MBE Advance Access originally published online on April 2, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mol. Biol. Evol. 20(5):842-854. 2003
DOI: 10.1093/molbev/msg089
© 2003 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038
MADS-Box Genes in Ginkgo biloba and the Evolution of the AGAMOUS Family

,
* Service de Biosystématique, Université P et M Curie, Paris, France
Équipe Développement et Évolution, UMR 7622 "Biologie du Développement" CNRS and Université P et M Curie, Paris, France
| Abstract |
|---|
|
|
|---|
MADS-box proteins are a large family of transcription factors. In plants, many genes belonging to this family are involved in the homeosis of the floral system. Up to now, they have mainly been studied in angiosperms, especially in the model species Arabidopsis thaliana and Antirrhinum majus. We undertook a study of MADS-box genes in Ginkgo biloba, the unique extant representative of a whole branch of the phylogenetic tree of the seed plants. A polymerase chain reaction (PCR) survey reveals the diversity of MADS-box genes present in the genome of the Ginkgo. Duplications probably occurred specifically in the ginkgophyte lineage. Phylogenetic analyses revealed that one of these genes, GBM5, is an orthologue of the AGAMOUS gene of A. thaliana. We cloned and sequenced the entire cDNA of the GBM5 gene and studied its intron/exon structure. We showed by reverse transcriptase-PCR that it is expressed in both floral and vegetative tissues. We discuss the molecular evolution of the AGAMOUS family of genes.
Key Words: developmental genes floral organs gene expression gymnosperms phylogeny
| Introduction |
|---|
|
|
|---|
Ginkgo biloba is a unique relict species belonging to a plant lineage known as Ginkgophyta. It was probably saved from extinction by Chinese Buddhist monks who cultivated it in their temples from around the 12th century, long before G. biloba became a widely appreciated garden and suburban tree in temperate regions all over the world. Both vegetative (e.g., wood or secondary xylem generated by a cambium) and reproductive characters (e.g., miniaturized dispersed gametophyte or pollen, modified female sporangium or ovule, containing the female gametophyte and becoming an embryo-containing seed) unambiguously allocate Ginkgo to the Spermatophyta. The phylogenetic position of Gingko among the Spermatophyta has long been debated. More classically proposed to be the sister group of pinophytes (Doyle and Donoghue 1986; Hasebe et al. 1992), it could turn out to be the sister group of the cycadophytes (Goremykin et al. 1996; Chaw et al. 1997) or of a clade composed of both coniferophytes and gnetophytes (Kuzoff and Gasser 2000; Bowe, Coat, and dePamphilis 2000; Chaw et al. 2000).
Among living Spermatophyta, Ginkgo biloba is remarkable in that it has retained a number of plesiomorphic reproductive features, explaining why the species received its classical (and inadequate) qualifier of "living fossil" (Darwin 1859). This includes the production by the male gametophyte (after pollination) of a pair of multiflagellated spermatozoids swimming to the female gamete or oosphere, while conifers, gnetophytes, and angiosperms have lost any motile male gamete. Fertilization may even occur after the ovule has fallen down from mother tree. Furthermore, reserves accumulate in the ovule before fertilization has taken place, which is another primitive reproductive character displayed by Ginkgo. Only cycads, among living spermatophytes, also share such primitive attributes. For that reason, Ginkgo appears as a key taxon for our understanding of the evolution of reproductive characters among vascular plants, and in particular for a comprehension of flower evolution among Spermatophytes.
In the past decade, researches dealing with the evolution of floral architecture have focused on the angiosperms, and radically new insights came from the study of developmental genes in model species Arabidopsis thaliana and Antirrhinum majus. Especially well known are a number of MADS-boxcontaining genes controlling the specification of floral organs during development in angiosperms. According to the now famous ABC model (Coen and Meyerowitz 1991; Weigel and Meyerowitz 1994; Vergara-Silva, Martinez-Castilla, and Alvarez-Buylla 2000), organ identity within each floral whorl is determined by a particular combination of gene expression: expression of group A genes alone specifies the sepals; expression of group A and B genes together specifies the petals; B and C together, the stamens; and C alone, the carpels. More recently, the model was extended with D function genes that specify the identity of the ovules that develop within carpels (Colombo et al. 1995; Angenent and Colombo 1996; Theissen et al. 2000). Even more complex models, i.e., the ABCDE and quartet models (Theissen 2001), have been proposed to take into account other functions involved in the specification of petals, stamens, and carpels, in interaction with canonical A, B, and C genes.
Interest in the molecular evolution of the multigenic family of MADS-boxcontaining genes has first taken advantage of the availability of genomic sequences from A. thaliana (Alvarez-Buylla et al. 2000a, 2000b). In addition, several laboratories have characterized MADS-box genes in other plants than the dicotyledon genetic models Arabidopsis thaliana and Antirrhinum majus: monocotyledons (Zea mays, Oryza sativa), gnetophytes (Gnetum gnemon, Gnetum parvifolium), conifers (Picea abies, Picea mariana, Pinus radiata, Pinus resinosa) and ferns (Ceratopteris richardii, C. pteroides, Ophioglossum pedunculosum) (Tandre et al. 1995; Münster et al. 1997; Rutledge et al. 1998; Shindo et al. 1999; Sundström et al. 1999; Winter et al. 1999; Theissen et al. 2000). In particular, orthologues of MADS-box genes belonging to the B- and C-functional groups, which are involved in the specification of the reproductive parts of the flower in angiosperms, have been found in conifers and gnetophytes. But, up until now, data are lacking about MADS-box genes in certain critical taxa such as cycads and Ginkgo.
Data from these key spermatophyte taxa are needed to improve our knowledge of MADS-box gene evolution, in particular if one wants to infer the MADS-box gene content of the last common ancestor of Spermatophyta. Extensive searching for the MADS-boxcontaining sequence is also desirable to prepare future studies of their expression and regulative properties, which should provide insights about mechanisms of floral evolution through a comparative approach.
