MBE Advance Access originally published online on April 2, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mol. Biol. Evol. 20(5):735-747. 2003
DOI: 10.1093/molbev/msg088
© 2003 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038
The Basic HelixLoopHelix Transcription Factor Family in Plants: A Genome-Wide Study of Protein Structure and Functional Diversity


* Max-Planck-Institute for Plant Breeding Research, Cologne, Germany
Department of Cell and Developmental Biology, John Innes Centre, Colney, Norwich, United Kingdom
| Abstract |
|---|
|
|
|---|
Basic helixloophelix (bHLH) transcription factors (TFs) belong to a family of transcriptional regulators present in three eukaryotic kingdoms. Many different functions have been identified for these proteins in animals, including the control of cell proliferation and development of specific cell lineages. Their mechanism for controlling gene transcription often involves homodimerization or heterodimerization. In plants, little is known about the bHLH family, but we have determined that there are 133 bHLH genes in Arabidopsis thaliana and have confirmed that at least 113 of them are expressed. The AtbHLH genes constitute one of the largest families of transcription factors in A. thaliana with significantly more members than are found in most animal species and about an equivalent number to those in vertebrates. Comparisons with animal sequences suggest that the majority of plant bHLH genes have evolved from the ancestral group B class of bHLH genes. By studying the AtbHLH genes collectively, twelve subfamilies have been identified. Within each of these main groups, there are conserved amino acid sequence motifs outside the DNA binding domain. Potential gene redundancy among members of smaller subgroups has been analyzed, and the resulting information is presented to provide a simplified visual interpretation of the gene family, identifying related genes that are likely to share similar functions. Based on the current characterization of a limited number of plant bHLH proteins, we predict that this family of TFs has a range of different roles in plant cell and tissue development as well as plant metabolism.
Key Words: bHLH Arabidopsis thaliana transcription control genomics
| Introduction |
|---|
|
|
|---|
In 1989 Murre, McCaw, and Baltimore identified a region present in ten DNA binding proteins from animals that shared a significant number of identical amino acids. This region has become known as the basic helixloophelix (bHLH) domain. The proteins containing this domain have broad functions in regulating cell proliferation and cellular differentiation pathways and include human c-Myc, the myoblast determination factor MyoD, as well as Achaete and Scute from Drosophila melanogaster that define the initial steps in neural development. Also in 1989, Ludwig et al. reported the molecular identification of Lc, a regulator of anthocyanin biosynthesis in Zea mays, and showed that the predicted protein shared the bHLH domain. With the identification of the Ino4p protein from yeast (Berben et al. 1990), it became clear that bHLH proteins constitute a ubiquitous family of regulators in eukaryotes and that the bHLH domain is an ancient component of transcriptional regulation. Moreover, recent genome sequencing and expressed sequence tag (EST) programs indicated the existence of many more bHLH genes in various eukaryotic species.
Typically, a bHLH domain comprises a stretch of about 18 hydrophilic and basic amino acids at the N-terminal end of the domain, followed by two regions of hydrophobic residues predicted to form amphipathic
-helices separated by an intervening loop (Murre et al. 1994). Studies with mammalian bHLH proteins have shown that the conserved HLH structure is required for dimerization between two bHLH proteins (Ferré-D'Amaré et al. 1993, 1994; Ellenberger et al. 1994). The specificity for a particular partner protein resides in the
-helices, and for a sequence-specific interaction with DNA, the basic regions of both polypeptides are required. Although the bHLH domain is conserved between animals and plants, the dimeric structure of the DNA binding complex in plants has only been inferred from the conserved amino acid sequence. Some, although not all, plant bHLH proteins which have been studied so far have been shown to modulate gene expression by binding DNA.
Generally, eukaryotic transcription factors (TFs) consist of at least two discrete domainsa DNA binding domain and an activation or repression domainthat operate together to modulate the rate of transcriptional initiation from target gene promoters (Ptashne 1988). Domains other than the bHLH DNA binding domain are known to be important for the regulation of gene expression by bHLH proteins, and these regions may be conserved at the amino acid level in related proteins from different species. This has been shown for the E12 family of bHLH proteins in animals, which are a ubiquitously expressed class of animal TFs involved in the development of many cell lineages. E12 factors act via heterodimerization with other, tissue-specific bHLH proteins (Quong et al. 1993).
To date, few plant bHLH genes have been studied in detail, but those that have, have provided insights into the central roles of TFs in biology, and into their biochemical function. Genetic analysis of the anthocyanin biosynthetic pathway in Z. mays has identified a group of bHLH genes required for production of the purple anthocyanin pigments: R(R-s and R-p), B, Lc, Sn (Neuffer, Coe, and Wessler 1997, pp. 367369) and R-ch Hopi (Petroni et al. 2000). The encoded bHLH proteins interact with members of another group of TFs in Z. maysCl or P, both R2R3-MYB proteinsand together they control pigmentation in tissues wherever the two proteins are expressed together. Other members of the R gene family in Z. mays and other species are also believed to interact with MYB proteins to regulate anthocyanin production in a tissue-specific manner. The bHLH/MYB partnership has been shown to be important in the differentiation of A. thaliana trichomes through the interaction of a bHLH protein encoded by GLABRA3 (GL3) and the R2R3-MYB protein GLABROUS1 (GL1; Payne, Zhang, and Lloyd 2000). Phytochrome interacting factor 3 (PIF3) is a bHLH protein necessary for light signaling mediated by the photoreceptor phytochrome B (PhyB) in A. thaliana (Ni, Tepperman, and Quail 1998; Halliday et al. 1999). Recently it has been shown that PhyB in its active form interacts with DNA-bound PIF3, suggesting a mechanism for direct activation of photoresponsive genes by a light signal (Martinez-Garcia, Huq, and Quail 2000).
Within the A. thaliana genome (The Arabidopsis Genome Initiative 2000), 32 families of genes have been identified as encoding TFs that contain three or more members (Riechmann and Ratcliffe 2000). Each family is characterized by a unique region of highly conserved amino acid sequence, which usually comprises the DNA binding domain. From comparative analysis of these conserved domains, it is apparent that within each gene family there are subgroups of genes that are structurally more closely related to each other than to other members of the family. Regions of TFs outside the DNA binding domain often contain short amino acid sequence motifs or domains that are also conserved. The prediction is that proteins within a subgroup that share these smaller motifs will share similar (but not necessarily identical) functions. Where information on function is available, different members of a subgroup of genes tend to share very similar or related functions, even though the biological functions of the particular TF family as a whole may be very broad (for example the AP2 family [Riechmann and Meyerowitz 1998], the R2R3-MYB family [Stracke, Werber, and Weisshaar 2001], or the MADS-box family [Becker et al. 2000]). Therefore an assessment of the structural relationships between all A. thaliana bHLH genes should provide a guide for prediction of gene function and for elucidation of the range of activities carried out by members of the bHLH gene family. At least for related groups of animal genes, the amino acid sequence of the bHLH motif has retained sufficient information to identify evolutionary relationships (Atchley and Fitch 1997). In this article, structural analysis is presented for all A. thaliana genes encoding proteins with a bHLH motif. Gene and protein sequence prediction is based on sequence information from newly isolated cDNAs. The results of the structural relationships between the proteins are discussed in the context of the functional diversity of this family of TFs in plants.
| Materials and Methods |
|---|
|
|
|---|
Identification of bHLH Motifs in the A. thaliana Genome Sequence
Using a consensus sequence based on that predicted by Atchley and Fitch (1997) for the bHLH motif, A. thaliana genomic DNA sequence was scanned using the TBLASTN algorithm (Altschul et al. 1997). In addition, DNA sequences corresponding to open reading frames (ORFs) predicted by the A. thaliana genome annotation (TAIR: www.arabidopsis.org; MIPS: mips.gsf.de/proj/thal/) were scanned for the bHLH motif. To this collection of putative bHLH genes, additional candidate bHLH genes were added which encode proteins containing the INTERPRO domains IPR001092, IPR003015 (www.ebi.ac.uk/interpro/) and/or the PROSITE motif PS00038 (www.expasy.ch/prosite). Finally, following the identification of groups of genes with distinct but similar sequence, the PSI-Blast algorithm (Altschul et al. 1997) was used to search for more bHLH genes belonging to each group that may have escaped the initial database searches. Previously, some genes had been classified as of the bHLH type which did not encode a bona fide bHLH motif according to our definition (lacking several amino acids that are highly conserved). These were excluded from the analysis.
The exon-intron structure prediction for each gene was improved by using a combination of gene-modeling programs (GeneMark: opal.biology.gatech.edu/GeneMark; GeneScan: genome.dkfz-heidelberg.de/cgi-bin/GENSCAN/genscan.cgi) and comparison with available ESTs. Where ESTs were not available, the predicted protein and the genes most closely related to it were aligned and the gene model was altered manually if there was evidence for greater similarity in gene structure than predicted. In some cases, small exons in the basic region were missing in the existing predictions (e.g., AtbHLH16).
