced region of the R5 element. To clone the 5' half of the element, a second set of PCR amplifications was conducted using primers to sequenced regions from the 3' half of the element and primers to the 28S gene upstream of the R5 insertion site. This approach revealed a second characteristic that R5 elements shared with non-LTR retrotransposons: many copies of R5 were 5' truncated (i.e., were missing variable lengths from their 5' end). For example, R5 copies were detected that were only 0.3 kb in length. The largest PCR fragments generated by amplifying genomic DNA with R5 primers directed to the 5' end of the element and upstream 28S gene sequences presumably revealed full-length elements (see Materials and Methods).

The 5' and 3' junction sequences of multiple R5 copies with the 28S gene are summarized in figure 3. Surprisingly R5 insertions were located at two sites. One site was located 8 bp upstream of the R2 insertion site (nucleotide position 421 in fig. 1B). The 28S gene sequences flanking the 3' junction of the R5 insertions contained an A residue 5 bp downstream of the insertion site and a C residue 45 bp downstream of this site, indicating that the insertions were located in type II rDNA units. The second R5 insertion site was located 287 bp upstream of the first site (nucleotide position 134 in fig. 1). This upstream site was within the duplicated sequence found in type II 28S genes.



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 3. Junction sequences of G. tigrina R5 elements in the downstream (A) and upstream (B) sites of the type II genes. In each panel the sequence of a short segment of the 28S gene is shown with the 28 bp duplication boxed as in figure 1. Shown below the 28S sequences are examples of the R5 element 5' and 3' junctions located in that site. The 5' and 3' junctions were independently cloned, thus 5' and 3' junctions shown on the same line of text do not correspond to the two ends of the same genomic copy of R5. Most R5 insertions result in a deletion of one base pair; however, two of the 5' junctions had undergone additional substitutions or deletions of 28S gene sequences. Different R5 sequences at the 5' junctions correspond to truncations of the element with the top sequence in (A) corresponding to a full-length element. The R5 elements from G. tigrina end in GA(T)n repeats, where n equals 2 to 8 nucleotides. (C) 3' junctions of R5 elements obtained from G. dorotocephala. The terminal repeats in this species are TGT repeats. 5' junctions were not obtained

 
The 3' ends of R5 elements in both insertion sites were composed of 33–80 bp of a simple repeat, AG(T)n, where n equals 2 to 8 nucleotides. Based on studies of the R2 and I element retrotransposition mechanisms (Luan et al. 1993; Luan and Eickbush 1995; Chaboissier, Finnegan, and Bucheton 2000), the variable number of 3' repeats and the sequence variation between these repeats were generated during the integration mechanism by slippage of the R5 reverse transcriptase as it attempted to engage the RNA template for cDNA synthesis.

Comparison of the 5' junction sequences of the R5 insertions with the uninserted 28S gene at each site indicated that one base pair was deleted during the process of insertion. However, because the T shown in figure 3 as part of the downstream 28S gene sequence could also correspond to part of the 3' tail of R5, it is also possible that R5 insertions resulted in 2 bp deletions. Two R5 insertions also generated additional deletions or replacements of the 28S gene upstream of the insertion (fig. 3A). Two base pair deletions of the target site with occasional more extensive deletions and replacements are also characteristic of R2 insertions in insects (George, Burke, and Eickbush 1996; Burke et al. 1999).

Like our findings with R1, R2, and R4, the level of nucleotide divergence of different R5 elements was low. With sequences from near the 3' end of the element to enable different copies to be identified by their variable 3' tails, the average level of nucleotide sequence divergence between 12 different R5 elements was 1.4% (range 0.4%–2.3%). Because our DNA was derived from 4 animals recently collected from the wild, this number is likely to represent the average level of R5 divergence within a population of G. tigrina. It should be noted that in our sequencing of different R5 copies we also detected a second family of R5 elements in G. tigrina that exhibited 19.9% nucleotide divergence from the first family. Although a complete copy of this second family was not recovered, this second family was useful in establishing the ORF structure of the R5 elements (see below).

To determine what fraction of the 28S genes of G. tigrina were inserted with R5, we conducted a Southern blot in which we probed RsaI-digested genomic DNA with the 28S gene region downstream of both R5 insertion sites (fig. 4D, probe A). Uninserted 28S genes of type I gave rise to a 0.55-kb band, and uninserted genes of type II gave rise to a 0.77-kb band. As shown in fig. 4A, the relative proportion of these two rDNA types was similar to that revealed by the PCR analysis of genomic DNA in figure 2. R5 elements at the downstream insertion site of the type II 28S genes gave rise to a 1.0-kb band which is barely visible in figure 4A. This band was at a level only 1% that of the uninserted type II band. A band at 1.3 kb corresponding to R5 insertions at the upstream site was not visible on the blot.