We present here the result of a polymerase chain reaction (PCR) survey of MADS-boxcontaining sequences from the genome of G. biloba, from which 33 distinct partial sequences could be retrieved. We have determined the complete coding sequence of GBM5, the Ginkgo orthologue of AGAMOUS from A. thaliana. We studied its expression by reverse transcriptase (RT)-PCR, reporting the first expression data of a MADS-boxcontaining gene from G. biloba. The results are interpreted by comparison with data previously published for ferns, gnetophytes, conifers, and angiosperms.
| Materials and Methods |
|---|
|
|
|---|
Specimen Collection and Nucleic Acid Extraction
Samples used in this study were collected during winter and spring from reproductively mature G. biloba male and female trees in the Jardin des Plantes (Muséum National d'Histoire Naturelle, Paris, France). For genomic DNA extraction, G. biloba leaves were ground to a powder in liquid nitrogen according to the method of Rogers and Bendich (1985). Genomic DNA was then extracted according to the procedure of Doyle and Doyle (1987). For total RNA extraction, samples were ground to powder in liquid nitrogen and the "RNeasy Plant Mini Kit" (Qiagen) was used according to the manufacturer's instructions.
PCR Amplification, Cloning, and Sequencing
Five sets of degenerate oligonucleotide primers were designed for the MADS-box first round of amplification, on the basis of an amino-acid alignment including several MADS-box genes from the angiosperm A. thaliana, the conifer Picea abies, and the fern C. richardii (table 1). To improve specificity, we performed two rounds of PCR amplification. All possible combinations of primers were tested, of which nine succeeded in amplifying fragments of the expected size, between 117 and 132 bp according to primer set. All reactions were performed in a final volume of 20 µl. For the first PCR amplification, 1 µl of genomic DNA was used as a template. Reamplification of PCR product amplified was done using 1 µl of a 1/100 dilution of the first PCR as a template. Three tubes were prepared and pooled before cloning. The PCR amplifications were performed in a DNA thermal cycler (Biometra) in the presence of primers at 1 µM each, dNTP at 200 µM final, 1X Hitaq buffer, and 0.5 units of Hitaq DNA polymerase (Bioprobe). Samples were amplified for 30 cycles under the following regime: denaturation at 94°C for 30 s, primer annealing for 30 s (first amplification at 45°C, reamplification at 50°C), and extension for 45 s at 72°C.
|
Polymerase chain reaction products were purified using the Jetsorb kit (Genomed) and cloned into a pKS Blue-script (Stratagen) T-hang modified according to the procedure of Holton and Graham (1990). Sequencing reactions were performed with the "Thermosequenase fluorescent-labeled primer cycle sequencing kit with 7-deaza-dGTP" (Amersham, Pharmacia) using a fluorescent primer labeled with CY5. Reaction products were analyzed using an automatic sequencer (Alf Express, Pharmacia). The amplified segments were from 75 to 90 bp in length between primers, depending on the PCR primer set used.
Determination of the Complete Coding Sequence of GBM5
cDNA was prepared from total RNA extracts from stamens and ovules (5 to 10 µg of total RNA). Reverse transcription was performed using MMLV-RT (RT-PCR kit, Stratagen). Specific (nondegenerate) primers (table 1; see also fig. 4) were designed from the partial sequence of GBM5 MADS-box and used for 3' and 5'RACE-PCR (Frohman, Dush, and Martin 1988). An oligo-dT was used as a reverse primer in 3'RACE and 5'RACE-PCR experiments. The PCR conditions were the same as above, but annealing was performed at 60°C and extension lasted 2 min. Two rounds of PCR amplification were necessary, for both 3' and 5'RACE, leading to PCR products which were then gel-purified, quantified, cloned, and sequenced as described above.
|
Determination of GBM5 Intron Positions and Sizes
We specifically looked for the presence in GBM5 of the six introns (introns 2 to 7, after Brunner et al. 2000) present in the corresponding sequence of the AGAMOUS gene of A. thaliana (Yanofsky et al. 1990). Nondegenerate primer sets (5.2/5B, I1d/I2r, I3d/I3r, I4d/I4r; I5d/I5r) were designed from the coding sequence, each primer set bracketing a putative intron site as reported by Tandre et al. 1998 in DAL2 and AGAMOUS (table 1; see also fig. 4). These primer sets were used for PCR amplification with genomic DNA as a template. PCR conditions were as described above, but annealing temperature was 60°C and extension time was 3 min. The PCR products were gel-purified, quantified, cloned, and sequenced according to the procedures described above.
Study of GBM5 Expression by RT-PCR
RNAs were prepared from freshly dissected tissues. Nucelli were dissected from young buds. For the endosperm samples, mature seeds were collected in September, then the envelopes were removed by dissection. cDNA was prepared using an oligo-dT as a primer, according to the procedure used for obtaining the complete sequence of the GBM5 gene. The primer set used for RT-PCR amplification was E1d/E2r, amplifying a 447 bp transcript (see fig. 4). This fragment contains a part of the K domain and the entire COOH domain of the GBM5 gene. This is an evolutionary variable region, thus limiting the chance of amplifying paralogues of GBM5. The genomic region corresponding to the RT-PCR amplified portion contains introns 4, 5, 6, and 7, allowing detection of contaminant genomic DNA if present. 25S rRNA was used as a positive control. A primer set (C18: 5'AGTGTGTAACAACTCACCTGCCGAA3'; D18: 5'CAGAAAAGATAACTCTTCCCGAGGC3') amplifying approximately 350 bp of the 25S rRNA gene was used to quantify 25S rRNA expression in all cDNA samples, leading to similar amounts of PCR products (not shown). RT-PCR products were transferred to a nylon membrane (Hybond NX, Amersham) after migration on a 1% agarose gel. The membrane was then hybridized with a 261bp PCR fragment of the GBM5 gene, amplified with the primer set I3d/I5r, internal to E1d/E2r (see fig. 4). The probe was labeled with 32P using the "Prime-a-gene" kit from Promega. Hybridization temperature (65°C) and buffer stringency were adjusted to obtain optimal hybridization of the probe according to the methods of Church and Gilbert (1984). The membrane was washed four times at 65°C during 30 min with wash buffer as described by Church and Gilbert (1984).