Isolation and Sequencing of cDNAs for the A. thaliana bHLH TFs
To verify the ORFs for each bHLH gene, and to confirm expression, cDNAs corresponding to the majority of genes were isolated using the Rapid Amplification of cDNA Ends (RACE) protocol (Frohman, Dush, and Martin 1988). If available, cDNAs encoding bHLH proteins identified in EST collections were sequenced. All sequencing was on both strands. DNA sequences were determined by the MPIZ DNA core facility on Applied Biosystems (Weiterstadt, Germany) Abi Prism 377 and 3100 sequencers using BigDye-terminator chemistry. Premixed reagents were from Applied Biosystems. Oligonucleotide primers were purchased from Metabion (Martinsried, Germany) or Invitrogen (Carlsbad, Calif.).
Expression Analysis
Total RNA was isolated from cultured A. thaliana cells (At7; Trezzini, Horrichs, and Somssich 1993) that were submitted to eight different treatments: untreated, incubation for 6 h at 4°C in the dark, incubation at 37°C in the dark, incubation under UV light at 28°C, and incubation with 10 µM 1-aminocyclopropan-1-carboxylic acid at 28°C. To simulate a stress response to pathogen attack, cell cultures were also incubated with 1 µM Flagellin22 at 28°C, with 10 µM methyl-jasmonate for 40 min at 28°C or 10 µM salicylic acid for 40 min at 28°C. In addition, RNA was isolated from roots, leaves, stems, and flowers and siliques of 6- to 8-week-old plants grown in the greenhouse under long day conditions. Using CDSIII-NotI primer (ATTCTAGAGGCCGAGGCGGCCGCCATG(T30)VN), 5 µg of each RNA was reverse transcribed in a 20 µl reaction with Superscript II RT polymerase (Invitrogen). After addition of 100 µl water, 1 µl of the diluted reaction was used for a first round of polymerase chain reaction (PCR) with a gene-specific primer, and CDSIII-NotI. PCR was carried out in a 96-well format, where 8 different genes could be probed against the array of 12 cDNA samples. After a first denaturation step of 2 min at 94°C and 30 cycles of 20 s at 94°C, 20 s at 60°C, and 2 min at 72°C, an aliquot of 1 µl of each reaction was transferred to a new 96-well plate and subjected to a second round of PCR with the same conditions as in round one, except that a second, nested, gene-specific primer was included. Resulting PCR fragments were analyzed on gels, and bands of the expected size were extracted and subsequently inserted into pTOPO (Invitrogen). Two to six clones were sequenced for each gene.
Clustering of bHLH Genes into Groups and Subgroups
For each gene, only the amino acid sequence from the bHLH domain was used for creating a manually edited alignment for sequence comparison with the ClustalW (Thompson, Higgins, and Gibson 1994) program. A similarity tree was constructed (Neighbor-Joining algorithm) followed by bootstrap analysis using PHYLIP (Felsenstein 1993). Based on the sequence information, 500 trees were calculated and all branches that appeared in more than 250 trees were used to calculate the final clustering. In addition, we used the MEME analysis tool (Bailey and Elkan 1994) to search for motifs shared by the AtbHLH proteins.
| Results and Discussion |
|---|
|
|
|---|
The A. thaliana Genome Contains 133 Genes with a bHLH Motif
A consensus sequence derived from an alignment of well-known plant sequences in the region surrounding the HLH motif was used to identify bHLH genes in A. thaliana (fig. 1a). Variations from this consensus were observed in a number of genes, but a high degree of conservation was observed in those positions that are known to have important functions in DNA binding and protein dimerization. The frequencies of each amino acid at every position in the bHLH domain deduced from all 133 bHLH genes are shown in figure 2. Within those bHLH proteins with proven ability to bind DNA, the amino acids at positions 5, 9, and 13 are the most critical. Non-plant bHLH proteins with His-Glu-Arg (H-E-R) at positions 5, 9, and 13 have been shown to bind to a variation of the E-box hexanucleotide sequence (E-box: CANNTG, variation: CACGTG), with His5 and Glu9 residues in contact with the outer two nucleotides and Arg13 in contact with the two inner nucleotides of the motif (Brownlie et al. 1997; Atchley, Terhalle, and Dress 1999; Ledent and Vervoort 2001). The DNA backbone is contacted by the basic residues at positions 10 and 12, and these are also conserved in the majority of plant proteins. The highly conserved hydrophobic residues in helix 1 and 2 are believed to be necessary for dimerization. For example, the structure of the human MAX protein dimer bound to DNA requires Leu23 in helix 1 to contact the corresponding Leu23 in the second bHLH polypeptide and confer stability to the DNAprotein dimer complex (Brownlie et al. 1997). In A. thaliana a leucine residue is present at position 23 in every bHLH protein, which emphasizes the likely importance of this residue in dimerization. Despite being well studied, there are some plant proteins (the R-like proteins) for which there is no evidence of dimerization. Based on the analysis presented (fig. 2) and the obvious importance of Leu23 in MAX dimerization, however, it is reasonable to suppose that R proteins do form dimers. Dimer formation is also known to be stabilized further by conserved hydrophobic residues in helix 2, which are located to one side of the helix. These hydrophobic residues are also conserved in plant proteins in a similar configuration, as detected by helical-wheel analysis (data not shown).
|
|
In total, 133 AtbHLH genes were identified, fitting well to the consensus presented in figure 2. This contrasts with the number of 139 claimed by Riechmann and Ratcliffe (2000). Unfortunately, the annotation data used by those authors are not available for comparison. A generic name (AtbHLH001 to AtbHLH133) was given to each bHLH gene, including those that had already been named in previous publications. The numbering system we chose provides a unique identifier for each bHLH gene as proposed for the A. thaliana, MYB, WRKY, and bZIP TFs (Kranz et al. 1998; Romero et al. 1998; Eulgem et al. 2000; Jakoby et al. 2002).
The predicted gene structure of 87 bHLH genes was verified by performing 3' RACE-PCR on 12 different cDNA sources. The results highlighted a number of incorrectly annotated ORFs (37% of all annotated bHLH genes) that had been predicted by the A. thaliana genome annotation. Forty-seven entries were corrected using our RACE-PCR results, including AtbHLH125 (At1g62975), which was newly annotated; this genome region was originally described as a noncoding repeat-rich region. These new cDNA accessions have been deposited at GenBank with the assigned AtbHLHxyz gene name and the new ORF structure has been submitted to MAtDB at the Munich Institute for Protein Sequences (MIPS). The results of the RT-PCR experiment also provided a preliminary impression of the expression profile of these genes (fig. 3). In total, at least 113 bHLH genes can be confirmed as being expressed in A. thaliana, including genes previously characterized. Most of the genes tested on all 12 cDNA sources have a very broad expression spectrum; very few are specific for particular tissues (AtbHLH039, 040, 050, and 101) or treatments (AtbHLH085). Because this PCR-based approach was designed for the maximum amplification of cDNAs, it does not provide any insight into the relative expression levels of the genes. However, our results provide the basis for the creation of cDNA (and other) arrays with a high coverage of bHLH genes.
|
The TCP (TB1-CYC-PCFs) family is a small subgroup of proteins sharing a common motif that is predicted to form a basic-helixloophelix structure (Cubas et al. 1999). Two rice proteins from this gene family, PCF1 and PCF2, have been shown to bind DNA, and the importance of the bHLH motif in the binding ability of PCF1 has been demonstrated by deletion analysis (Kosugi and Ohashi 1997). However, although these TCP proteins have a DNA binding domain with a predicted secondary structure similar to bHLH proteins, their primary amino acid sequences are unrelated to that of all other members of the bHLH family, including other eukaryotes (fig. 1b). Therefore, TCP proteins are not considered further in our study. It is possible that the TCP bHLH-like structure and the bHLH structure of the conventional bHLH proteins provide an example of convergent evolution.