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 4. Genomic blots and PCR amplifications used to determine the distribution of R5 elements in G. tigrina. (A) Genomic blots of RsaI digested genomic DNA probed with a segment of the 28S gene downstream of the R5 insertion site (see diagram in D). The major band at 0.77 kb corresponds to uninserted type II genes; the band at 0.55 kb, to the type I genes; and the faint band at 1.0 kb, to R5 insertions in the down site of the type II gene. A 1.3 kb band corresponding to R5 insertions in the up site is too faint to be visible. (B) PCR assay to detect the relative levels of R5 insertions in the up and down sites of the 28S gene. Lane 1, PCR amplification of genomic DNA using one primer within the R5 element and a second primer (Ribo down60 REV, fig. 1B) downstream of both insertion sites (see diagram in D). Lane 2, PCR amplification of genomic DNA using the same R5 primer and a primer upstream of the down site (Ribo up70 REV, fig. 1B). R5 elements in the down site are 5–10 times more abundant than elements in the up site, which explains why these insertions were not seen in A. (C) Genomic blot of SphI-ClaI digested genomic DNA probed with R5 sequences from near the 3' end of the element (see diagram in D). The bands at 1.4 and 1.75 kb correspond to R5 elements in the down and up sites, respectively. Other faint bands correspond to 5' truncated R5 elements, restriction polymorphisms, or R5 insertions outside of 28S genes. The sizes of the DNA markers used in panels A–C are shown at the right. (D) Restriction maps of the two types of 28S genes and of R5 elements in the up and down sites. 28S gene sequences are shown as open horizontal bars and R5 sequences as black horizontal bars. The probes used to hybridize to the blots in panels A (probe A) and C (probe C) are shown at the bottom. The predicted sizes of the hybridizing bands corresponding to the inserted and uninserted 28S genes are indicated. The location (inverted arrows) and sizes of the PCR products in B are shown below the gene diagrams as shaded bars. The length of the AG(T)n tail varies, but it was assumed to be 50 bp for the calculations in this figure

 
As a more sensitive means to determine the relative level of R5 insertions in the upstream and downstream insertion sites, we conducted a PCR amplification using one primer to the 28S gene downstream of both insertion sites and a primer near the 3' end of the R5 element (diagrammed in figure 4D). As shown in figure 4B, lane 1, R5 insertions in the upstream and downstream insertion sites gave rise to bands at approximately 1.1 and 0.8 kb, respectively. To confirm that the upper band corresponded to R5 insertions at the upstream 28S gene site, a second 28S primer that annealed upstream of the downstream site was used in combination with the R5 primer (~1.0-kb band in lane 2). This PCR analysis indicated that there were 5–10 times as many R5 elements located at the downstream site as at the upstream site, explaining why no inserted band was seen for the upstream site in figure 4A.

Finally, to determine what fraction of the R5 sequences in G. tigrina are located in the 28S genes, SphI–ClaI digested genomic DNA was probed with a segment of DNA from near the 3' end of the R5 element (fig. 4D, probe C). The major 1.4-kb and 1.7-kb bands seen in this blot (fig. 4C) corresponded, respectively, to R5 insertions at the down and up sites of the type II 28S genes. Only a few faint upper bands (more visible on longer exposures) correspond to R5 elements with restriction polymorphisms, extreme 5' truncations, or locations outside the rDNA units.

Structure of R5 and Its Relationship to Other Non-LTR Retrotransposons
The longest R5 elements recovered were 4.8 kb in length and encoded two ORFs (fig. 5). The 3' untranslated region, excluding the variable length AG (T)n tail, was only 132 bp in length, whereas the 5' UTR was only 8 bp in length; thus these ORFs occupied over 96% of the element's length. The second R5 ORF encoded a central RT domain with fingers, palm, and thumb subdomains typical of other non-LTR retrotransposons (Burke, Malik, and Eickbush 1999). Located at the C-terminal end of the second ORF was a restriction-like endonuclease (EN) domain that was similar to that of R2 and R4 elements. Within the EN domain were two identifiable motifs, a C-X2-C-X8-H-X4-C sequence that is potentially a nucleic acid binding motif and a PD-X12-D motif which forms part of the active site of the enzyme (Yang, Malik, and Eickbush 1999). Most lineages of non-LTR elements are like R1 and encode an apurinic-like endonuclease (APE) upstream of the RT domain (Malik, Burke, and Eickbush 1999).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 5. Diagram of the ORF structure of the R5 element compared to other non-LTR retrotransposons. ORFs are represented by rectangular boxes, with boxes at different levels indicating ORFs in different reading frames. Shaded regions indicate identified enzymatic domains: RT, reverse transcriptase; APE, apurinic-apyrimidinic endonuclease; PR, cysteine proteinase; EN, restriction-like endonuclease. Two conserved regions of the EN domain, a C-X2-C-X8-H-X4-C domain (CCHC) and a PD-X12-D domain (PD..D) which has been shown to be part of the active site of the endonuclease are indicated with the black bars (Yang, Malik, and Eickbush 1999). Gray bars at the amino-terminal end of the single ORF in NeSL-1 and R2 and at the C-terminal end of the R1 ORF1 indicate putative nucleic acid binding motifs