Phylogenetic Analysis
For the phylogenetic analyses, the data sets were completed after a search in the GenBank database (Protein queryTranslated database) using the Blast program at NCBI (http://www.ncbi.nlm.nih.gov/blast). Translation of nucleotide sequence to protein and alignments were done using the MUST package (Philippe 1993) and Se-Al v1.0a1 (http://evolve.zoo.ox.ac.uk/). Alignments were unambiguous over the length of the MADS domain but show a few ambiguities in the remaining regions. Phylogenetic trees were constructed using the Maximum Parsimony (MP) and Neighbor-Joining methods in PAUP 4.ob3 (Swofford 1999). For DNA analyses, the MP analysis was conducted either with equal weighting or with differential weighting of the character-state transformations using the product CI x S (CI = consistency index; S = slope of the saturation curve) (Hassanin, Lecointre, and Tillier 1998; Hassanin, Pasquet, and Vigne 1998). The CI and S values were calculated on the six substitution-types (AG, CT, AC, AT, CG, and GT), distinguishing the three codon positions to take into account the selective constraints. The robustness of the nodes was assessed by bootstrap proportions (BP) (Felsenstein 1985) computed after 1,000 and 100 replicates for NJ and MP analyses, respectively.
| Results |
|---|
|
|
|---|
PCR Survey of MADS-Box Genes in Ginkgo biloba
From an analysis of type II MADS-boxes, we designed several degenerate primers for PCR amplification (table 1). Seven of the nine primer sets used permitted us to recover a total of 33 distinct sequences from Ginkgo biloba genomic DNA (accession numbers on fig. 1) that showed significant similarity with sequences of MADS-box genes. Among these sequences, six contained a stop codon and were qualified as pseudogenes (GBM28
to 33
). For all six, the presence of the stop codon was confirmed by sequencing on both strands at least three identical clones. We postulate that the 27 remaining sequences (GBM1 to 27) belong to coding sequences, although we cannot exclude that they also belong to pseudogenes, because of the shortness of the fragment amplified.
|
Each of the 43 sequences from Arabidopsis thaliana that were included in the MADS-box genes data set used by Alvarez-Buylla et al. (2000b) was used to perform Blast searches over the complete A. thaliana genome. This permitted us to retrieve as many as 36 new putative MADS-box genes. The 33 sequences isolated from G. biloba were then translated and aligned together with the A. thaliana sequences. The amino acid sequence alignment contained from 22 to 30 positions depending on the sequences. A distance Neighbor-Joining tree computed from the alignment is shown in figure 1. The tree was rooted on "type I" MADS-box genes according to results obtained by Alvarez-Buylla et al. (2000b), who suggested the monophyly of "type II" genes.
Despite the shortness of the sequences analyzed, several well-supported clades (BP
70%) were found, containing only genes from A. thaliana (AGL8 and AP1), (AGL14, AGL19 and AGL20), (AGL25, AGL27, AGL31, and AB026633), (AGL17 and AGL21) and (AGL22 and AGL24) (fig. 1).
All 33 MADS-domains from G. biloba isolated in this study belong to type II. This was expected from the choice of the primers used for PCR amplification. The overall degree of resolution of the tree is very low, which is not surprising given the shortness and conservation of the sequences. Yet, it can suggest some relationships: The GBM5 gene of G. biloba is associated with AG, AGL1, AGL5 (65% BP). According to this analysis, GBM5 belongs to the AGAMOUS (AG) family of MADS-box genes, which includes AG, AGL1, AGL5, as well as AGL11 (Purugganan et al. 1995; Theissen, Kim, and Saedler 1996; Theissen et al. 2000).
Another grouping of particular G. biloba genes with A. thaliana genes is worth noting, although not statistically supported: GBM4 and GBM3 may belong to a clade comprising the AGL6 and AGL2 genes. AGL2-, AGL6- and SQUA-like genes form a super-clade, called the AP1/AGL9 group (Purugganan et al. 1995; Theissen et al. 2000). Additional sequencing of the GBM4 and GBM3 genes is needed to identify their possible orthology to members of this super-clade.
In contrast, several well-supported clades contain genes from G. biloba only: GBM7 and 23 (82% BP); GBM14, 15, 25, and 27 and pseudogenes (90% BP); GBM9 and 17 (70% BP); GBM2 and 10 (81% BP); and GBM12 and 18 (95% BP).
We further performed an analysis including, in addition to genes from G. biloba and A. thaliana, all available MADS-domain sequences from Tracheophyta. All previously well-supported clades are retrieved in this second analysis (not shown). Within the AGAMOUS family, GBM5 is associated with GGM3 from Gnetum gnemon and four conifer genes belonging to four distinct speciesi.e., Picea abies (DAL2), Picea mariana (SAG1a), Pinus radiata (not named), and Pinus resinosa (MADS2). This is in accordance with Winter et al. (1999), who found GGM3 and DAL2 falling with very high support within the AGAMOUS family, from an analysis of full MADS, I, and K domains. Apart from GBM5, no other known gene of G. biloba appears to cluster with strong support with particular genes from A. thaliana, gymnosperms (s.l.), filicophytes, or bryophytes.
Determination of the Complete Coding Sequence of the GBM5 Gene
The complete GBM5 cDNA (see fig. 3 for the accession number) was obtained from 3' and 5' RACE-PCR amplifications performed on cDNA synthesized from stamens and from ovules. In both tissues we found amplification products of two distinct sizes (950 and 1,000 bp). However, the difference in size is due only to the 3' untranslated end of the cDNAs, which is either 300 or 350 bp long. This observation suggests the existence of at least two distinct sites of polyadenylation. Similarly, the presence of several polyadenylation sites has been recorded for SAG1, which is an AG orthologue from P. mariana (Rutledge et al. 1998).
|
Figure 2 shows an alignment of the complete amino acid sequence of GBM5 with representative genes of the AGAMOUS family from A. thaliana (AG, AGL1, AGL5, and AGL11), from gymnosperms and gnetophytes (DAL2 from Picea abies, SAG1 from Picea mariana, and GGM3 from Gnetum gnemon), as well as with representatives of other MADS-gene families from A. thaliana (AP3, PI, and AP1). This alignment reveals a high degree of sequence similarity among genes belonging to the AGAMOUS family, and a still higher similarity between GBM5 and AG family genes from gymnosperms. Another interesting observation is the absence in GBM5 of the NH2-terminal domain found in the AG gene from A. thaliana. This domain is also absent from all AGAMOUS family genes known in conifers and gnetophytes, and from MADS-box genes belonging to the A- and B-functional groups. In A. thaliana, this NH2-terminal extension is present in only two other type-II MADS-box genes (AGL1 and AGL5).
