MBE Advance Access originally published online on April 25, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mol. Biol. Evol. 20(6):994-998. 2003
DOI: 10.1093/molbev/msg116
© 2003 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038
Lactate Dehydrogenase A as a Highly Abundant Eye Lens Protein in Platypus (Ornithorhynchus anatinus): Upsilon (
)-Crystallin


* Department of Biochemistry, University of Nijmegen, Nijmegen, The Netherlands
Leiden University Medical Center, Leiden, The Netherlands
School of Aquaculture, University of Tasmania, Hobart, Australia
| Abstract |
|---|
|
|
|---|
Vertebrate eye lenses mostly contain two abundant types of proteins, the
-crystallins and the ß/
-crystallins. In addition, certain housekeeping enzymes are highly expressed as crystallins in various taxa. We now observed an unusual approximately 41-kd protein that makes up 16% to 18% of the total protein in the platypus eye lens. Its cDNA sequence was determined, which identified the protein as muscle-type lactate dehydrogenase A (LDH-A). It is the first observation of LDH-A as a crystallin, and we designate it upsilon (
)-crystallin. Interestingly, the related heart-type LDH-B occurs as an abundant lens protein, known as
-crystallin, in many birds and crocodiles. Thus, two members of the ldh gene family have independently been recruited as crystallins in different higher vertebrate lineages, suggesting that they are particularly suited for this purpose in terms of gene regulatory or protein structural properties. To establish whether platypus LDH-A/
-crystallin has been under different selective constraints as compared with other vertebrate LDH-A sequences, we reconstructed the vertebrate ldh-a gene phylogeny. No conspicuous rate deviations or amino acid replacements were observed.
Key Words: platypus Ornithorhynchus anatinus
-crystallin taxon-specific crystallin lactate dehydrogenase gene sharing mammalian phylogeny
| Introduction |
|---|
|
|
|---|
The evolution of multicellular life forms, with specialized cell types and organs, brings the need for new functions and new building blocks. How has this problem to acquire new structures and functions been solved? The evolution of the eye provides a unique example in which housekeeping enzymes and stress proteins have been recruited for a role as structural proteins in lens and cornea, either by "gene sharing" (i.e., a gene acquiring a dual function) or after gene duplication (reviewed in Wistow 1995; Piatigorsky 1998).
The vertebrate eye lens contains large quantities of densely packed, water-soluble proteins. These proteins, aptly called crystallins, give the lens its refractive properties and long-term transparency. The
-crystallin and ß/
-crystallins are ubiquitous to the vertebrate eye lens and generally constitute the bulk of the lens protein. The
-crystallin belongs to the small heat-shock protein family, whereas the ß/
-crystallins essentially form a lens-specific family of proteins. In addition, some 10 types of taxon-specific crystallins are known to occur in various vertebrate lineages. These taxon-specific crystallins are related to or identical with common metabolic enzymes such as lactate dehydrogenase B,
-enolase, alcohol dehydrogenase, and aldose/aldehyde reductases. A single exception is iota (
)-crystallin, which is a cellular retinol-binding protein (CRBP I), occurring in the lenses of some diurnal gecko species (Röll, Amons, and de Jong 1996; Werten et al. 2000).
The evolution of the vertebrate eye lens must have been accompanied by profound changes in gene expression and protein composition. The ubiquitous
-crystallin and ß/
-crystallins may have dominated the primordial lens, and adaptations to different visual environments were achieved by modulating their expression and recruiting additional genes in certain lineages. Such gene recruitment probably began as "gene sharing," by which a housekeeping protein, mostly enzymes, acquired an additional function as an abundant lens protein (Piatigorsky and Wistow 1991). The dual function may cause an "adaptive conflict" in which changes beneficial for the lens function may be deleterious for the housekeeping function outside the lens (Wistow 1993). This conflict can be solved when gene duplication occurs, allowing one copy to retain the housekeeping function and the other copy to further specialize for the lens function. Whereas gene sharing implies that the acquisition of a dual function may be strictly associated with changes in the regulation of such a gene (Piatigorsky 1998), gene duplication overcomes this restriction.
Although several examples of gene sharing and subsequent gene duplications have been described (Wistow 1995; Piatigorsky 1998), additional cases may contribute to better understanding this evolutionary phenomenon. We therefore present here a novel eye lens crystallin,
-crystallin, found in platypus. Its sequence is similar to that of muscle-type lactate dehydrogenase A (LDH-A). Whereas LDH-B is expressed as a lens crystallin in many birds and crocodiles (Stapel et al. 1985; Wistow, Mulders, and de Jong 1987), this is the first example of recruitment of LDH-A as a structural protein to the eye lens. It also is the first LDH/crystallin outside the reptile/bird lineage.
| Materials and Methods |
|---|
|
|
|---|
Platypus (Ornithorhynchus anatinus) lenses were obtained from a male animal from the north of Tasmania. The platypus suffered from ulcerative mycosis, and was captured and euthanized with permission of the Tasmanian Parks and Wildlife Service. To preserve RNA, lenses were stored in RNAlater (Ambion).