 
To determine the phylogenetic relationship of R5 to other non-LTR retrotransposons, the RT domain of R5 was aligned with that of other non-LTR retrotransposons. Based on this alignment, we used Neighbor-Joining algorithms to construct a phylogeny (fig. 6). The R5 element was found to be located in the same lineage (clade) as NeSL-1, an element in Caenorhabditis elegans which specifically inserts into the tandemly repeated spliced leader-1 genes (Malik and Eickbush 2000). Unfortunately, the phylogenetic relationship of the NeSL/R5 lineage relative to the other non-LTR clades was not resolved using either the RT domain (fig. 6) or the RT domain in combination with the EN domain (data not shown). In a previous attempt to resolve the non-LTR element phylogeny, it was suggested that the NeSL and the R4 clades were sister groups relative to the R2 clade (Burke et al. 2002). The bootstrap support for this relationship was low, however, and the addition of the divergent R5 element within the NeSL-1 clade and of the EhRLE element from Entamoeba histolytica (Sharma et al. 2001) to the R4 clade has unfortunately further reduced resolution of the phylogeny of those elements with C-terminal EN domains.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 6. Phylogenetic relationship of R5 to other non-LTR retrotransposons based on their reverse transcriptase domain. The phylogeny presented is derived by the Neighbor-Joining method based on the 420 amino acid residue positions that correspond to the fingers, palm, and thumb regions of the RT domain (Malik, Burke, and Eickbush 1999). The numbers next to each node indicate bootstrap values as percentages of 1,000 replicates. The analysis was conducted with the complete set of non-LTR retrotransposon sequences as they appear at EMBL (accession number ALIGN_000231) with the addition of the R5 and EhRLE sequences. Only branches corresponding to elements with C-terminal restriction-like endonuclease (APE) domains are shown. All elements with APE endonuclease domains are located on the branch shown (dotted box). The topology of branches within this box is essentially the same as that in Malik, Burke, and Eickbush (1999). Each major grouping of elements (clades) was also supported by maximum parsimony methods (> 50% bootstrap values)

 
The structure of R5 elements is unusual compared to that of R2, R4, and NeSL-1, because they contain two overlapping ORFs (fig. 5). All sequenced copies of the R5 element contained these two ORFs separated by this frameshift. In addition, as mentioned in the preceding section, a second family of R5 elements was discovered in G. tigrina. A 1.5-kb region spanning the region of the frameshift was sequenced from this second family. In comparing the second family with the sequence of the first family, we detected seven indels, yet both ORFs and the location of the frameshift are conserved. Because this frameshift has been conserved during the evolution of the two families, it is likely a feature of active R5 elements.

The identification of a frameshift in R5 may be relevant to an unusual feature of its nearest relative, NeSL-1 (Malik and Eickbush 2000). As shown in figure 5, NeSL-1 elements contain a single ORF that is somewhat longer than the combined lengths of the two R5 ORFs. Unlike all other non-LTR retrotransposons, the ORF of NeSL-1 contains a cysteine protease domain (PR) upstream of the RT domain. Sequences similar to a cysteine protease were not identified in R5. If the protease of NeSL-1 were to cleave its large ORF immediately downstream of this domain, as is typical for proteases within retrotransposons and retroviruses (Kirchner and Sandmeyer 1993), then the size of the protein containing the RT/EN would be similar to that encoded by R5 ORF2 as well as that of the R2 and R4 ORFs. The N-terminal region of R2 contains zinc-finger and c-myb DNA binding domains (gray vertical bars) involved in DNA binding (Burke et al. 1999; S. Christensen and T. Eickbush, in preparation). NeSl-1 elements also contain zinc-finger motifs at the N-terminal end of the NeSl-1 ORF, but no such motifs could be identified in R5 and R4.