|
Phylogeny of the AGAMOUS Family of MADS-Box Genes
We performed an alignment of the MADS, I, and K domains of the genes forming the AGAMOUS family as defined by Theissen et al. (2000). We added to this data set a number of MADS-box genes sharing more than 85% identical residues with the MADS domain of the GBM5 protein that we retrieved from a Blast search on GenBank. The COOH domain was excluded because of numerous alignment ambiguities. The NH2-terminal extension, when present, was not taken into account. The ANR1, CAL, AGL3, and AGL14 genes were used as outgroups (Theissen et al. 2000). The amino acid alignment is available on request. Phylogenetic analyses by distance and maximum parsimony methods confirm that the AGAMOUS family forms a highly supported clade (100% BP) (fig. 3). In addition, they revealed a basal division within the family between a group of angiosperm genes and a group of gymnosperm genes. Each group of the genes is strongly supported. The group of angiosperm AGAMOUS genes includes the four genes from A. thaliana (AG, AGL1, AGL5, and AGL11) that gave the name to the family and related genes from many other angiosperms. The group of gymnosperm genes comprises GBM5 and orthologous genes found in Picea abies, Picea mariana, Pinus radiata, Pinus resinosa, and Gnetum gnemon. This result confirms the indications from the alignment (fig. 2) and from our previous analysis of short sequences (fig. 1). It provides conspicuous evidence that GBM5 is an orthologue of AG and other AG-like genes from angiosperms and gymnosperms.
The AG protein, as well as other angiosperm MADS-box proteins, is characterized by an additional domain in the NH2-terminal end, called the N domain (Mizukami et al. 1996). Within the AGAMOUS family, the N region may either be present (e.g., AG) or absent (e.g., AGL11). We plotted the presence/absence of this domain on the phylogenetic tree resulting from our analysis (fig. 3). No gymnosperm genes possess the N domain. Four groups of genes can be defined in angiosperms: (1) Group 1 includes genes from eudicotyledons that do not have the NH2-terminal domaini.e., AGL11, CAG1, MADS10, FBP7 and FBP11. This group is clearly monophyletic. (2) Group 2 includes all genes of eudicotyledons that possess the N-region. For instance, this group contains AG, AGL1, AGL5 of Arabidopsis, and PLE and FAR of Anthirrhinum. (3) Group 3 incorporates ZAG2 and ZMM1 of Zea mays and the OsMADS13 gene of Oryza sativa. All lack the NH2-terminal domain. We did not include the HAG1 gene from Hyacinthus, also lacking an N-domain, in this group for the reasons discussed below. (4) Group 4 includes ZAG1 and ZMM2 of Z. mays. These two genes form a highly supported clade of monocotyledon genes with the OsMADS3 gene of O. sativa. All genes belonging to group 4 possess an N domain.
Genomic Organization of the GBM5 Gene
Some authors have stated that the AG gene has a particular intron/exon structure (Tandre et al. 1998; Rutledge et al. 1998). To understand the evolution of genomic organization in the AGAMOUS family of genes, we sought to determine the intron positions of the GBM5 gene. The genomic structure of the AG gene of A. thaliana (Yanofsky et al. 1990) was used as a starting point for looking for introns in GBM5 by PCR using Ginkgo genomic DNA as a template. A summary of our results on the intron/exon pattern of the GBM5 gene is drawn in figure 4 (triangles) (GenBank accession numbers AY114305 to AY114309). We obtained no PCR product with the specific primers 5.2/5.B (table 1) that could provide evidence for the presence in GBM5 of an intron homologous to intron 2 of AG. In a parallel experiment the same primers yielded a product of the expected size from stamen cDNA. In AG homologous genes, intron 2 is 3- to 5-kblong (Brunner et al. 2000). It is likely that PCR failure on G. biloba genomic DNA is due to the presence of a long-sized intron. Leaving aside the NH2-terminal coding extension of the AG gene, not present in GBM5, all other introns were retrieved in GBM5 at the same position as in AG. Intron sizes are moderate, being generally higher in GBM5 than in AG, except intron 7. The same intron positions have now been shown in MADS-box genes not belonging to the AGAMOUS family (Sundström et al. 1999 and our unpublished results). This shows that intron-exon structure has been a very preserved feature during the evolution of MIKC genes. As in other known MADS-box genes, exons in the GBM5 gene do not exactly correspond to protein domains (Shore and Sharrocks 1995). For instance, the K domain spans three exons.
Expression of GBM5
GBM5 expression level was monitored by semiquantitative RT-PCR in young roots, young leaves from male and female trees, old leaves from short and long shoots, male and female bracts, stamens, ovules, and female gametophyte (fig. 5). No signal is detected in young roots, old leaves, and bracts. In contrast, GBM5 expression is detected in reproductive organs (stamens, ovules, and female gametophyte), and in young leaves (male and female).
|
| Discussion |
|---|
|
|
|---|
MADS-Gene Duplications and the Repertoire of MADS-Box Genes in Ginkgo
MADS-box genes are key regulators of plant development. They appear as a large multigenic family whose history is complex. The only exhaustive set of MADS-box genes known to date is from A. thaliana. We could retrieve 79 distinct genes from this genome. In gymnosperms, the largest data sets up until now are from Picea mariana, with 27 distinct partial gene sequences (Rutledge et al. 1998), and from Gnetum gnemon, with 19 sequences (Becker et al. 2000). A few sequences are also available from Picea abies (Tandre et al. 1995; 1998; Sundström et al. 1999), Pinus radiata (Mouradov et al. 1996, 1999; Mouradov, Glassick, and Teasdale 1997), P. resinosa (Liu and Podila 1997), and Gnetum parvifolium (Shindo et al. 1999). The present study does not claim to be an exhaustive survey of MADS-box genes in G. biloba. Nonetheless, we retrieved up to 33 different MADS-box sequences from the genomic DNA of Ginkgo biloba.