The Structural Relationships Between Plant bHLH Genes
Based on the amino acid alignments of 133 bHLH domains, a comparative tree was constructed. The clustering showed that there are 12 major groups (subfamilies) of related sequences which were strongly supported by bootstrap analysis. The conclusions from this analysis are presented in figure 4
, with closely related genes within subfamilies grouped together. Comparing all aspects of gene structure, genes within each subfamily contain a similar number of introns with conserved positions, and show similar predicted lengths for the encoded proteins and similar positions for the bHLH domain within the protein. In many subfamilies, the proteins also share related amino acid sequences outside the DNA binding domain (fig. 4). These motifs give added support to the clustering obtained using the DNA binding domain alone and in several cases help to separate the subfamilies further into subgroups. Some of these motifs probably act as activation domains and may also be important for interaction with other modules of the transcription complex, or they may be targets of signal transduction chains. For example, proteins belonging to sub-groups IIId, IIIe, and IIIf have a conserved stretch of amino acids positioned toward the N-termini of the proteins, a region that is found only in plant bHLH proteins (fig. 4). Amino acids within this region are predicted to form
-helixes, some of which are highly amphipathic (Goff, Cone, and Chandler 1992). A conserved aspartate residue in this region (within motif 11) of the AtbHLH005/ATR2 protein appears to be functionally important for correct expression of several downstream target genes that belong to the tryptophan biosynthesis pathway (Smolen et al. 2002). Between the bHLH domain and the conserved N-terminal domain is a sequence rich in acidic amino acids with significant negative charge (Lc: Ludwig et al. 1989; B: Radicella, Turks, and Chandler 1991; DEL: Goodrich, Carpenter, and Coen 1992), a feature of activating domains identified in known transcriptional activators (Ptashne 1988). Using trans-activation assays Goff, Cone, and Chandler (1992) demonstrated that a region of the anthocyanin regulator B, comprising the N-terminal domain and part of the acidic region, was important for activation of a Bz1 promoter-reporter construct. However, activation only occurred when the C1 MYB protein was also present in the assay, indicating that an interaction of B with C1 was necessary to obtain an active transcription complex. The interacting region within C1 was mapped to the MYB DNA binding domain (Goff, Cone, and Chandler 1992), and more recently, particular amino acids within the MYB domain of C1 have been shown to be important for an interaction with the R bHLH protein (Grotewold et al. 2000). It is not clear whether R-like bHLH proteins (group III) bind DNA in the bHLH-MYB complex or whether DNA binding occurs only via the MYB partner; to date only C1 has been shown to bind cis-acting elements in the promoter of the Z. mays A1 (DFR) gene (Sainz, Grotewold, and Chandler 1997). Within bHLH group III, B is most similar to A. thaliana AtbHLH012/MYC1, a bHLH protein from A. thaliana identified by Urao et al. (1996).
|
|
The Z. mays Intensifier1 gene product (In1: Burr et al. 1996) also belongs to group III and is more closely related to PhAN1 (ANTHOCYANIN1 of Petunia hybrida: Spelt et al. 2000) and AtbHLH042/TT8 (Nesi et al. 2000) than it is to the R-like proteins AtbHLH012/MYC1, PhJAF13 (Quattrocchio et al. 1998) or AmDEL (DELILA of Antirrhinum majus: Goodrich, Carpenter, and Coen 1992; de Pater et al. 1997). Most group III members with known functions act as TFs regulating genes of flavonoid metabolism. In contrast, ZmIn1 encodes a repressor that regulates the expression of the White pollen1 (Whp1) gene, one of the Z. mays genes encoding chalcone synthase (CHS: Franken et al. 1991) and also the Bronze1 gene, which encodes UDP-flavonoid 3-O-glucosyl transferase and catalyzes one of the last steps in the anthocyanin biosynthetic pathway (Klein and Nelson 1983). The predicted structure of In1 is similar to that of AtbHLH042/TT8 and PhAN1, but many ZmIn1 transcripts are miss-spliced (Burr et al. 1996). This may result in premature termination of translation and, more specifically, in a protein lacking the bHLH domain. The means by which truncated In1 protein negatively regulates Whp1 and Bz1 gene expression are not yet clear.
Specific functions for other genes belonging to group III are known, and in contrast to the R-like proteins, the corresponding gene products have been shown to bind DNA. The Phaseolus vulgaris bHLH protein PG1 binds to a G-box motif in the ß-phaseolin gene promoter that is important for positive transcriptional regulation (Kawagoe and Murai 1996), and the A. thaliana rd22BP1 protein (AtbHLH006/rd22BP1/RAP-1) binds to a region of the rd22 gene promoter that is sufficient for dehydration- and ABA-induced expression of the rd22 gene (Abe et al. 1997; de Pater et al. 1997). The tomato Fer genestructurally closely related to A. thaliana group III bHLH geneshas been shown recently to have a role in iron uptake in roots (Ling et al. 2002), and so the diverse functional nature of this group of bHLH proteins in A. thaliana is emerging.
Members of group IV have a highly conserved leucine zipper (ZIP) motif adjacent to the second helix of the bHLH motif. The ZIP domain is predicted to adopt a coiled-coil structure that permits dimerization between proteins (Lupas 1996). Some animal proteins also contain a ZIP domain in the same position as the plant bHLH-ZIP proteins, and a few members of group III also have a partially conserved ZIP motif. In animal bHLH-ZIP proteins, there is evidence that the ZIP motif stabilizes protein dimers (Brandt-Rauf et al. 1989; Bresnick and Felsenfeld 1994) and that particular residues within the ZIP domain determine dimerization specificity (Marchetti et al. 1995). The functions of the plant group IV bHLH-ZIP proteins are unknown.
Recently, three members of group XII, AtbHLH044/BEE1, AtbHLH058/BEE2, and AtbHLH050/BEE3 (BR Enhanced Expression) from A. thaliana have been linked to multiple pathways regulating plant growth and development (Friedrichsen et al. 2002). These closely related bHLHs act redundantly as positive regulators in the early Brassinosteroid (BR) signaling pathway and they also affect signaling by abscisic acid (ABA), a known antagonist of BR.
One might anticipate that proteins clustered on the tree have similar biological functions. However the genes that make up subgroup IIIf are involved in very different processes; flavonoid/anthocyanin biosynthesis (AtbHLH0012/MYC1and AtbHLH042/TT8) and trichome initiation (AtbHLH001/GL3). The maize gene, Lc, encodes a member of the R/B family and is orthologous to the A. thaliana gene AtbHLH012/MYC1. Overexpression of Lc in wild-type A. thaliana results in additional trichomes and an elevated level of anthocyanins compared to control plants (Lloyd, Walbot, and Davis 1992). However, in maize, members of the R gene family have no influence on trichome formation. The bHLH protein bHLH001/GL3, closely related to Lc (Payne, Zhang, and Lloyd 2000), belongs to a cascade of transcriptional regulators that control the differentiation of trichome progenitor cells in shoot epidermis. Although the maize Lc gene was overexpressed in a heterologous context, the observation that it can induce trichome formation in A. thaliana suggests that closely related genes retain the potential to cross over and regulate parallel processes (requiring similar transcriptional activators) when expressed at artificially high levels. This may reflect the importance that patterns of expression and strength of expression have on the specific function(s) carried out by transcription factors in wild-type tissues.
Evolution of bHLH Protein Structure and Function
In their phylogenetic classification of animal bHLH protein sequences, Atchley and Fitch (1997) identified more than 24 protein lineages containing proteins with related function. They found that these lineages could be organized further into five groups (A to E) that relate to the preferred DNA binding sequence of the proteins within each lineage. Within each group proteins bound to a variation of the palindromic hexanucleotide sequence CANNTG known as the E-box motif. Patterns of amino acids were found at three positions within the basic region of the bHLH motif (the 5913 configuration) that defined the five different subgroups very accurately and suggested that the amino acid sequence motif of group B, with an H-E-R configuration, was the ancestral sequence (Atchley and Fitch 1997).
In A. thaliana, three proteins, namely PvPG1, AtbHLH006/rd22BP1/RAP-1 (both group III), and more recently AtbHLH008/PIF3 (group VII; Martinez-Garcia, Huq, and Quail 2000) have been shown to bind a sequence identical or very similar to the B variant of the animal E-box motif, which is also identical to the G-box core motif (CACGTG), a ubiquitous regulatory DNA element found in plants that is also bound by some bZIP TFs (Menkens, Schindler, and Cashmore 1995). Most (87 of 133) A. thaliana genes have the H-E-R configuration within the bHLH domain that is found in members of group B from animals (fig. 4), suggesting that plant bHLH proteins evolved from one or several members of group B that were present in early eukaryotic lineages. In this context it is also interesting that seven plant bHLH proteins in group IV contain their ZIP motif in the identical position to animal bHLH-ZIP proteins, which allwith one exceptionbelong to the class B proteins. Some plant proteins, notably members of groups VIII and X, have a variation of the H-E-R configuration and contain helix-breaking prolines in the basic region (fig. 4), characteristics that may interfere with affinity for DNA. These variations may enable these proteins to act as negative regulators, retaining the ability to dimerize with other bHLH proteins but lacking the ability to bind DNA. This would make group X members candidates for reclassification into group D according to Atchley and Fitch (1997).