SDS-PAGE and Protein Sequencing
Lens proteins were isolated with Trizol reagent (Life technologies), allowing simultaneous isolation of RNA (see below), and analyzed by SDS-PAGE. Gel pieces containing the protein of interest, with a mass of approximately 41 kd, were cut into small cubes and washed several times with water. The protein was digested in-gel with endoproteinase Lys-C (Boehringer) in 0.2 M Tris-HCl, pH 8.6, for 16 h at 37°C. The liquid covering the gel pieces was collected, and the gel pieces were gently shaken, first with 200 ml of water for 3 h at room temperature and subsequently with 200 ml 0.1% (v/v) trifluoroacetic acid and 20% (v/v) acetonitrile, also for 3 h at room temperature, to elute the peptides. The extracts obtained were pooled and concentrated by lyophilization. The lyophilizate was dissolved in a small volume of 0.1% (v/v) trifluoroacetic acid and loaded onto a narrow bore (
) Vydac C4 HPLC column. Chromatography was performed with a 1 h gradient from 0.1% (v/v) trifluoroacetic acid to 0.08% (v/v) trifluoroacetic acid and 80% (v/v) acetonitrile at 0.25 ml/min at room temperature. The peak fractions were collected and subjected to Edman degradation on a Hewlett Packard G1005A instrument, connected on-line with a Hewlett Packard Model 1100 HPLC. Only a few of the fractions contained peptides that could be analyzed. In one peak, the sequence SADTLWGIq was found. From another chromatographic run, two peaks were analyzed. One clearly contained a mixture of two peptides. Its analysis was: NS; AL; DH; TP; DL; L; G; T; D; A; -; -; -. The second peak gave again SADTLwGIq; -; -; -. Subtracting the latter sequence from the former, being a mixture of two sequences, gave NLHPDLGTDA.
RT-PCR and Sequencing
RNA was isolated using Trizol reagent (Life Technologies) and was reverse transcribed with Superscript II reverse transcriptase (Invitrogen). PCR on cDNA and 3' RACE (SMART RACE Kit [Clontech]) was performed with degenerate primers based on the sequenced peptides and on alignments of LDH-A and LDH-B sequences available in the data bank (see next section): 30 forward: GTTGGIGCWGTTGGNATGGCYTG; 150 forward: ATTTTGACCTATGTGGCYTGGAARAT; 280 forward: ATGGTGAAGGGCATGTATGG; 320 forward: AAGAGTGCAGAYACCYTGTGG; 3UTR reverse: AGTGCGACATACCCAATCC (numbering reflects approximate primer position in the alignment). After initial sequencing, gene-specific primers were designed to be used in 5' RACE (SMART RACE Kit [Clontech]): 5race1: CAGCTTGTGGAGTGGATGCC; 5race2: AATCCAGATTGCAGCCGCTTCC; 5race3: TCATCAGCCAAATCCTTCATC. PCR products were sequenced directly on an ABI 3700 automated sequencer. The sequence was submitted to GenBank with the accession number AF545182.
Gene Tree Construction
The newly obtained platypus LDH-A sequence was aligned with LDH sequences of mammals and reptiles from GenBank, using ClustalW. Accession numbers of sequences used in the alignment and for phylogenetic reconstruction can mostly be found in Mannen and Li (1999). The other accession numbers are AF070996 and AF070997 (Grey opossum [Monodelphis domestica] LDH-A and LDH-B, respectively) and AF069771 (chicken [Gallus gallus] LDH-B). For LDH-A sequences we performed maximum-parsimony (MP), Neighbor-Joining with Kimura two-parameter distances (NJ-K2P), and maximum-likelihood (ML) analyses on data sets of first and second codon positions with transversions only on third positions. Third codon position were used as transversions only, because some taxa had a high GC contents at third positions (e.g., platypus), thus violating assumptions of equal rates across lineages. MP analysis was performed with 100 branch-swapping replicates, random input order of sequences and 1,000 bootstrap replicates. NJ analysis was performed with K2P distance, as described in a recent study on the molecular evolution of the ldh gene family in vertebrates by Li and Tsoi (2002). In ML analysis, we used the HKY85 model of sequence evolution with gamma distribution and invariable sites (HKY+G+I). These analyses were performed using PAUP* 4.0 (Swofford 2002), applying the tree bisection reconnection (TBR) branch-swapping option.