R5 Elements Are Present in G. dorotocephala
We have conducted preliminary experiments to confirm that R5 elements are also present in G. dorotocephala. The 3' half of the elements were obtained by PCR amplification using the 28S gene primer Ribo down60 REV (fig. 1B) and the degenerate primer to the highly conserved AY/FADD motif of the RT domain (see Materials and Methods). A G. dorotocephala insertion element was identified that was inserted into the identical site as the R5 element of G. tigrina. The R5 element of G. dorotocephala ended in a series of GTT repeats, similar but not identical to the tandem repeats found at the 3' end of R5 elements in the G. tigrina (fig. 3C). The G. dorotocephala R5 element was highly divergent from that of G. tigrina. Comparison of the protein-encoding regions revealed only 25% identity (40% similarity), and their 3' untranslated regions could not be unambiguously aligned. A series of Southern blots and PCR experiments of the type described in figure 4A and 4B were also conducted for G. dorotocephala (data not shown). The fraction of the 28S genes with R5 insertions in G. dorotocephala was again low (1%–2%). Unlike G. tigrina, no evidence was obtained for R5 insertions in the upstream (duplicated) target site of the G. dorotocephala 28S genes.


    Discussion
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 Literature Cited
 
The R5 retrotransposons of dugesiid planaria insert into the same region of the 28S gene as the R1–R4 elements of arthropods and nematodes (fig. 7). A DNA-mediated element, Pokey, has also been identified in the 28S genes of crustaceans (Penton, Sullender, and Crease 2002). The different copies of R5 in the rDNA loci of G. tigrina exhibit little nucleotide divergence, with most copies devoid of mutations that would cause premature termination or inappropriate frameshifts. This would suggest that like R1 and R2, R5 elements must continually retrotranspose to maintain their presence in the rDNA locus (Perez-Gonzalez and Eickbush 2001, 2002). However, unlike the previously described R elements, the percentage of the G. tigrina or G. dorotocephala rDNA units inserted with R5 is only around 1%.



View larger version (8K):
[in this window]
[in a new window]
 
FIG. 7. Location of transposable element insertions in a localized region of the 28S rRNA genes of eukaryotes. Diagram of a typical rRNA gene transcription unit (rDNA unit) found in eukaryotes with the location of the 18S, 5.8S, and 28S rRNA genes indicated. The nucleotide sequence of a small region of the D. melanogaster 28S rRNA gene is presented, but all eukaryotic 28S gene sequences are highly conserved throughout this localized region. Arrows indicate the insertion site of the various elements based on their 3' junction with the gene. All insertions sites are numbered relative to the insertion site of R2. R1, R2, R4, and R5 elements are non-LTR retrotransposons, and their structures are shown in figure 6. R3 elements have been found in two insects, but the significant features of these elements have not been characterized (Kerrebrock, Srivastava, and Gerbi 1989; Burke et al. 1993). Pokey is a DNA-mediated element of the Piggyback class and has been identified in Daphnia pulex (Penton, Sullender, and Crease 2002)

 
The rRNA genes of dugesiid species are unusual in that they comprise two types of rDNA units that differ by 8%–10% in nucleotide sequence. The duplication or physical separation event that gave rise to these two families of rDNA units has been estimated to have occurred about 100 MYA (Carranza, Beguna, and Riutort 1999). The presence of two families of rRNA genes in the same species is not without precedent. There are two sets of tandemly arranged 5S rRNA genes in Xenopus laevis, one specific for somatic tissues and one specific for oocyte ribosomes (Peterson, Doering, and Brown 1980). More similar to the situation in planaria are the two sets of rDNA units in Plasmodium species (Dame, Sullivan, and McCutchan 1984). One set is expressed during the sporozite stage in the mosquito host, and the second set is expressed during the blood stage in the mammalian host (Gunderson et al. 1987). Perhaps the type II rDNA units of planaria are also expressed only in limited cell types or during limited developmental stages.

Based on the six 5' junction sequences and the twelve 3' junction sequences, G. tigrina R5 elements are preferentially inserted in the infrequently transcribed type II rDNA units. There are only three nucleotide differences between the type I and II 28S genes of G. tigrina in the 35 bp to either side of the insertion site. Thus it seems unlikely that sequence recognition by the R5 endonuclease could be responsible for the preference of insertions for the type II genes. A more likely basis for the R5 preference for inserting into type II genes is the chromatin structure of the insertion site. The R2 endonuclease can conduct the integration reaction when the target site is assembled into nucleosomes, but the reaction is highly dependent on the translational phase of the nucleosome (Ye et al. 2002). Thus it is possible that differences in the position of the nucleosomes, or higher order structures of the chromatin, inhibit insertion of R5 elements into the type I genes. An alternative explanation for the distribution of R5 elements is that these elements can insert into type I units but that such insertions are strongly selected against. When R elements insert into the rDNA units of insects and nematodes, transcription of the unit is severely inhibited (Long and Dawid 1979; Kidd and Glover 1981; Jamrich and Miller 1984; Neuhaus et al. 1987). Because eukaryotes have more rDNA units than are needed at any one time for rRNA synthesis, the inactivation of a limited fraction of units may have little effect on the host's fitness. However, if G. tigrina had no mechanism to turn off the transcription of R5-inserted units, then defective 28S rRNA would be produced, which could be highly damaging to the organism. As a result, R5 insertions in type I units may be strongly selected against and rapidly eliminated, whereas insertions in the infrequently transcribed type II units are less damaging and are able to accumulate.