On the basis of the phylogenetic analysis, very few relations of orthology can be established with strong statistical support between genes from G. biloba and genes from A. thaliana (fig. 1). The GBM5 gene, being an orthologue of the agamous (AG) gene of A. thaliana, is the single clear case. When including sequences from other gymnosperm taxa, which are phylogenetically closer to G. biloba, the same observation can be made. The agamous clade is retrieved, containing five gymnosperm genes in addition to GBM5, AG, AGL1, AGL5, and AGL11, but no other Ginkgo MADS-box gene clusters with significant bootstrap support with particular gymnosperm genes. This can be attributed to insufficient phylogenetic information, because the analyzed Ginkgo sequences are very short as a result of intrinsic limitation of the PCR strategy. Nevertheless, despite the shortness of the sequences analyzed, several well-supported clades (BP
70%) are found, containing only genes from A. thaliana or only genes from G. biloba (fig. 1). As for the Arabidopsis genes, the same monophyletic groups were found with 100% BP support by Alvarez-Buylla et al. (2000a) in an analysis including the M, I, and K domains. This clearly validates our analysis, despite the paucity of sites. The fact that monophyletic groups are found containing exclusively genes of Arabidopsis or of Ginkgo supports the idea that independent duplications of MADS-box genes have arisen in these two lineages.
The Evolution of the AGAMOUS Family
All angiosperm species are characterized by the presence of at least two genes belonging to the AGAMOUS family: four genes in Arabidopsis, two genes in Anthirrhinum majus, four genes in Zea mays, and three genes in Oryza sativa. In contrast, we found a single gene belonging to the AGAMOUS family in the genome of Ginkgo biloba. Although we do not pretend that the repertoire of Ginkgo MADS-box genes we describe in the present work is exhaustive, we believe that missing another orthologue of AG is unlikely, given the primers used (table 1) and the number of clones studied (331 in total). In agreement with this view, it seems worth noting that a single AG orthologue has been found as yet in all other species of gymnosperms studied, i.e. Gnetum gnemon, Picea abies, Picea mariana, Pinus radiata, and Pinus resinosa (fig. 3). We thus postulate that the AGAMOUS family was restricted to a unique gene in the common ancestor of spermatophytes, a group of duplications occurred or was maintained in the angiosperm lineage only. Among angiosperms, the monocotyledon genes form a strongly supported monophyletic group (fig. 3). This brings evidence that independent duplication events in the AGAMOUS family of genes occurred in the eudicotyledon and monocotyledon lineages.
Because no gymnosperm AG-like genes possess an N-coding extension, and because among angiosperms some branches only of the phylogenetic tree comprise genes bearing an N-domain (fig. 3), it is more parsimonious to postulate that their common ancestral gene was devoid of an N-coding extension. MADS-box genes presenting an N-extension have been isolated from the fern Ceratopteris (Kofuji and Yamaguchi 1997; Hasebe et al. 1998), but they are not orthologous to the AGAMOUS clade of MADS-box genes from flowering plants (Theissen et al. 2000). Similarly, an N-extension is present in two conifer genes not belonging to the AGAMOUS clade, DAL3 and PrMADS7 (Tandre et al. 1995; Walden et al. 1998). Thus the simplest interpretation is that N-extensions found in ferns, angiosperms, and conifers were acquired independently.
Our phylogenetic analyses (fig. 3), which do not take the N-domain into account, showed that the monocotyledon AGAMOUS genes form a strongly supported monophyletic assemblage that is distinct from eudicotyledon Agamous-like genes. This clade comprises genes that possess an N-extension (group 4) and genes that do not (group 3 and HAG1). It was not possible to align the N-domains between the group 2 (dicotyledon) and group 4 (monocotyledon) genes. It is thus more parsimonious to assume that genetic events leading to an N-coding extension have occurred independently in the eudicotyledon and in the monocotyledon lineages (two gains versus one gain and two losses).
On the basis of phylogenetic analyses, because of lack of resolution, it was not possible to determine whether a single event had led to the N-extension in group-2 (eudicotyledon) genes (fig. 3). We thus sought to align the N-domain of the 28 group-2 genes (fig. 6A and B). The N-extension is variable in length and sequence. It comprises between 13 and 20 codons, except for three genes: the CAG2 gene of Cucumis sativus, which contains a microsatellite-like sequence, and is thus barely alignable; the GAGA1 gene of Gerbera hybrida, with a 30 codon-long extension; and the AG gene of Arabidopsis thaliana itself, with a huge extension (fig. 6B). For the latter two genes, the part of the N-extension that is closest to the MADS-box remains alignable (fig. 6A and B). The exon-intron structure is known for four group-2 genes. In three of them (PTAG1, PTAG2, and FAR), the N-extension remains limited to the second exon, leaving the first exon untranslated. Only in AG from Arabidopsis does it extend into the first exon (Yanofsky et al. 1990).
|
The alignment revealed an unexpected feature: the N-extension is itself composed of a variable region flanked on each side by two more conserved modules, one around the AUG-initiating codon and the second close to the MADS-box. Within the conserved modules, preservation is also observed at the nucleotide level (fig. 6A). We believe that this alignment (fig. 6A and B) reflects homology of the N-extension in at least 25 of the 28 genes belonging to group 2.
We propose the following scenario of molecular evolution. When known, the coding sequence of genes belonging to the AGAMOUS family appears to be preceded by a long 5' untranslated region (5' UTR) comprising an intronic sequence (Brunner et al. 2000). Creation of a new AUG initiating codon upstream of the AUG codon located just in front of the MADS-box may occur with some significant probability. For at least 25 genes belonging to group 2, the same single event has created a new AUG-initiating codon and the N-extension. The primitive AUG codon in front of the MADS-box has been preserved in three genes (P1, LAG, and CAG3) but could eventually have been lost during the course of evolution in the others. New in-frame AUG codons could then have been created inside (BAG1, MADS1/MADS6, P1, CAG3, GAGA1, GAGA2) or upstream of the N-domain, in the latter case creating a longer extension (AG, GAGA1). The CAG2 gene and the clade comprising AGL1, AGL5, and BAGL1 may have been generated by independent events. Alternatively, they might have profoundly derived after the initial mutation creating the N-extension.