From comparative studies it is apparent that the bHLH motif was present in early eukaryotes and that the subfamilies of genes distinguishable today have emerged following the separation of plants, animals, and fungi (Ledent and Vervoort 2001). A. thaliana possesses more bHLH genes than are found in Caenorhabditis elegans or D. melanogaster (39 and 59 genes, respectively), but is comparable to the numbers obtained for human and mouse, 125 and 102, respectively (Ledent, Paquet, and Vervoort 2002). Although no striking similarities in gene structure were detected between plants and these other lineages, except for similarities to animal group B proteins, it is still possible that some plant proteins have retained functions possessed by the ancestral eukaryotic proteins such as the developmental control of cell lineages. For example, MyoD and related proteins are involved in the determination of muscle cell lineages, and expression is confined to these cells. They interact with the ubiquitously expressed E12 family of bHLH proteins to produce active heterodimers (French et al. 1991). Furthermore, E12 and related proteins are involved in the determination and maintenance of other cell types through their ability to dimerize with other proteins that are expressed in specific cell lineages (Littlewood and Evan 1998, pp. 2735). Recently, two members of the plant group VII have been shown to be important in the development of floral structures. Mutants in the gene AtbHLH024/SPATULA are defective specifically in the development of the style and stigma and, with strong mutant alleles, cells comprising the pollen-transmitting tract tissue do not form (Alvarez and Smyth 1999; Heisler et al. 2001). However, expression is not confined to these tissues, indicating that SPATULA may have additional roles in other aspects of growth and development. The other member of group VII, AtbHLH073, is the most closely related A. thaliana protein to SPATULA and is responsible for the differentiation of a nonlignified cell layer necessary for cell separation during dehiscence (Rajani and Sundaresan 2001).
Mediating responses to the environment may be another ancient function retained by plant bHLH proteins, for example, controlling responses to light and interacting with components of the circadian clock. The PIF-like 1 protein (AtbHLH124/PIL1; group VII) has been shown to interact with APRR1, a factor that has been implicated in circadian rhythms (Makino et al. 2002) and that belongs to a class of pseudo-response regulators that are components of signal transduction systems. In addition, AtbHLH008/PIF3 (group VII) can regulate expression of the circadian clock genes CCA1 and LHY, suggesting that this protein provides an entry point to phytochrome regulation of the circadian clock (Martinez-Garcia, Huq, and Quail 2000). Studies indicate that light regulation and control of biorhythms are functionally interrelated and possibly have a common evolutionary origin (Kay 1997). Photoreceptor proteins and protein components of the circadian clock from species belonging to several kingdoms of life contain PAS (PER-ARNT-SIM) domains (Nambu et al. 1991) that have been shown to mediate proteinprotein interactions. These include the D. melanogaster PER protein that interacts via its PAS domain with Timeless to regulate the circadian clock (Zeng et al. 1996), and the White Collar 2 protein (WC2) from Neurospora crassa that is involved in the blue light regulation of gene expression (Linden and Macino 1997) and has also been shown to be a clock component (Crosthwaite, Dunlap, and Loros 1997). A PAS-like domain has been identified in PIF3 and a related protein, PIF4 (Huq and Quail 2002), but in both cases the domain shows only modest similarity to animal PAS domains, although the region encompassing the PAS domain in PIF3 is important for the interaction of PhyB (Ni et al. 1996).
ProteinProtein Interactions and Their Importance in Gene Regulation
In mammals and D. melanogaster there are many instances in which bHLH proteins have been shown to homodimerize or heterodimerize as a means of controlling transcription (Littlewood and Evan 1998). The ability to heterodimerize allows a large number of potential DNA binding complexes that may have different biochemical propertiesincluding variable DNA binding characteristics and activation or repression potentialsthereby creating a lot of opportunities for regulating different genes or sets of genes. In plants, dimerization has been shown for two related members of group VII, AtbHLH008/PIF3, and AtbHLH026/HFR1/REP1, with proposed dominant roles in phytochrome B and phytochrome A signaling, respectively (Halliday et al. 1999; Fairchild, Schumaker, and Quail 2000; Soh et al. 2000). In yeast-two-hybrid experiments, PIF3 binds preferentially to PhyB rather than PhyA, as well as being able to interact with itself (Zhu et al. 2000); AtbHLH026/HFR1/REP1 binds neither to phyA nor to phyB, but it does bind to PIF3 in vitro, suggesting that it is likely to operate as a heterodimer in regulating transcription from target promoters (Fairchild, Schumaker, and Quail 2000). Recently the AtbHLH009/PIF4 protein, which is closely related to PIF3, has been shown to have a role in phyB-regulated de-etiolation as a negative regulator (Huq and Quail 2002). PIF4 and PIF3 have similar biochemical properties, but unlike PIF3, PIF4 is unable to bind to the active form of PhyB when bound to the G-box element. In addition, PIF4 cannot regulate G-boxcontaining gene promoters including those of the circadian clock genes CCA1 and LHY, which are targets of PIF3 (Martinez-Garcia, Huq, and Quail 2000). Structurally, the most similar gene to PIF4 in A. thaliana, AtbHLH065 (fig. 4) appears on a duplicated section of the A. thaliana genome, so it may have functions similar if not identical to those of PIF4. Subgroup VIIa contains several more genes encoding factors which are related to PIF3, PIL1, and PIF4 that have not yet been studied (AtbHLH015, AtbHLH023, AtbHLH056, AtbHLH119, and AtbHLH127) but that have (due to their structural similarity) the potential to be involved in aspects of phytochrome signaling. These five genes may have redundant functions, as two are found in duplicated sections of the genome and one is part of a cluster of four structurally similar genes, indicating that there have been recent duplications of these bHLH genes in A. thaliana (fig. 4).
Interactions can also occur between different classes of TFs. For example, members of bHLH group III associate with R2R3-MYB proteins. In a similar way to the Z. mays bHLH protein B, which interacts with the R2R3-type MYB protein C1 to create an active transcription complex (Goff, Cone, and Chandler 1992), bHLH TFs related to B from other species also behave as co-activators of MYB proteins to induce anthocyanin biosynthetic genes (PhJAF13; Quattrocchio et al. 1998). AtMYC1 is the most closely related protein in A. thaliana to these R-like proteins, but it is phylogenetically distinct from two other regulators of anthocyanin biosynthesis, ANTHOCYANIN1 (AN1) from Petunia (Spelt et al. 2000) and TT8 from A. thaliana (Nesi et al. 2000). Together with a MYB protein (AN2 in P. hybrida, TT2 in A. thaliana), these petunia bHLH proteins can regulate a specific part of the anthocyanin pathway, downstream of dihydroflavonol biosynthesis. In transfection assays, co-expression of PhAN1 or PhJAF13 with PhAN2 (a P. hybrida R2R3-MYB) resulted in much stronger activation of the DFR target gene than if either PhAN1 or PhJAF13 were expressed alone (Spelt et al. 2000). Interestingly, when PhAN1 was co-expressed with ZmP, a R2R3-MYB protein that activates a branch of flavonoid biosynthesis in Z. mays maternal seed tissues, expression was enhanced 10-fold more than if ZmP was expressed alone; this did not happen if PhJAF13 was co-expressed with ZmP (Spelt et al. 2000). This experiment suggests that, at least under certain conditions, specific bHLH factors differ in their affinities for particular MYB proteins, and this finding is a reflection of their structural differences.
The AtbHLH001/GL3 protein that controls trichome development in A. thaliana interacts with the R2R3-MYB protein AtMYB0/GLABROUS1 (GL1) in yeast-2-hybrid experiments (Payne, Zhang, and Lloyd 2000). GL1 and GL3 positively control expression of the homeodomain transcription factor GLABRA2 (GL2; Rerie, Feldmann, and Marks 1994) but it is not known how GL2 then induces the cellular requirements for the directional shaping of a developing trichome cell. Interestingly, GL1 and WEREWOLF (WER) belong to the same sub-group of R2R3-MYB proteins (subgroup 15; Stracke, Werber, and Weisshaar 2001) but control opposite epidermal cell fates: WER is expressed specifically in non-hair cells of root epidermis to prevent hair formation, whereas GL1 promotes trichome formation that is expressed only in shoot epidermis. The biochemical function of the WER protein is likely to be identical to that of GL1, because each gene can complement the mutant phenotype of the other when expressed from the reciprocal promoter (Lee and Schiefelbein 2001). In this case function is dependent on cell-specific expression and the other (co-localized) TFs with which each protein can interact. Some specificity might come through the differential expression of bHLH genes with which WER might interact, as GL3 does not affect root hair formation.