A second unusual feature of R5 insertion is that because of a sequence duplication, R5 elements can insert into two sites approximately 300 bp apart. The duplicated sequence is identical in G. tigrina and G. dorotocephala, suggesting that this duplication arose in the common ancestor of these species. Although the duplication of a short DNA segment at a site 300 bp from the original site is difficult to explain by recombination, insights into the generation of this duplication may be obtained from studies of R2 retrotransposition. Short segments of the upstream 28S gene, usually 20–30 bp in length, are sometimes co-inserted along with the R2 sequence during its integration (Burke et al. 1999). These 5' transduced 28S gene sequences have been suggested to result from reverse transcription of flanking 28S gene sequences present on the R2 RNA transcript.

Using this analogy to R2, we can suggest the following model for the generation of a duplicate R5 target site in the type II 28S genes of planaria. In the first step, a rare R5 retrotransposition event involving transduced 28S gene sequences occurred at a site ~300 bp upstream of the normal insertion site. This location may have been selected by the R5 endonuclease because this site contains sequence identity to the normal R5 target site. Using the current sequence of the type I genes to infer the probable sequence of this region before insertion, the upstream site contained an 8 of 10 match to the normal R5 insertion site (TGATCTTT versus TGATCTTT). In the second step, the R5 sequences were eliminated by recombination from the upstream site, leaving behind the duplicated 28S sequences. In the final step the continuing process of the concerted evolution of the rDNA locus spread the sequence duplication to all type II 28S genes of the species.

The discovery of R5 elements in planaria has important implications for the origin and evolution of several of the oldest non-LTR retrotransposon lineages. Both the phylogeny using the RT domain and the presence of a C-terminal EN domain suggest that R2, R4, and R5 represent three of the older clades of non-LTR retrotransposons. In contrast, R1 elements encode an APE endonuclease and are part of a younger lineage of non-LTR retrotransposons (Malik, Burke, and Eickbush 1999). Whereas one or more lineages of 28S gene-specific R1 elements are present in all classes of arthropods (Burke et al. 1998), elements from the R1 clade have also been identified which specifically insert into telomeric repeats (TRAS and SART elements), into CA tandem repeats (WALDO elements), and into other specific locations of either the 18S or 28S genes (RT, R6, and R7 elements) (Besansky et al. 1992; Kubo et al. 2001; Kojima and Fujiwara 2003). Thus lineages of R1-like elements have evolved specificities for new sites both within and outside the rDNA units.

The presence in the 28S genes of a flatworm of non-LTR retrotransposons that are similar in structure to those of the R2 and R4 elements can have two possible explanations. First the elements could represent the same lineage and, like the R1 lineage, have shifted their insertion sites. This model implies that throughout animal history the rRNA genes may have served as a breeding ground for non-LTR retrotransposons that have changed their insertion specificities. For example, elements within the R5 clade insert within the spliced leader exons of nematodes (NeSL-1 elements). The R4 clade contains elements that insert into tandem TA or TAA repeats—Dong elements in insects (Xiong and Eickbush 1993) and elements with no obvious target specificity, REX6 and EhRLE elements, in vertebrates and protozoans (Volff et al. 2001; Sharma et al. 2001). In the second model for the evolution of R2-like elements, R2, R4, and R5 could represent separate lineages of elements that have independently evolved specificity for the 28S gene. Unfortunately, attempts to define the phylogenetic relationship of the R2, R4, and R5 elements based on the sequence of their ORFs does not provide sufficient resolution to determine the relationship of the elements (see fig. 6). Evidence for or against these models should be obtained when more elements from these clades are identified, particularly in more primitive organisms. No matter which model is correct, the small region of the 28S gene shown in figure 7 is clearly a highly favored location for the insertion of transposons. The abundance and long history of these elements suggest that their life histories are intimately tied to the rDNA locus. They will thus provide clues and new tools for the study of both non-LTR retrotransposons and the rRNA genes themselves.