| Results and Discussion |
|---|
|
|
|---|
SDS gel electrophoresis of platypus lens extract revealed a conspicuous band in addition to the expected
-crystallin, ß-crystallin, and
-crystallin (fig. 1). The protein made up 16% to 18% of the total lens protein and had an apparent molecular mass of approximately 41 kd. To identify the protein, we performed Edman degradation on peptides isolated after digestion with endoproteinase Lys-C. The sequences of two peptides could be determined (SADTLWGI and NLHPDLGTDA [boxed in fig. 2]). A database search with these two sequences suggested that they originated from muscle-type LDH-A but could not completely exclude the possibility that it concerned heart-type LDH-B/epsilon (
)-crystallin, as reported earlier in birds and crocodiles (Wistow, Mulders, and de Jong 1987). Degenerate PCR primers were therefore designed on basis of the sequenced peptides and of alignments of LDH-A and LDH-B. RT-PCR on platypus lens total RNA and subsequent sequencing yielded a complete coding sequence and 3' UTR. The derived amino acid sequence (fig. 2) clearly identified it as LDH-A, rather than LDH-B. In fact, neither the Edman degradation nor the cDNA sequencing provided any evidence for the additional presence of LDH-B or any other LDH in the platypus lens. To distinguish this novel platypus lens protein from the archosaurian
-crystallin, we designate it as upsilon (
)-crystallin. The deduced amino acid sequence of
-crystallin comprises 332 residues. It has a predicted molecular mass of 36.5 kd and a pI of 7.65.
|
|
Lens proteins require structural stability and the ability for close packaging. If platypus LDH-A/
-crystallin had been under different selective constraints as compared with other vertebrate LDH-A sequences, this might be reflected by the presence of radical amino acid replacements. Nine substitutions are unique to platypus
-crystallin, as compared with the other LDH-A sequences in figure 2 (indicated by asterisks), but all these replacements are conservative in nature. A dual function, as an enzyme and as a lens protein, might also result in an accelerated rate of evolutionary change to adapt it to the additional function, as was found for CRBP-I/
-crystallin (Werten et al. 2000). We therefore reconstructed the phylogeny of amniote LDH-A. From figure 3, it appears that platypus LDH-A might have evolved somewhat slower rather than faster at the protein level than LDH-A in other mammals, suggesting that the protein is under increased selective constraints.
|
The related LDH-B/
-crystallin is present at levels of up to 23% in lenses of many birds and crocodiles (Stapel et al. 1985; Wistow, Mulders, and de Jong 1987). Duck lens LDH-B/
-crystallin is enzymatically active (Wistow, Mulders, and de Jong 1987) and is indeed the highly expressed product of the normal ldh-b gene (Hendriks et al. 1988). Also in the gecko genus Phelsuma, a 37-kd lens protein, present at low levels (<2%), reacts with the
-crystallin antiserum and is associated with increased LDH activity (Röll and de Jong 1996). LDH-A, as we now found it in the platypus eye lens, is not present in echidna or other mammals (Stapel et al. 1985). This means that the recruitment of the ldh-a gene for expression as a lens crystallin has occurred in the platypus lineage after it diverged from the echidna lineage, estimated at around 34 MYA (Janke et al., 2002). Thus, while LDH-B is widely distributed as a lens protein in various avian and crocodilian lineages, probably having appeared and vanished repeatedly, LDH-A is as yet only found in the platypus lens.
The finding that the two paralogous ldh-a and ldh-b genes have been recruited in the eye lens in different amniote lineages raises the question of whether these genes or their products have properties that make them especially attractive for such a dual function. Recruitment of housekeeping genes in the eye lens may be a neutral process, in which the products of these genes can be used as structural proteins as long as requirements for transparency and stability are met. Some taxon-specific crystallins may also confer an evolutionary advantage to the eye lens in terms of adaptation to ecological requirements. The ability of several enzyme-crystallins to bind pyrimidine nucleotide cofactors may be adaptive because of their UV-absorbing capacity (Zigler and Rao 1991; Wistow 1995). Repeated, independent recruitment of crystallins from the same gene family, as here for the ldh genes, suggests that only certain gene families are suitable for this purpose. Repeated recruitement has also been observed for the zeta (
)-crystallins from the quinone oxidoreductase family in the eye lenses of guinea pig, camel, and Japanese tree frog (Gonzalez et al. 1995; Fujii et al. 2001) and for
A/
B-crystallins from the aldo-keto reductase superfamily, which were independently recruited in frogs (Rana) and geckos (Phelsuma) (van Boekel et al. 2001). Another example of different isoforms being recruited as lens crystallins are the
-crystallins in birds and reptiles. Whereas the chicken lens expresses mainly
1-crystallins and little
2-crystallins, which are enzymatically inactive and active isoforms of the enzyme argininosuccinate lyase (ASL), respectively, the ratio
1-rystallin to
2-crystallin is more equal in the duck lens (Li, Wistow, and Piatigorsky 1995).