According to the ABCDE model, the C function is specialized in specifying stamens and carpels (Theissen 2000). This function has been genetically determined in several species of angiosperms. It is provided by AGAMOUS in Arabidopsis thaliana (Bowman, Smyth, and Meyerowitz 1991), PLENA in Antirrhinum majus (Bradley et al. 1993), OsMADS3 in Oryza sativa (Kang et al. 1995). All these genes from both eudicotyledon and monocotyledon species possess an N-domain, although variable in size and sequence (fig. 3 and 6). On the basis of current knowledge, however, there is no correlation between the presence/absence of the N-domain and a specific pattern of expression. Moreover, on the basis of in vitro experiments using truncated AG proteins of various lengths, Mizukami et al. (1996) have shown that this domain is not necessary for DNA binding or for the formation of homodimers or heterodimers with AGL1, AGL2, or AGL3 proteins. In addition, genetic overexpression assays have shown that transgenic plants carrying constructs encoding AG proteins with or without the N-domain display similar phenotypes (Tandre et al. 1998). Nevertheless, these data do not rule out a more subtle in vivo effect of the N-domain. According to Riechmann and Meyerowitz (1997), the N-domain may have a role in modulating the DNA-binding activity of the AG protein, but not necessarily by affecting its DNA-binding specificity.
Duplications and the Evolution of Function in the AGAMOUS Family
A functional genetic analysis of the Ginkgo is obviously beyond available means of investigation. We must therefore try to derive the function of a gene from its expression pattern, although a strict correlation cannot be fixed. We have shown by RT-PCR that GBM5, the Ginkgo representative of the AGAMOUS family, is expressed in young male and female leaves as well as in reproductive organs (fig. 5). In another gymnosperm, Picea mariana, expression of its orthologue, SAG1, has been detected in vegetative buds and in mature needles (Rutledge et al. 1998). This expression is detectable by RT-PCR but not by northern-blot analysis, suggesting that the level of expression of SAG1 in these tissues is very weak. Expression of the AG orthologues and has not been detected in vegetative organs of either Picea abies (conifer; DAL2) or in Gnetum gnemon (gnetophyte; GGM3), but analyses were done by northern-blots only (Tandre et al. 1995; Winter et al. 1999). In angiosperms, expression in vegetative organs of genes belonging to the AGAMOUS family has been reported in the poplar tree Populus balsamifera (Brunner et al. 2000), and in the cotyledon and leaves of seedlings in the case of the GAG2, but not GAG1, genes of Panax ginseng (Kim et al. 1998). A weak expression, not yet detected, may still be present for some AGAMOUS-like genes of other plants. Several studies have shown that lack of expression of AG in developing leaves in A. thaliana is due to the downregulation of AG by other developmental genes. A mutation in the APETALA2 (AP2) gene leads to expression of AG in young leaves (Jofuku et al. 1994). AP2, not a MADS-box gene, functionally belongs to group A. AP2 expression in combination with AP1 specifies sepals in the developing flower. It has long been known that A- and C-group genes are antagonistic in the flower (Coen and Meyerowitz 1991). A comparable antagonism seems to be present in the leaf. Another gene, CURLY LEAF, regulates AG expression in leaves, inflorescences, and flowers (Goodrich et al. 1997).
Our RT-PCR experiment showed that GBM5 is expressed in early stages of developing male and female organs but persists in the female gametophyte. Similar expression patterns have been observed for orthologues of GBM5 in coniferophytes: DAL2 in Picea abies and SAG1 in Picea mariana. Indeed, DAL2 and SAG1 are expressed in the male and female cones, but a progressive decrease was observed during male cone maturation, whereas developing female cones maintained a high level of expression throughout the maturation of ovules (Tandreet al. 1995, 1998; Rutledge et al. 1998). Somewhat differently, the GGM3 gene of Gnetum gnemon is still expressed in both male and female reproductive units at late developmental stages (Winter et al. 1999). The temporal control of expression of AG orthologues observed in the Ginkgo and in conifers parallels the expression of genes belonging to the C and D functional groups in angiosperms. In A. thaliana, the typical group-C AGAMOUS gene is expressed in both stamens and ovules. AGL11 is an orthologue of the Petunia genes FBP7/FBP11 (fig. 3). Genetic experiments assign FBP7 and FBP11 to the D functional group. AGL11 is exclusively expressed in ovules, like the group D genes FBP7 and FBP11. On the basis of this expression pattern, we postulate, in agreement with Theissen (2001), that AGL11 presents the D function in the regulatory code of flower specification. The expression pattern of orthologues of AG in gymnosperms thus combines the patterns of both angiosperm C and D genes in developing reproductive organs. Such a split of a single complex expression pattern into two more specialized functions between the two sister genes after a duplication event is in agreement with the DDC (Duplication-Degeneration-Complementation) model of Force et al. (1999) for the functional evolution and maintenance of duplicated genes.
| Acknowledgements |
|---|
|
|
|---|
We thank Jean-Michel Gibert and Valery Malécot for help in collecting and dissecting Ginkgo samples and tissues. We are grateful to Prof. Georges Ducreux for careful reading of the manuscript and to Dr. Catherine Damerval for discussions.
| Footnotes |
|---|
E-mail: jean.deutsch{at}snv.jussieu.fr.
| Literature Cited |
|---|
|
|
|---|
Alvarez-Buylla, E. R., S. J. Liljegren, S. Pelaz, S. E. Gold, C. Burgeff, G. S. Ditta, F. Vergara-Silva, and M. F. Yanofsky. 2000a. MADS-box gene evolution beyond flowers: expression in pollen, endosperm, guard cells, roots and trichomes. Plant J. 24:457-466.[CrossRef][Web of Science][Medline]
Alvarez-Buylla, E.R., S. Pelaz, S. J. Liljegren, S. E. Gold, C. Burgeff, G. S. Ditta, L. Ribas de Pouplana, L. Martinez-Castilla, and M. F. Yanofsky. 2000b. An ancestral MADS-box gene duplication occurred before the divergence of plants and animals. Proc. Natl. Acad. Sci. USA 97:5328-5333.
Angenent, G. C., and L. Colombo. 1996. Molecular control of ovule development. Trends Plant Sci. 1:228-232.[CrossRef][Web of Science]
Becker, A., K. U. Winter, B. Meyer, H. Saedler, and G. Theissen. 2000. MADS-box gene diversity in seed plants 300 million years ago. Mol. Biol. Evol. 17:1425-1434.