    Acknowledgements
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 Literature Cited
 
This work was supported by National Science Foundation grant MCB-9974606 to T.H.E. We thank Malka Korman, whose experiments originally suggested that an R-like element was inserted in the 28S genes of G. tigrina, and Thomas Prentice for assistance with the phylogenetic analysis. We also thank D. Eickbush for helpful comments on the manuscript.


    Footnotes
 
1 Present address: State University of New York at Buffalo, School of Medicine and Biomedical Sciences. Back

Pierre Capy, Associate Editor Back


    Literature Cited
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 Literature Cited
 

    Besansky, N. J., S. M. Paskewitz, D. M. Hamm, and F. H. Collins. 1992. Distinct families of site-specific retrotransposons occupy identical positions in the rDNA genes of Anopheles gambiae. Mol. Cell. Biol. 12:5102-5110.[Abstract/Free Full Text]

    Burke, W. D., D. G. Eickbush, Y. Xiong, J. L. Jakubczak, and T. H. Eickbush. 1993. Sequence relationship of retrotransposable elements R1 and R2 within and between divergent insect species. Mol. Biol. Evol. 10:163-185.[Abstract]

    Burke, W. D., H. S. Malik, J. P. Jones, and T. H. Eickbush. 1999. Conserved structure and mechanism of integration of the R2 retrotransposable element in all arthropods. Mol. Biol. Evol. 16:502-511.[Abstract]

    Burke, W. D., H. S. Malik, W. C. Lathe, III, and T. H. Eickbush. 1998. Are retrotransposons longterm hitchhikers? Nature 392:141-142.[CrossRef][Medline]

    Burke, W. D., H. S. Malik, S. M. Rich, and T. H. Eickbush. 2002. Ancient lineages on non-LTR retrotransposons in the primitive eukaryote, Giardia lamblia. Mol. Biol. Evol. 19:619-630.[Abstract/Free Full Text]

    Burke, W. D., F. Müller, and T. H. Eickbush. 1995. R4, a non-LTR retrotransposon specific to the large subunit rRNA genes of nematodes. Nucleic Acids Res. 23:4628-4634.[Abstract/Free Full Text]

    Carranza, S., J. Baguna, and M. Riutort. 1999. Origin and evolution of paralogous rRNA gene clusters within the flatworm family Dugusiidae (Platyhelminthes, Tricladidia). J. Mol. Evol. 49:250-259.[CrossRef][Web of Science][Medline]

    Carranza, S., G. Giribet, C. Ribera, J. Baguna, and M. Riutort. 1996. Evidence that two types of 18S rDNA coexist in the genome of Dugesia (Schmidtea) mediterranea (Platyhelminthes, Turbellaria, Tricladidia). Mol. Biol. Evol. 13:824-832.[Abstract]

    Chaboissier, M. C., D. Finnegan, and A. Bucheton. 2000. Retrotransposition of the I factor, a non-long terminal repeat retrotransposon of Drosophila, generates tandem repeats at the 3' end. Nucleic Acids Res. 28:2467-2472.[Abstract/Free Full Text]

    Christensen, S., G. Pont-Kingdom, and D. Carroll. 2000. Target specificity of the endonuclease from Xenopus laevis non-long terminal repeat retrotransposon, Tx1L. Mol. Cell. Biol. 20:1219-1226.[Abstract/Free Full Text]

    Dame, J. B., M. Sullivan, and T. F. McCuthan. 1984. Two major sequence classes of ribosomal RNA genes in Plasmodium berghei. Nucleic Acids Res. 12:5943-5952.[Abstract/Free Full Text]

    Devine, S. E., and J. D. Boeke. 1996. Integration of the yeast retrotransposon Ty1 is targeted to regions upstream of genes transcribed by RNA polymerase III. Genes Dev. 10:620-633.[Abstract/Free Full Text]

    Eickbush, T. H. 2002. R2 and related site-specific non-long terminal repeat retrotransposons. Chapter 34 in N. Craig, R. Craigie, M. Gellert, and A. Lambowitz, eds. Mobile DNA II. American Society of Microbiology Press, Washington, D.C.

    Eickbush, T. H., and H. S. Malik. 2002. Evolution of retrotransposons. Chapter 47 in N. Craig, R. Craigie, M. Gellert, and A. Lambowitz, eds. Mobile DNA II. American Society of Microbiology Press, Washington, D.C.

    Felsenstein, J. 1993. PHYLIP (phylogeny inference package). Version 3.55. Distributed by the author, Department of Genetics, University of Washington, Seattle.