-Crystallin/ASL is a convincing example of initial gene sharing in an ancient reptilian ancestor, with subsequent duplication of the asl gene allowing one copy (
1) to adapt to the requirements as a lens protein, loosing its enzyme function, while the other copy (
2) retained the enzymatic role (Wistow 1995; Piatigorsky 1998).
In the case of platypus LDH-A/
-crystallin, we were unfortunately unable to obtain any data about enzymatic activity, expression in other tissues, or possible gene duplication because of lack of good quality material. However, considering the sequence similarities and position in the LDH-A tree (figs. 2 and 3), it is reasonable to assume that platypus LDH-A/
-crystallin respresents a case of gene sharing, just as has been demonstrated for LDH-B/
-crystallin. The recruitment of LDH-A and LDH-B must have involved changes in their gene expression. Small changes in the promoter region can indeed have major effects on the expression level of genes. For example, adaptive variation in ldh-b gene expression between populations of the fish species Fundulus heteroclitus could be explained by a single mutation (Schulte et al. 2000). Also, the high expression of
-crystallin in the duck lens did not require the evolution of a lens-specific promoter element (Brunekreef et al. 1996). In fact, the numerous studies on crystallin gene regulation demonstrate that their high expression in the lens is mainly the result of tissue-specific transcriptional activation, resulting from the complex interplay between lens-preferred factors, such as Pax-6, and general transcription factors (reviewed in Wistow 1995; Piatigorsky 1998).
It remains an open question whether high LDH levels in the lens are evolutionary neutral or adaptive and why the ldh genes are particularly suited for lens recruitment. From our data, we conclude that no major adaptive amino acid replacements are required to make LDH-A suitable for its dual function as a housekeeping enzyme and as a highly expressed lens protein. Also, duck LDH-B/
-crystallin was actually found to be relatively unstable and to have a decreased affinity for its substrate, pyruvate (Berr et al. 2000). In any case, the ldh gene family has provided a versatile source of evolutionary variation. Duplication of the ldh-a gene led to the testis-specific LDH-C in mammals (Li and Tsoi 2002). LDH-B is expressed at levels of up to 5% in mouse oocytes (Whitt 1984) and is present as
-crystallin in the eye lenses of many archosaurs, whereas LDH-A functions as
-crystallin in the platypus lens.
| Acknowledgements |
|---|
|
|
|---|
We thank Sandor Boros for technical advice. This work was supported by a grant from the Netherlands Organization for Scientific Research (NWO-ALW).
| Footnotes |
|---|
E-mail: w.dejong{at}ncmls.kun.nl.
| Literature Cited |
|---|
|
|
|---|
Berr, K., D. Wassenberg, H. Lilie, J. Behlke, and R. Jaenicke. 2000.
-Crystallin from duck eye lens: comparison of its quaternary structure and stability with other lactate dehydrogenases and complex formation with
-crystallin. Eur. J. Biochem. 267:5413-5420.[Web of Science][Medline]
Brunekreef, G.A., H. J. Kraft, J. G. Schoenmakers, and N. H. Lubsen. 1996. The mechanism of recruitment of the lactate dehydrogenase-B/
-crystallin gene by the duck lens. J. Mol. Biol. 262:629-639.[CrossRef][Web of Science][Medline]
Chiou, S. H., H. J. Lee, S. M. Huang, and G. G. Chang. 1991. Kinetic comparison of caiman epsilon-crystallin and authentic lactate dehydrogenases of vertebrates. J. Protein Chem. 10:161-166.[CrossRef][Web of Science][Medline]
Fujii Y., H. Kimoto, K. Ishikawa, K. Watanabe, Y. Yokota, N. Nakai, and A. Taketo. 2001. Taxon-specific zeta-crystallin in Japanese tree frog (Hyla japonica) lens. J. Biol. Chem. 276:28134-28139.