There is also evidence that another member of group III, AtbHLH006/rd22BP1/RAP-1, interacts with the R2R3-MYB protein AtMYB2 to activate gene expression from a dehydration and ABA-responsive promoter element (Abe et al. 1997). In conclusion, bHLH/MYB interactions are probably conserved for group III bHLH proteins and for members of MYB subgroups 5, 6, and 15 (Stracke, Werber, and Weisshaar 2001), but it remains to be clarified whether interactions are confined to the protein products of these particular gene clades or are more widespread. The N-terminal region conserved in group III bHLH proteins may be involved in bHLH/MYB interactions and could provide the specificity for particular proteinprotein interactions (Goff, Cone, and Chandler 1992).
| Future Perspectives |
|---|
|
|
|---|
It is likely that the main groups of bHLH genes identified here are present in all higher plants and have evolved specific functions with different biochemical properties. The current challenge is to assign functions to all these subgroups and the genes within them. Although the recent work on group VII proteins illustrates that functions can be diverse within a subgroup, in other cases conservation of function between proteins of the same subgroup may be high. One reason could be that the A. thaliana genome contains sections of sequence duplication covering at least 60% of the entire genome which probably have arisen from a tetraploidization event (Blanc et al. 2000). By searching for bHLH genes within these regions (MIPS Redundancy Viewer: mips.gsf.de/proj/thal/db/gv/rv/), we estimate that duplication events account for 51 (40%) of the 133 genes (fig. 4). As expected, each duplicated gene pair detected falls within the same major clade of bHLH genes. In seven instances there are up to four bHLH genes arranged in tandem and often only one gene of the cluster is present on a duplicated section. This may be because clusters have arisen by gene duplication after a major segmental duplication event, or because genes have been lost from clusters after a major segmental duplication event. However, the clustering analysis shows that pairs of structurally very similar genes exist (data not shown) that are not in corresponding duplicated regions of the genome nor in tandem repeats. These genes may have arisen following large segmental duplications but have been translocated subsequently to other regions of the genome, in which case they are still likely to share similar functions.
Major segmental duplication events appear to have occurred at different times during angiosperm evolution, possibly including a polyploidization event (Blanc et al. 2000; Vision, Brown, and Tanksley 2000), and the more recent duplication events may have contributed significantly to the phenomenon of gene redundancy (Pickett and Meeks-Wagner 1995). Combining the data on inferred gene duplications with clustering analysis of genes from one species (fig. 4) provides a framework for visualizing the likely functional diversity within groups of related genes such as those encoding bHLH proteins. From these data, educated guesses can be made concerning gene redundancy, which will be important information for estimating the number of knockout mutations required for observing altered phenotypes for closely related genes. From structural similarities we estimate that the bHLH family includes at least 33 discernible functions in transcriptional regulation. An automated interrogatory gene tree founded on the Arabidopsis genes would be a useful aid for providing clues to the functions for bHLH proteins in other model and crop species and would allow subsequent experiments on these genes to be designed more effectively. Knowledge about the structure of the AtbHLH gene family, and the option to integrate new bHLH genes from other plant species into this frame, will further facilitate the identification of the functions of bHLH genes in plants.
| Acknowledgements |
|---|
|
|
|---|
The work for this study was financed in part from the European Union's REGIA project granted to C.M. and B.W. (Regulatory Gene Initiative in Arabidopsis; QLG2-CT-1999000876), and from the Deutsche Forschungsgemeinschaft to B.W. and M.H. ("Graduiertenkolleg für Molekulare Analysen von Entwicklungsprozessen" der Universität zu Köln; IIIGK-GRK 306/1). The Ph.D. work of M.W. was funded by Norddeutsche Pflanzenzucht (NPZ), Hohenlieth, Germany. Further financial support to B.W. was from GABI (German plant genomics program "Genomanalyse im biologischen System Pflanze"). We thank Ute Tartler and Doris Falkenhahn for technical support, Heiko Schoof (Munich Institute for Protein Sequences [MIPS], München, Germany) for help with AGI gene identifiers, Guenter Theissen and Gieta Dewal for critical reading of the manuscript, and the Max-Planck-Institute for Plant Breeding Research DNA core facility "ADIS" for their sequencing work.
| Footnotes |
|---|
E-mail: weisshaa{at}mpiz-koeln.mpg.de.
William Taylor, Associate Editor ![]()
| Literature Cited |
|---|
|
|
|---|
Abe, H., K. Yamaguchi-Shinozaki, T. Urao, T. Iwasaki, D. Hosokawa, and K. Shinizaki. 1997. Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression. Plant Cell 9:1859-1868.[Abstract]
Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped Blast and PSI-Blast: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-402.
Alvarez, J., and D. R. Smyth. 1999. Crabs Claw and Spatula, two Arabidopsis genes that control carpel development in parallel with AGAMOUS. Development 126:2377-2386.[Abstract]
Atchley, W. R., and W. M. Fitch. 1997. A natural classification of the basic helixloophelix class of transcription factors. Proc. Natl. Acad. Sci. USA 94:5172-5176.
Atchley, W. R., W. Terhalle, and A. Dress. 1999. Positional dependence, cliques, and predictive motifs in the bHLH protein domain. J. Mol. Evol. 48:501-16.[CrossRef][Web of Science][Medline]
Bailey, T. L., and C. Elkan. 1994. Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, 2836. AAAI Press, Menlo Park, Calif.
Becker, A., K.-U. Winter, B. Meyer, H. Saedler, and G. Theissen. 2000. MADS-Box gene diversity in seed plants 300 million years ago. Mol. Biol. Evol. 17:1425-1434.
Berben, G., M. Legrain, V. Gilliquet, and F. Hilger. 1990. The yeast regulatory gene Pho4 encodes a helix-loop-helix motif. Yeast 6:451-454.[CrossRef][Web of Science][Medline]
Bernhardt, C., A. Gonzalez, F. Zhang, A. M. Lloyd, and J. W. Schiefelbein. 2001. Two bHLH genes are involved in Arabidopsis root epidermis cell specification. 12th International Conference on Arabidopsis Research. Wisconsin Union Conference Services, Madison, Wis.
Blanc, G., A. Barakat, R. Guyot, R. Cooke, and M. Delseny. 2000. Extensive duplication and reshuffling in the Arabidopsis genome. Plant Cell 12:1093-1101.
Brandt-Rauf, P. W., M. R. Pincus, J. M. Chen, and G. Lee. 1989. Conformational energy analysis of the leucine repeat regions of C/EBP, GCN4, and the proteins of the myc, jun, and fos oncogenes. J. Prot. Chem. 8:679-688.[CrossRef][Web of Science][Medline]
Bresnick, E. H., and G. Felsenfeld. 1994. The leucine zipper is necessary for stabilizing a dimer of the helixloophelix transcription factor USF but not for maintenance of an elongated conformation. J. Biol. Chem. 269:21110-21116.
Brownlie, P., T. Ceska, M. Lamers, C. Romier, G. Stier, H. Teo, and D. Suck. 1997. The crystal structure of an intact human Max-DNA complex: new insights into mechanisms of transcriptional control. Structure 5:509-520.[Medline]
Burr, F. A., B. Burr, B. E. Scheffler, M. Blewitt, U. Wienand, and E. C. Matz. 1996. The maize repressor-like gene intensifier1 shares homology with the r1-b1 multigene family of transcription factors and exhibits missplicing. Plant Cell 8:1249-1259.[Abstract]
Crosthwaite, S. K., J. C. Dunlap, and J. J. Loros. 1997. Neurospora wc-1 and wc-2: transcription, photoresponses, and the origins of circadian rhythmicity. Science 276:763-769.
Cubas, P., N. Lauter, J. Doebley, and E. Coen. 1999. The TCP domain: a motif found in proteins regulating plant growth and development. Plant J. 18:215-222.[CrossRef][Web of Science][Medline]
de Pater, S., K. Pham, J. Memelink, and J. Kijne. 1997. RAP-1 is an Arabidopsis MYC-like R protein homologue that binds to G-box sequence motifs. Plant Mol. Biol. 34:169-174.[CrossRef][Web of Science][Medline]
Ellenberger, T., D. Fass, M. Arnaud, and S. C. Harrison. 1994. Crystal structure of transcription factor E47: E-box recognition by a basic region helixloophelix dimer. Genes Dev. 8:970-980.
Eulgem, T., P. J. Rushton, S. Robatzek, and I. E. Somssich. 2000. The WRKY superfamily of plant transcription factors. Trends Plant Sci. 5:199-206.[CrossRef][Web of Science][Medline]
Fairchild, C. D., M. A. Schumaker, and P. H. Quail. 2000. HFR1 encodes an atypical bHLH protein that acts in phytochrome A signal transduction. Genes Dev. 14:2377-2391.
Felsenstein, J. 1993. PHYLIP (phylogeny inference package). Version 3.54c. Distributed by the author, Department of Genetics,. University of Washington, Seattle.