    Feng, Q., G. Schulmann, and J. D. Boeke. 1998. Retrotransposon R1Bm endonuclease cleaves the target sequence. Proc. Natl. Acad. Sci. USA 95:2083-2088.[Abstract/Free Full Text]

    Gentile, K., W. D. Burke, W. C. Lathe, III, and T. H. Eickbush. 2001. Stable and unstable lineages of the R1 retrotransposable element in the genus Drosophila. Mol. Biol. Evol. 18:235-245.[Abstract/Free Full Text]

    George, J. A., W. D. Burke, and T. H. Eickbush. 1996. Analysis of the 5' junctions of R2 elements with the 28S gene: implications for non-LTR retrotransposition. Genetics 142:853-863.[Abstract]

    Gunderson, J. H., M. L. Sogin, G. Wollett, M. Hollingdale, V. F. De La Cruz, A. P. Walters, and T. F. McCuthan. 1987. Structurally distinct, stage specific ribosomes occur in Plasmodium. Science 238:933-937.[Abstract/Free Full Text]

    Hancock, J. M., D. Tautz, and G. A. Dover. 1988. Evolution of the secondary structures and compensatory mutations of the ribosomal RNAs of Drosophila melanogaster. Mol. Biol. Evol. 5:393-414.[Abstract]

    Hillis, D. M., and M. T. Dixon. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Q. Rev. Biol. 66:411-453.[CrossRef][Medline]

    Jakubczak, J. L., W. D. Burke, and T. H. Eickbush. 1991. Retrotransposable elements R1 and R2 interrupt the rRNA genes of most insects. Proc. Natl. Acad. Sci. USA 88:3295-3299.[Abstract/Free Full Text]

    Jamrich, M., and O. L. Miller, Jr. 1984. The rare transcripts of interrupted rRNA genes in Drosophila melanogaster are processed or degraded during synthesis. EMBO J. 3:1541-1545.[Web of Science][Medline]

    Kerrebrock, A. W., R. Srivastava, and S. A. Gerbi. 1989. Isolation and characterization of ribosomal DNA variants from Sciara coprophila. J. Mol. Biol. 210:1-13.[CrossRef][Web of Science][Medline]

    Kidd, S. J., and D. J. Glover. 1981. Drosophila melanogaster ribosomal DNA containing type II insertions is variably transcribed in different strains and tissues. J. Mol. Biol. 151:645-662.[CrossRef][Web of Science][Medline]

    Kirchner, J., C. M. Connolly, and S. B. Sandmeyer. 1995. Requirement of RNA polymerase III transcription factors for in vitro position-specific integration of a retrovirus like element. Science 267:1488-1491.[Abstract/Free Full Text]

    Kirchner, J., and S. B. Sandmeyer. 1993. Proteolytic processing of Ty3 proteins is required for transposition. J. Virol. 67:19-28.[Abstract/Free Full Text]

    Kojima, K. K., and H. Fujiwara. 2003. Evolution of target specificity in R1 clade non-LTR retrotransposons. Mol. Biol. Evol. 20:351-361.[Abstract/Free Full Text]

    Kubo, Y., S. Okazaki, T. Anzai, and H. Fujiwara. 2001. Structural and phylogenetic analysis of TRAS, telomeric repeat-specific non-LTR retrotransposon families in Lepidopteran insects. Mol. Biol. Evol. 18:848-857.[Abstract/Free Full Text]

    Long, E. O., and I. B. Dawid. 1979. Expression of ribosomal DNA insertions in Drosophila melanogaster. Cell 18:1185-1196.[CrossRef][Web of Science][Medline]

    Luan, D. D., and T. H. Eickbush. 1995. RNA template requirements for target DNA-primed reverse transcription by the R2 retrotransposable element. Mol. Cell. Biol. 15:3882-3891.[Abstract]

    Luan, D. D., M. H. Korman, J. L. Jakubczak, and T. H. Eickbush. 1993. Reverse transcription of R2Bm RNA is primed by a nick at the chromosomal target site: a mechanism for non-LTR retrotransposition. Cell 72:595-605.[CrossRef][Web of Science][Medline]

    Malik, H. S., W. D. Burke, and T. H. Eickbush. 1999. The age and evolution of non-LTR retrotransposable elements. Mol. Biol. Evol. 16:793-805.[Abstract]

    Malik, H. S., and T. H. Eickbush. 2000. NeSL-1, an ancient lineage of site-specific non-LTR retrotransposons from Caenorhabditis elegans. Genetics 154:193-203.[Abstract/Free Full Text]

    Neuhaus, H., F. Müller, A. Etter, and H. Tobler. 1987. Type I–like intervening sequences are found in the rDNA of the nematode Ascaris lumbricoides. Nucleic Acids. Res. 15:7689-7707.[Abstract/Free Full Text]