Bowman, J. L., D. R. Smyth, and E. M. Meyerowitz. 1991. Genetic interactions between homeotic genes of Arabidopsis. Development 112:1-20.[Abstract]
Bowe, L. M., G. Coat, and C. W. dePamphilis. 2000. Phylogeny of seed plants based on all three genomic compartments: extant gymnosperms are monophyletic and gnetales closest relatives are conifers. Proc. Natl. Acad. Sci. USA 97:4092-4097.
Bradley, D., R. Carpenter, H. Sommer, N. Hartley, and E. Coen. 1993. Complementary floral homeotic phenotypes result from opposite orientations of a transposon at the plena-locus of Antirrhinum. Cell 72:85-95.[CrossRef][Web of Science][Medline]
Brunner, A. M., W. H. Rottmann, L. A. Sheppard, K. Krutovskii, S. P. Difazio, S. Leonardi, and S. H. Strauss. 2000. Structure and expression of duplicate AGAMOUS orthologues in poplar. Plant Mol. Biol. 44:619-634.[CrossRef][Web of Science][Medline]
Chaw, S. M., C. L. Parkinson, Y. Cheng, T. M. Vincent, and J. D. Palmer. 2000. Seed plant phylogeny inferred from all three plant genomes: monophyly of extant gymnosperms and origin of gnetales from conifers. Proc. Natl. Acad. Sci. USA 97:4086-4091.
Chaw, S. M., A. Zharkikh, H. M. Sung, T. C. Lau, and W. H. Li. 1997. Molecular phylogeny of extant gymnosperms and seed plant evolution: analysis of nuclear 18S rRNA sequences. Mol. Biol. Evol. 14:56-68.[Abstract]
Church, G. M., and W. Gilbert. 1984. Genomic sequencing. Proc. Natl. Acad. Sci. USA 81:1991-1995.
Coen, E. S., and E. M. Meyerowitz. 1991. The war of the whorls: genetic interactions controlling flower development. Nature 353:31-37.[CrossRef][Medline]
Colombo, L., J. Franken, E. Koetje, J. J. J. Van Went, H. J. M. Dons, G. C. Angenent, and A. J. Van Tunen. 1995. The petunia MADS box gene FBP11 determines ovule identity. Plant Cell 7:1859-1868.[Abstract]
Darwin, C. 1859. The origin of species. Royal Society, London.
Doyle, J. A., and M. J. Donoghue. 1986. Seed plant phylogeny and the origin of angiosperms: an experimental cladistic approach. Bot. Rev. 52:321-431.
Doyle, J. J., and J. L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19:11-15.
Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using bootstrap. Evolution 39:783-791.[CrossRef][Web of Science]
Force, A., M. Lynch, F. B. Pickett, A. Amores, Y. L. Yan, and J. Postlethwait. 1999. Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151:1531-1545.
Frohman, M. A., M. K. Dush, and G. R. Martin. 1988. Rapid production of full-length cDNAs from rare transcripts: amplification using single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85:8998-9002.
Goodrich, J., P. Puangsomlee, M. Martin, D. Long, E. M. Meyerowitz, and G. Coupland. 1997. A polycomb-group gene regulates homeotic gene expression in Arabidopsis. Nature 386:44-51.[CrossRef][Medline]
Goremykin, V., V. Bobrova, J. Pahne, A. Troisky, A. Antonov, and W. Martin. 1996. Noncoding sequences from the slowly evolving chloroplast inverted repeat in addition to rbcl data do not support gnetalean affinities of angiosperms. Mol. Biol. Evol. 13:383-396.[Abstract]
Hasebe, M., M. Ito, R. Kofuji, K. Iwatsuki, and K. Ueda. 1992. Phylogenetic relationships in Gnetophyta deduced from rbcL gene sequences. Bot. Mag. (Tokyo) 105:385-391.[CrossRef]
Hasebe, M., C. K. Wen, M. Kato, and J. A. Banks. 1998. Characterization of MADS homeotic genes in the fern Ceratopteris richardii. Proc. Natl. Acad. Sci. USA 95:6222-6227.
Hassanin, A., G. Lecointre, and S. Tillier. 1998. The "evolutionary signal" of homoplasy in protein-coding gene sequences and its phylogenetic consequences for weighting in phylogeny. C. R. Acad. Sci. Paris Ser. III 321:611-620.[Medline]
Hassanin, A., E. Pasquet, and J. D. Vigne. 1998. Systematic relationships within the subfamily Caprinae (Artiodactyla, Bovidae) as determined from cytochrome b sequences. J. Mammalian Evol. 5:217-236.[CrossRef]
Holton, T. A., and M. W. Graham. 1990. A simple and efficient method for direct cloning of PCR products using dT-tailed vectors. Nucleic Acids Res. 19:1156.[CrossRef]
Jofuku, K. D., B. G. W. Den Boer, M. Van Montagu, and J. K. Okamuro. 1994. Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant Cell 6:1211-1225.[Abstract]
Kang, H. G., Y. S. Noh, Y. Y. Chung, M. A. Costa, K. An, and G. An. 1995. Phenotypic alterations of petal and sepal by ectopic expression of a rice MADS box gene in tobacco. Plant Mol. Biol. 29:1-10.[CrossRef][Web of Science][Medline]
Kim, Y. S., H. S. Lee, M. H. Lee, O. J. Yoo, and J. R. Liu. 1998. A MADS box gene homologous to AG is expressed in seedlings as well as in flowers of Ginseng. Plant Cell Physiol. 39:836-845.
Kofugi, R., and K. Yamaguchi. 1997. Isolation and phylogenetic analysis of MADS gene from the fern Ceratopteris richardii. J. Phytogeogr. Taxon. 45:83-91.
Kuzoff, R. K., and C. S. Gasser. 2000. Recent progress in reconstructing angiosperm phylogeny. Trends Plant Sci. 5:330-336.[CrossRef][Web of Science][Medline]
Liu, J. J., and G. K. Podila. 1997. Characterization of a MADS box gene (Y09611) from immature female cone of red pine (PGR97-032). Plant Physiol. 113:665.
Mizukami, Y., H. Huang, M. Tudor, Y. Hu, and H. Ma. 1996. Functional domains of the floral regulator AGAMOUS: characterization of the DNA binding domain and analysis of dominant negative mutations. Plant Cell 8:831-845.[Abstract]
Mouradov, A., T. Glassick, and R. Teasdale. 1997. Isolation and characterisation of a new MADS-box cDNA from Pinus radiata. Plant Physiol. 113:664.