Ferré-D'Amaré, A. R., P. Pognonec, R. G. Roeder, and S. K. Burley. 1994. Structure and function of the b/HLH/Z domain of USF. EMBO J. 13:180-189.[Web of Science][Medline]
Ferré-D'Amaré, A. R., G. C. Prendergast, E. B. Ziff, and S. K. Burley. 1993. Recognition by Max of its cognate DNA through a dimeric b/HLH/Z domain. Nature 363:38-45.[CrossRef][Medline]
Franken, P., U. Niesbach-Klösgen, U. Weydermann, L. Maréchal-Drouard, H. Saedler, and U. Wienand. 1991. The duplicated chalcone synthase genes C2 and Whp (white pollen) of Zea mays are independently regulated; evidence for translational control of Whp expression by the anthocyanin intensifying gene in. EMBO J. 10:2605-2612.[Web of Science][Medline]
French, B. A., K. L. Chow, E. N. Olson, and R. J. Schwartz. 1991. Heterodimers of myogenic helixloophelix regulatory factors and E12 bind a complex element governing myogenic induction of the avian cardiac alpha-actin promoter. Mol. Cell. Biol. 11:2439-2450.
Friedrichsen, D. M., J. Nemhauser, T. Muramitsu, J. N. Maloof, J. Alonso, J. R. Ecker, M. Furuya, and J. Chory. 2002. Three redundant brassinosteroid early response genes encode putative bhlh transcription factors required for normal growth. Genetics 162:1445-1456.
Frohman, M. A., M. K. Dush, and G. R. Martin. 1988. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85:8998-9002.
Goff, S. A., K. C. Cone, and V. L. Chandler. 1992. Functional analysis of the transcriptional activator encoded by the maize B gene: evidence for a direct functional interaction between two classes of regulatory proteins. Genes Dev. 6:864-675.
Goodrich, J., R. Carpenter, and E. S. Coen. 1992. A common gene regulates pigmentation pattern in diverse plant species. Cell 68:955-964.[CrossRef][Web of Science][Medline]
Grotewold, E., M. B. Sainz, L. Tagliani, J. M. Hernandez, B. Bowen, and V. L. Chandler. 2000. Identification of the residues in the Myb domain of maize C1 that specify the interaction with the bHLH cofactor R. Proc. Natl. Acad. Sci. USA 97:13579-13584.
Halliday, K. J., M. Hudson, M. Ni, M. Qin, and P. H. Quail. 1999. poc1: an Arabidopsis mutant perturbed in phytochrome signaling because of a T DNA insertion in the promoter of PIF3, a gene encoding a phytochrome-interacting bHLH protein. Proc. Natl. Acad. Sci. USA 96:5832-5837.
Heisler, M. G., A. Atkinson, Y. H. Bylstra, R. Walsh, and D. R. Smyth. 2001. Spatula, a gene that controls development of carpel margin tissues in Arabidopsis, encodes a bHLH protein. Development 128:1089-1098.[Abstract]
Huq, E., and P. H. Quail. 2002. PIF4, a phytochrome-interacting bHLH factor, functions as a negative regulator of phytochrome B signaling in Arabidopsis. EMBO J. 21:2441-2450.[CrossRef][Web of Science][Medline]
Jakoby, M., W. Droege-Laser, T. Kroj, J. Tiedemann, J. Vicente-Carbajosa, B. Weisshaar, and F. Parcy. 2002. The bZIP family of transcription factors in Arabidopsis thaliana. Trends Plant Sci. 7:106-111.[CrossRef][Web of Science][Medline]
Kawagoe, Y., and N. Murai. 1996. A novel basic region/helixloophelix protein binds to a G-box motif CACGTG of the bean seed storage protein beta-phaseolin gene. Plant Sci. 116:47-57.[CrossRef]
Kay, S. A. 1997. PAS, present, and future: clues to the origins of circadian clocks. Science 276:753-754.
Klein, A. S., and O. E. Nelson, Jr. 1983. The allelic state at intensifier influences accumulation of UDP glucose: flavonoid 3-O-glucosyltransferase in maize. Phytochemistry 22:2612-2634.
Kosugi, S., and Y. Ohashi. 1997. PCF1 and PCF2 specifically bind to cis elements in the rice proliferating cell nuclear antigen gene. Plant Cell 9:1607-1619.[Abstract]
Kranz, H. D., M. Denekamp, and R. Greco et al., (14 co-authors). 1998. Towards functional characterisation of the members of the R2R3-MYB gene family from Arabidopsis thaliana. Plant J. 16:263-276.[CrossRef][Web of Science][Medline]
Ledent, V., O. Paquet, and M. Vervoort. 2002. Phylogenetic analysis of the human basic helixloophelix proteins. Genome Biol. 3(6):1-18.
Ledent, V., and M. Vervoort. 2001. The basic helixloophelix protein family: comparative genomics and phylogenetic analysis. Genome Res. 11:754-770.
Lee, M. M., and J. Schiefelbein. 2001. Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis. Development 128:1539-1546.[Abstract]
Linden, H., and G. Macino. 1997. White collar 2, a partner in blue-light signal transduction, controlling expression of light-regulated genes in Neurospora crassa. EMBO J. 16:98-109.[CrossRef][Web of Science][Medline]
Ling, H.-Q., P. Bauer, Z. Bereczky, B. Keller, and M. W. Ganal. 2002. The tomato fer gene encoding a bHLH protein controls iron-uptake responses in roots. Proc. Natl. Acad. Sci. USA 99:13938-13943.
Littlewood, T. D., and G. I. Evan. 1998. Basic helixloophelix transcription factors. Oxford University Press, Oxford.
Lloyd, A. M., V. Walbot, and R. W. Davis. 1992. Arabidopsis and Nicotiana anthocyanin production activated by maize regulators R and C1. Science 258:1773-1775.
Ludwig, S. R., L. F. Habera, S. L. Dellaporta, and S. R. Wessler. 1989. Lc, a member of the maize R gene family responsible for tissue-specific anthocyanin production, encodes a protein similar to transcriptional activators and contains the myc-homology region. Proc. Natl. Acad. Sci. USA 86:7092-7096.
Lupas, A. 1996. Coiled coils: new structures and new functions. Trends Biochem. Sci. 21:375-382.[CrossRef][Web of Science][Medline]
Makino, S., A. Matsushika, M. Kojima, T. Yamashino, and T. Mizuno. 2002. The APRR1/TOC1 quintet implicated in circadian rhythms of Arabidopsis thaliana: I. Characterization with APRR1-overexpressing plants. Plant Cell Physiol. 43:58-69.
Marchetti, A., M. Abril-Marti, B. Illi, G. Cesareni, and S. Nasi. 1995. Analysis of the Myc and Max interaction specificity with lambda repressor-HLH domain fusions. J. Mol. Biol. 248:541-550.[CrossRef][Web of Science][Medline]
Martinez-Garcia, J., E. Huq, and P. Quail. 2000. Direct targeting of light signals to a promoter element-bound transcription factor. Science 288:859-863.
Menkens, A. E., U. Schindler, and A. R. Cashmore. 1995. The G-box: a ubiquitous regulatory DNA element in plants bound by the GBF family of bZIP proteins. Trends Biochem. Sci. 20:506-510.[CrossRef][Web of Science][Medline]
Murre, C., G. Bain, M. A. van Dijk, I. Engel, B. A. Furnari, M. E. Massari, J. R. Matthews, M. W. Quong, R. R. Rivera, and M. H. Stuiver. 1994. Structure and function of helixloophelix proteins. Biochim. Biophys. Acta 1218:129-135.[Medline]
Murre, C., P. S. McCaw, and D. Baltimore. 1989. A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell 56:777-783.[CrossRef][Web of Science][Medline]
Nambu, J. R., J. O. Lewis, K. A. Wharton, Jr., and S. T. Crews. 1991. The Drosophila single-minded gene encodes a helixloophelix protein that acts as a master regulator of CNS midline development. Cell 67:1157-1167.[CrossRef][Web of Science][Medline]
Nesi, N., I. Debeaujon, C. Jond, G. Pelletier, M. Caboche, and L. Lepiniec. 2000. The TT8 gene encodes a basic helixloophelix domain protein required for expression of DFR and BAN genes in arabidopsis siliques. Plant Cell 12:1863-1878.
Neuffer, M. G., E. H. Coe, Jr., and S. R. Wessler. 1997. Mutants of maize. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
Ni, W., T. Fahrendorf, G. M. Ballance, C. Lamb, and R. A. Dixon. 1996. Stress responses in alfalfa (Medicago sativa L.). XX. Transcriptional activation of phenylpropanoid pathway genes in elicitor-induced cell suspension cultures. Plant Mol. Biol. 30:427-438.[CrossRef][Web of Science][Medline]
Ni, M., J. M. Tepperman, and P. H. Quail. 1998. PIF3, a phytochrome-interacting factor necessary for normal photoinduced signal transduction, is a novel basic helixloophelix protein. Cell 95:657-667.[CrossRef][Web of Science][Medline]
Payne, C. T., F. Zhang, and A. M. Lloyd. 2000. GL3 encodes a bHLH protein that regulates trichome development in Arabidopsis through interaction with GL1 and TTG1. Genetics 156:1349-1362.