    Ochman, H., A. S. Gerber, and D. L. Hartl. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120:621-623.[Abstract/Free Full Text]

    Penton, E. H., B. W. Sullender, and T. J. Crease. 2002. Pokey, a new DNA transposon in Daphnia (Cladocera: Crustacea). J. Mol. Evol. 55:664-673.[CrossRef][Web of Science][Medline]

    Perez-Gonzalez, C. E., and T. H. Eickbush. 2001. Dynamics of R1 and R2 elements in the rDNA locus of Drosophila simulans. Genetics 158:1557-1567.[Abstract/Free Full Text]

    2002. Rates of R1 and R2 retrotransposition and elimination from the rDNA locus of Drosophila melanogaster. Genetics 162:799-811.[Abstract/Free Full Text]

    Peterson, R. C., J. L. Doering, and D. D. Brown. 1980. Characterization of two Xenopus somatic 5S and one minor oocyte specific 5S DNA. Cell 20:131-141.[CrossRef][Web of Science][Medline]

    Sharma, R., A. Bagchi, A. Bhattacharya, and S. Bhattacharya. 2001. Characterization of a retrotransposon-like element from Entamoeba histolytica. Mol. Biochem. Parasitol. 116:45-53.[CrossRef][Web of Science][Medline]

    Swofford, D. L. 1999. PAUP 4.0. Laboratory of Molecular Systematics. Smithsonian Institution, Washington, D.C.

    Takahashi, H., and H. Fujiwara. 2002. Transplantation of target site specificity by swapping the endonuclease domains of two LINEs. EMBO J. 21:408-417.[CrossRef][Web of Science][Medline]

    Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25:4876-4882.[Abstract/Free Full Text]

    Volff, J. N., C. Korting, A. Froschauer, K. Sweeney, and M. Schartl. 2001. Non-LTR retrotransposons encoding a restriction-like endonuclease in vertebrates. J. Mol. Evol. 52:351-360.[CrossRef][Web of Science][Medline]

    Xiong, Y., and T. H. Eickbush. 1988. Functional expression of a sequence-specific endonuclease encoded by the retrotransposon R2Bm. Cell 55:235-246.[CrossRef][Web of Science][Medline]

    1993. Dong, a new non-long terminal repeat (non-LTR) retrotransposable element from Bombyx mori. Nucleic Acids Res. 21:1318.[Free Full Text]

    Yang, J., H. S. Malik, and T. H. Eickbush. 1999. Identification of the endonuclease domain encoded by R2 and other site-specific, non-long terminal repeat retrotransposable elements. Proc. Natl. Acad. Sci. USA 96:7847-7852.[Abstract/Free Full Text]

    Ye, J., Z. Yang, J. J. Hayes, and T. H. Eickbush. 2002. R2 retrotransposition on assembled nucleosomes depends upon the translational position of the target site. EMBO J. 21:6853-6964.[CrossRef][Web of Science][Medline]

    Zhu, Y., S. Zou, D. A. Wright, and D. F. Voytas. 1999. Tagging chromatin with retrotransposons: target specificity of the Saccharomyces Ty5 retrotransposon changes with the chromosomal localization of Sir3p and Sir4p. Genes Dev. 13:2738-2749.[Abstract/Free Full Text]

Accepted for publication April 1, 2003.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
M. Rho and H. Tang
MGEScan-non-LTR: computational identification and classification of autonomous non-LTR retrotransposons in eukaryotic genomes
Nucleic Acids Res., September 17, 2009; (2009) gkp752v1.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Ye and T. H. Eickbush
Chromatin Structure and Transcription of the R1- and R2-Inserted rRNA Genes of Drosophila melanogaster
Mol. Cell. Biol., December 1, 2006; 26(23): 8781 - 8790.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
K. K. Kojima, K.-i. Kuma, H. Toh, and H. Fujiwara
Identification of rDNA-Specific Non-LTR Retrotransposons in Cnidaria
Mol. Biol. Evol., October 1, 2006; 23(10): 1984 - 1993.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. T. Averbeck and T. H. Eickbush
Monitoring the Mode and Tempo of Concerted Evolution in the Drosophila melanogaster rDNA Locus
Genetics, December 1, 2005; 171(4): 1837 - 1846.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. M. Christensen and T. H. Eickbush
R2 Target-Primed Reverse Transcription: Ordered Cleavage and Polymerization Steps by Protein Subunits Asymmetrically Bound to the Target DNA
Mol. Cell. Biol., August 1, 2005; 25(15): 6617 - 6628.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
20/8/1260    most recent
msg141v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Burke, W. D.
Right arrow Articles by Eickbush, T. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burke, W. D.
Right arrow Articles by Eickbush, T. H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?