Gonzalez, P., P. V. Rao, S. B. Nunez, and J. S. Zigler, Jr. 1995. Evidence for independent recruitment of zeta-crystallin/quinone reductase (CRYZ) as a crystallin in camelids and hystricomorph rodents. Mol. Biol. Evol. 12:773-781.[Abstract]
Hendriks, W., J. W. Mulders, M. A. Bibby, C. Slingsby, H. Bloemendal, and W. W. de Jong. 1988. Duck lens
-crystallin and lactate dehydrogenase B4 are identical: a single-copy gene product with two distinct functions. Proc. Natl. Acad. Sci. USA 85:7114-7118.
Janke, A., O. Magnell, G. Wieczorek, M. Westerman, and U. Arnason. 2002. Phylogenetic analysis of 18S rRNA and the mitochondrial genomes of the wombat, Vombatus ursinus, and the spiny anteater, Tachyglossus aculeatus: increased support for the Marsupionta hypothesis. J. Mol. Evol. 54:71-80.[CrossRef][Web of Science][Medline]
Li, Y. J., and S. C. Tsoi. 2002. Phylogenetic analysis of vertebrate lactate dehydrogenase (LDH) multigene families. J. Mol. Evol. 54:614-624.[CrossRef][Web of Science][Medline]
Li, X., G. J. Wistow, and J. Piatigorsky. 1995. Linkage and expression of the argininosuccinate lyase/
-crystallin genes of the duck: insertion of a CR1 element in the intragenic spacer. Biochim. Biophys. Acta 1261:25-34.[Medline]
Mannen, H., and S. S. Li. 1999. Molecular evidence for a clade of turtles. Mol. Phylogenet. Evol. 13:144-148.[CrossRef][Web of Science][Medline]
Piatigorsky, J. 1998. Gene sharing in lens and cornea: facts and implications. Prog. Retin. Eye Res. 17:145-174.[CrossRef][Web of Science][Medline]
Piatigorsky, J., and G. Wistow. 1991. The recruitment of crystallins: new functions precede gene duplication. Science 252:1078-1079.
Röll, B., R. Amons, and W. W. de Jong. 1996. Vitamin A2 bound to cellular retinol-binding protein as ultraviolet filter in the eye lens of the gecko Lygodactylus picturatus. J. Biol. Chem. 271:10437-10440.
Röll, B., and W. W. de Jong. 1996. First finding of
-crystallin outside the archosaurian lineage. Naturwissenschaften 83:177-178.[Web of Science][Medline]
Schulte, P. M., H. C. Glemet, A. A. Fiebig, and D. A. Powers. 2000. Adaptive variation in lactate dehydrogenase-B gene expression: role of a stress-responsive regulatory element. Proc. Natl. Acad. Sci. USA 97:6597-6602.
Stapel, S. O., A. Zweers, H. J. Dodemont, J. H. Kan, and W. W. de Jong. 1985.
-Crystallin, a novel avian and reptilian eye lens protein. Eur. J. Biochem. 147:129-136.[Web of Science][Medline]
Swofford, D.L. 2002. PAUP*: Phylogenetic analyses using parsimony (* and other methods). Version 4. Sinauer Associates, Sunderland, Masschusetts.
van Boekel, M. A., D. M. van Aalten, G. J. Caspers, B. Röll, and W. W. de Jong. 2001. Evolution of the aldose reductase-related gecko eye lens protein rhoB-crystallin: a sheep in wolf's clothing. J. Mol. Evol. 52:239-248.[Web of Science][Medline]
Werten, P. J., B. Röll, D. M. van Aalten, and W. W. de Jong. 2000. Gecko iota-crystallin: how cellular retinol-binding protein became an eye lens ultraviolet filter. Proc. Natl. Acad. Sci. USA 97:3282-3287.
Whitt, G. S. 1984. Genetic, developmental and evolutionary aspects of the lactate dehydrogenase isozyme system. Cell. Biochem. Funct. 2:134-139.[CrossRef][Web of Science][Medline]
Wistow, G. 1993. Lens crystallins: gene recruitment and evolutionary dynamism. Trends Biochem. Sci. 18:301-306.[CrossRef][Web of Science][Medline]
Wistow, G. 1995. Molecular biology and evolution of crystallins: gene recruitment and multifunctional proteins in the eye lens. R. G. Landes Company, Austin, Texas.
Wistow, G. J., J. W. Mulders, and W. W. de Jong. 1987. The enzyme lactate dehydrogenase as a structural protein in avian and crocodilian lenses. Nature 326:622-624.[CrossRef][Medline]
Zigler Jr, J. S., and P. V. Rao. 1991. Enzyme/crystallins and extremely high pyridine nucleotide levels in the eye lens. FASEB J. 5:223-225.[Abstract]
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