Mouradov, A., T. Glassick, A. Vivian-Smith, and R. Teasdale. 1996. Isolation of a MADS box gene family from Pinus radiata. Plant Physiol. 110:1047.[CrossRef][Medline]
Mouradov, A., B. Hamdorf, R. D. Teasdale, J. T. Kim, K. U. Winter, and G. Theissen. 1999. A DEF/GLO-like MADS-box gene from a gymnosperm; Pinus radiata contains an ortholog of angiosperm B class floral homeotic genes. Dev. Genet. 25:245-252.[CrossRef][Web of Science][Medline]
Münster, T., J. Pahnke, A. DiRosa, J. T. Kim, W. Martin, H. Saedler, and G. Theissen. 1997. Floral homeotic genes were recruited from homologous MADS-box genes preexisting in the common ancestor of ferns and seed plants. Proc. Natl. Acad. Sci. USA 94:2415-2420.
Philippe, H. 1993. MUST: a computer package of management utilities for sequences and trees. Nucleic Acids Res. 21:5264-5272.
Purugganan, M. D., S. D. Rounsley, R. J. Schmidt, and M. Yanofsky. 1995. Molecular evolution of flower development: diversification of the plant MADS-box regulatory gene family. Genetics 140:345-356.[Abstract]
Riechmann, J. L., and E. M. Meyerowitz. 1997. MADS domain proteins in plant development. Biol. Chem. 378:1079-1101.[Web of Science][Medline]
Rogers, S. O., and J. Bendich. 1985. Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissues. Plant Mol. Biol. 5:69-76.
Rutledge, R., S. Regan, O. Nicolas, P. Fobert, C. Cote, W. Bosnich, C. Kauffeldt, G. Sunohara, A. Seguin, and D. Stewart. 1998. Characterization of an AGAMOUS homologue from the conifer black spruce (Picea mariana) that produces floral homeotic conversions when expressed in Arabidopsis. Plant J. 15:625-634.[CrossRef][Web of Science][Medline]
Shindo, S., M. Ito, K. Ueda, M. Kato, and M. Hasebe. 1999. Characterization of MADS genes in the gymnosperm Gnetum parvifolium and its implication on the evolution of reproductive organs in seed plants. Evol. Dev. 3:180-190.
Shore, P., and A. D. Sharrocks. 1995. The MADS-box family of transcription factors. Eur. J. Biochem. 229:1-13.[Web of Science][Medline]
Sundström, J., A. Carlsbecker, M. E. Svensson, M. Svenson, U. Johanson, G. Theissen, and P. Engström. 1999. MADS-box genes active in developing pollen cones of Norway spruce (Picea abies) are homologous to B-class floral homeotic genes in angiosperms. Dev. Genet. 25:253-266.[CrossRef][Web of Science][Medline]
Swofford, D. L. 1999. PAUP*: phylogenetic analysis using parsimony (*and other methods). Sinauer Associates, Sunderland, Mass.
Tandre, K., V. A. Albert, A. Sundas, and P. Engström. 1995. Conifer homologues to genes that control floral development in angiosperms. Plant Mol. Biol. 27:69-78.[CrossRef][Web of Science][Medline]
Tandre, K., M. Svenson, M. E. Svensson, and P. Engström. 1998. Conservation of gene structure and activity in the regulation of reproductive organ development of conifers and angiosperms. Plant J. 15:615-623.[CrossRef][Web of Science][Medline]
Theissen, G. 2001. Development of floral organ identity: stories from the MADS house. Curr. Opin. Plant Biol. 4:75-85.[CrossRef][Web of Science][Medline]
Theissen, G., A. Becker, A. Di Rosa, A. Kanno, J. T. Kim, T. Münster, K. U. Winter, and H. Saedler. 2000. A short history of MADS-box genes in plants. Plant Mol. Biol. 42:115-149.[CrossRef][Web of Science][Medline]
Theissen, G., J. T. Kim, and H. Saedler. 1996. Classification and phylogeny of the MADS-box multigene family suggest defined roles of MADS-box gene subfamilies in the morphological evolution of eukaryotes. J. Mol. Evol. 43:484-516.[Web of Science][Medline]
Vergara-Silva, F., L. Martinez-Castilla, and E. Alvarez-Buylla. 2000. MADS-box genes: development and evolution of plant body plans. J. Phycol. 36:803-812.[CrossRef][Web of Science]
Walden, A. R., D. Y. Wang, C. Walter, and R. C. Gardner. 1998. A large family of TM3 MADS-box cDNA in Pinus radiata includes two members with deletions of the conserved K domain. Plant Sci. 138:167-176.[CrossRef]
Weigel, D., and E. M. Meyerowitz. 1994. The ABCs of floral homeotic genes. Cell 78:203-209.[CrossRef][Web of Science][Medline]
Winter, K. U., A. Becker, T. Münster, T. Kim, H. Saedler, and G. Theissen. 1999. MADS-box genes reveal that gnetophytes are more closely related to conifers than to flowering plants. Proc. Natl. Acad. Sci. USA 96:7342-7347.
Yanofsky, M. F., H. Ma, J. L. Bowman, G. N. Drews, K. A. Feldmann, and E. M. Meyerowitz. 1990. The protein encoded by the Arabidopsis homeotic gene AGAMOUS resembles transcription factors. Nature 346:35-39.[CrossRef][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
G. Theissen and R. Melzer Molecular Mechanisms Underlying Origin and Diversification of the Angiosperm Flower Ann. Bot., September 1, 2007; 100(3): 603 - 619. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Scutt, M. Vinauger-Douard, C. Fourquin, C. Finet, and C. Dumas An evolutionary perspective on the regulation of carpel development J. Exp. Bot., July 1, 2006; 57(10): 2143 - 2152. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Kramer, M. A. Jaramillo, and V. S. Di Stilio Patterns of Gene Duplication and Functional Evolution During the Diversification of the AGAMOUS Subfamily of MADS Box Genes in Angiosperms Genetics, February 1, 2004; 166(2): 1011 - 1023. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