Petroni, K., E. Cominelli, G. Consonni, G. Gusmaroli, G. Gavazzi, and C. Tonelli. 2000. The developmental expression of the maize regulatory gene Hopi determines germination-dependent anthocyanin accumulation. Genetics 155:323-336.
Pickett, F. B., and D. R. Meeks-Wagner. 1995. Seeing double: appreciating genetic redundancy. Plant Cell 7:1347-1356.[CrossRef][Web of Science][Medline]
Ptashne, M. 1988. How eukaryotic transcriptional activators work. Nature 335:683-689.[CrossRef][Medline]
Quattrocchio, F., J. F. Wing, K. van der Woude, J. N. M. Mol, and R. Koes. 1998. Analysis of bHLH and MYB domain proteins: species specific regulatory differences are caused by divergent evolution of target anthocyanin genes. Plant J. 13:475-488.[CrossRef][Web of Science][Medline]
Quong, M. W., M. E. Massari, R. Zwart, and C. Murre. 1993. A new transcriptional-activation motif restricted to a class of helixloophelix proteins is functionally conserved in both yeast and mammalian cells. Mol. Cell. Biol. 13:792-800.
Radicella, J. P., D. Turks, and V. L. Chandler. 1991. Cloning and nucleotide sequence of a cDNA encoding B-Peru, a regulatory protein of the anthocyanin pathway in maize. Plant Mol. Biol. 17:127-130.[CrossRef][Web of Science][Medline]
Rajani, S., and V. Sundaresan. 2001. The Arabidopsis myc/bHLH gene ALCATRAZ enables cell separation in fruit dehiscence. Curr. Biol. 11:1914-1922.[CrossRef][Web of Science][Medline]
Rerie, W. G., K. A. Feldmann, and M. D. Marks. 1994. The GLABRA2 gene encodes a homeo domain protein required for normal trichome development in Arabidopsis. Genes Dev. 8:1388-1399.
Riechmann, J. L., and E. M. Meyerowitz. 1998. The AP2/EREBP family of plant transcription factors. Biol. Chem. 379:633-646.[Web of Science][Medline]
Riechmann, J. L., and O. J. Ratcliffe. 2000. A genomic perspective on plant transcription factors. Curr. Opin. Plant Biol. 3:423-434.[CrossRef][Web of Science][Medline]
Romero, I., A. Fuertes, M. J. Benito, J. M. Malpical, A. Leyva, and J. Paz-Ares. 1998. More than 80 R2R3-MYB regulatory genes in the genome of Arabidopsis thaliana. Plant J. 14:273-284.[CrossRef][Web of Science][Medline]
Sainz, M. B., E. Grotewold, and V. L. Chandler. 1997. Evidence for direct activation of an anthocyanin promoter by the maize C1 protein and comparison of DNA binding by related Myb domain proteins. Plant Cell 9:611-625.[Abstract]
Smolen, G. A., L. Pawlowski, S. E. Wilensky, and J. Bender. 2002. Dominant alleles of the basic helixloophelix transcription factor ATR2 activate stress-responsive genes in Arabidopsis. Genetics 161:1235-1246.
Soh, M. S., Y. M. Kim, S. J. Han, and P. S. Song. 2000. REP1, a basic helixloophelix protein, is required for a branch pathway of phytochrome A signaling in arabidopsis. Plant Cell 12:2061-2074.
Spelt, C., F. Quattrocchio, J. N. M. Mol, and R. Koes. 2000. Anthocyanin1 of petunia encodes a basic helixloophelix protein that directly activates transcription of structural anthocyanin genes. Plant Cell 12:1619-1631.
Stracke, R., M. Werber, and B. Weisshaar. 2001. The R2R3-MYB gene family in Arabidopsis thaliana. Curr. Opin. Plant Biol. 4:447-456.[CrossRef][Web of Science][Medline]
The Arabidopsis Genome Initiative. 2000. Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408:796-815.[CrossRef][Medline]
Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. Clustal_W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.
Trezzini, G. F., A. Horrichs, and I. E. Somssich. 1993. Isolation of putative defense-related genes from Arabidopsis thaliana and expression in fungal elicitor-treated cells. Plant Mol. Biol. 21:385-389.[CrossRef][Web of Science][Medline]
Urao, T., K. Yamaguchishinozaki, N. Mitsukawa, D. Shibata, and K. Shinozaki. 1996. Molecular cloning and characterization of a gene that encodes a MYC-related protein in Arabidopsis. Plant Mol. Biol. 32:571-576.[CrossRef][Web of Science][Medline]
Vision, T. J., D. G. Brown, and S. D. Tanksley. 2000. The origins of genomic duplications in Arabidopsis. Science 290:2114-2117.
Zeng, H., Z. Qian, M. P. Myers, and M. Rosbash. 1996. A light-entrainment mechanism for the Drosophila circadian clock. Nature 380:129-135.[CrossRef][Medline]
Zhang, F., A. Gonzalez, M. Zhao, and A. M. Lloyd. 2001. An enhancer of Glabra3 defines roles for bHLH proteins in all TTG1-dependent pathways. 12th International Conference on Arabidopsis Research, Madison, Wis.
Zhu, Y., J. M. Tepperman, C. D. Fairchild, and P. H. Quail. 2000. Phytochrome B binds with greater apparent affinity than phytochrome A to the basic helixloophelix factor PIF3 in a reaction requiring the PAS domain of PIF3. Proc. Natl. Acad. Sci. USA 97:13419-13424.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
B. Karas, L. Amyot, C. Johansen, S. Sato, S. Tabata, M. Kawaguchi, and K. Szczyglowski Conservation of Lotus and Arabidopsis Basic Helix-Loop-Helix Proteins Reveals New Players in Root Hair Development Plant Physiology, November 1, 2009; 151(3): 1175 - 1185. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Welchen, I. L. Viola, H. J. Kim, L. P. Prendes, R. N. Comelli, J. C. Hong, and D. H. Gonzalez A segment containing a G-box and an ACGT motif confers differential expression characteristics and responses to the Arabidopsis Cytc-2 gene, encoding an isoform of cytochrome c J. Exp. Bot., March 1, 2009; 60(3): 829 - 845. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Streisfeld and M. D. Rausher Altered trans-Regulatory Control of Gene Expression in Multiple Anthocyanin Genes Contributes to Adaptive Flower Color Evolution in Mimulus aurantiacus Mol. Biol. Evol., February 1, 2009; 26(2): 433 - 444. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. V. Espley, C. Brendolise, D. Chagne, S. Kutty-Amma, S. Green, R. Volz, J. Putterill, H. J. Schouten, S. E. Gardiner, R. P. Hellens, et al. Multiple Repeats of a Promoter Segment Causes Transcription Factor Autoregulation in Red Apples PLANT CELL, January 1, 2009; 21(1): 168 - 183. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yang, N. Johnston, E. Talideh, S. Mitchell, C. Jeffree, J. Goodrich, and G. Ingram The endosperm-specific ZHOUPI gene of Arabidopsis thaliana regulates endosperm breakdown and embryonic epidermal development Development, November 1, 2008; 135(21): 3501 - 3509. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Maes, D. Inze, and A. Goossens Functional Specialization of the TRANSPARENT TESTA GLABRA1 Network Allows Differential Hormonal Control of Laminal and Marginal Trichome Initiation in Arabidopsis Rosette Leaves Plant Physiology, November 1, 2008; 148(3): 1453 - 1464. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Badawi, Y. V. Reddy, Z. Agharbaoui, Y. Tominaga, J. Danyluk, F. Sarhan, and M. Houde Structure and Functional Analysis of Wheat ICE (Inducer of CBF Expression) Genes Plant Cell Physiol., August 1, 2008; 49(8): 1237 - 1249. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kondou, M. Nakazawa, M. Kawashima, T. Ichikawa, T. Yoshizumi, K. Suzuki, A. Ishikawa, T. Koshi, R. Matsui, S. Muto, et al. RETARDED GROWTH OF EMBRYO1, a New Basic Helix-Loop-Helix Protein, Expresses in Endosperm to Control Embryo Growth Plant Physiology, August 1, 2008; 147(4): 1924 - 1935. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Nagano, Y. Fukao, M. Fujiwara, M. Nishimura, and I. Hara-Nishimura Antagonistic Jacalin-Related Lectins Regulate the Size of ER Body-Type {beta}-Glucosidase Complexes in Arabidopsis thaliana Plant Cell Physiol., June 1, 2008; 49(6): 969 - 980. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Rushton, M. T. Bokowiec, S. Han, H. Zhang, J. F. Brannock, X. Chen, T. W. Laudeman, and M. P. Timko Tobacco Transcription Factors: Novel Insights into Transcriptional Regulation in the Solanaceae Plant Physiology, May 1, 2008; 147(1): 280 - 295. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Tominaga, M. Iwata, R. Sano, K. Inoue, K. Okada, and T. Wada Arabidopsis CAPRICE-LIKE MYB 3 (CPL3) controls endoreduplication and flowering development in addition to trichome and root hair formation Development, April 1, 2008; 135(7): 1335 - 1345. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Leivar, E. Monte, B. Al-Sady, C. Carle, A. Storer, J. M. Alonso, J. R. Ecker, and P. H. Quail The Arabidopsis Phytochrome-Interacting Factor PIF7, Together with PIF3 and PIF4, Regulates Responses to Prolonged Red Light by Modulating phyB Levels PLANT CELL, February 1, 2008; 20(2): 337 - 352. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Streisfeld and M. D. Rausher Relaxed Constraint and Evolutionary Rate Variation between Basic Helix-Loop-Helix Floral Anthocyanin Regulators in Ipomoea Mol. Biol. Evol., December 1, 2007; 24(12): 2816 - 2826. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Hernandez, A. Feller, K. Morohashi, K. Frame, and E. Grotewold The basic helix loop helix domain of maize R links transcriptional regulation and histone modifications by recruitment of an EMSY-related factor PNAS, October 23, 2007; 104(43): 17222 - 17227. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Gremski, G. Ditta, and M. F. Yanofsky The HECATE genes regulate female reproductive tract development in Arabidopsis thaliana Development, October 15, 2007; 134(20): 3593 - 3601. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Monte, B. Al-Sady, P. Leivar, and P. H. Quail Out of the dark: how the PIFs are unmasking a dual temporal mechanism of phytochrome signalling J. Exp. Bot., September 12, 2007; (2007) erm186v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ohashi-Ito and D. C. Bergmann Regulation of the Arabidopsis root vascular initial population by LONESOME HIGHWAY Development, August 15, 2007; 134(16): 2959 - 2968. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Adam, F. Ouellet, N. A. Kane, Z. Agharbaoui, G. Major, Y. Tominaga, and F. Sarhan Overexpression of TaVRN1 in Arabidopsis Promotes Early Flowering and Alters Development Plant Cell Physiol., August 1, 2007; 48(8): 1192 - 1206. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Menand, K. Yi, S. Jouannic, L. Hoffmann, E. Ryan, P. Linstead, D. G. Schaefer, and L. Dolan An Ancient Mechanism Controls the Development of Cells with a Rooting Function in Land Plants Science, June 8, 2007; 316(5830): 1477 - 1480. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chen and J. M. Lopes Multiple Basic Helix-Loop-Helix Proteins Regulate Expression of the ENO1 Gene of Saccharomyces cerevisiae Eukaryot. Cell, May 1, 2007; 6(5): 786 - 796. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Baumann, M. Perez-Rodriguez, D. Bradley, J. Venail, P. Bailey, H. Jin, R. Koes, K. Roberts, and C. Martin Control of cell and petal morphogenesis by R2R3 MYB transcription factors Development, May 1, 2007; 134(9): 1691 - 1701. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Rampey, A. W. Woodward, B. N. Hobbs, M. P. Tierney, B. Lahner, D. E. Salt, and B. Bartel An Arabidopsis Basic Helix-Loop-Helix Leucine Zipper Protein Modulates Metal Homeostasis and Auxin Conjugate Responsiveness Genetics, December 1, 2006; 174(4): 1841 - 1857. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kodama and H. Sano Evolution of a Basic Helix-Loop-Helix Protein from a Transcriptional Repressor to a Plastid-resident Regulatory Factor: INVOLVEMENT IN HYPERSENSITIVE CELL DEATH IN TOBACCO PLANTS J. Biol. Chem., November 17, 2006; 281(46): 35369 - 35380. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ohashi-Ito and D. C. Bergmann Arabidopsis FAMA Controls the Final Proliferation/Differentiation Switch during Stomatal Development PLANT CELL, October 1, 2006; 18(10): 2493 - 2505. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Cao, H. Cheng, W. Wu, H. M. Soo, and J. Peng Gibberellin Mobilizes Distinct DELLA-Dependent Transcriptomes to Regulate Seed Germination and Floral Development in Arabidopsis Plant Physiology, October 1, 2006; 142(2): 509 - 525. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Feller, J. M. Hernandez, and E. Grotewold An ACT-like Domain Participates in the Dimerization of Several Plant Basic-helix-loop-helix Transcription Factors J. Biol. Chem., September 29, 2006; 281(39): 28964 - 28974. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang, Y. Sun, L. Timofejeva, C. Chen, U. Grossniklaus, and H. Ma Regulation of Arabidopsis tapetum development and function by DYSFUNCTIONAL TAPETUM1 (DYT1) encoding a putative bHLH transcription factor Development, August 15, 2006; 133(16): 3085 - 3095. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ogo, R. N. Itai, H. Nakanishi, H. Inoue, T. Kobayashi, M. Suzuki, M. Takahashi, S. Mori, and N. K. Nishizawa Isolation and characterization of IRO2, a novel iron-regulated bHLH transcription factor in graminaceous plants J. Exp. Bot., August 1, 2006; 57(11): 2867 - 2878. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, X. Duan, H. Jiang, Y. Sun, Y. Tang, Z. Yuan, J. Guo, W. Liang, L. Chen, J. Yin, et al. Genome-Wide Analysis of Basic/Helix-Loop-Helix Transcription Factor Family in Rice and Arabidopsis Plant Physiology, August 1, 2006; 141(4): 1167 - 1184. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Morita, M. Saitoh, A. Hoshino, E. Nitasaka, and S. Iida Isolation of cDNAs for R2R3-MYB, bHLH and WDR Transcriptional Regulators and Identification of c and ca Mutations Conferring White Flowers in the Japanese Morning Glory Plant Cell Physiol., April 1, 2006; 47(4): 457 - 470. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Sweeney, M. J. Thomson, B. E. Pfeil, and S. McCouch Caught Red-Handed: Rc Encodes a Basic Helix-Loop-Helix Protein Conditioning Red Pericarp in Rice PLANT CELL, February 1, 2006; 18(2): 283 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakano, K. Suzuki, T. Fujimura, and H. Shinshi Genome-Wide Analysis of the ERF Gene Family in Arabidopsis and Rice Plant Physiology, February 1, 2006; 140(2): 411 - 432. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-h. Lee, D. A. Henderson, and J.-K. Zhu The Arabidopsis Cold-Responsive Transcriptome and Its Regulation by ICE1 PLANT CELL, November 1, 2005; 17(11): 3155 - 3175. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Woll, L. A. Borsuk, H. Stransky, D. Nettleton, P. S. Schnable, and F. Hochholdinger Isolation, Characterization, and Pericycle-Specific Transcriptome Analyses of the Novel Maize Lateral and Seminal Root Initiation Mutant rum1 Plant Physiology, November 1, 2005; 139(3): 1255 - 1267. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. B. Lai, J. A. Nadeau, J. Lucas, E.-K. Lee, T. Nakagawa, L. Zhao, M. Geisler, and F. D. Sack The Arabidopsis R2R3 MYB Proteins FOUR LIPS and MYB88 Restrict Divisions Late in the Stomatal Cell Lineage PLANT CELL, October 1, 2005; 17(10): 2754 - 2767. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. P. Colangelo and M. L. Guerinot The Essential Basic Helix-Loop-Helix Protein FIT1 Is Required for the Iron Deficiency Response PLANT CELL, December 1, 2004; 16(12): 3400 - 3412. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bauer, T. Thiel, M. Klatte, Z. Bereczky, T. Brumbarova, R. Hell, and I. Grosse Analysis of Sequence, Map Position, and Gene Expression Reveals Conserved Essential Genes for Iron Uptake in Arabidopsis and Tomato Plant Physiology, December 1, 2004; 136(4): 4169 - 4183. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Hernandez, G. F. Heine, N. G. Irani, A. Feller, M.-G. Kim, T. Matulnik, V. L. Chandler, and E. Grotewold Different Mechanisms Participate in the R-dependent Activity of the R2R3 MYB Transcription Factor C1 J. Biol. Chem., November 12, 2004; 279(46): 48205 - 48213. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Khanna, E. Huq, E. A. Kikis, B. Al-Sady, C. Lanzatella, and P. H. Quail A Novel Molecular Recognition Motif Necessary for Targeting Photoactivated Phytochrome Signaling to Specific Basic Helix-Loop-Helix Transcription Factors PLANT CELL, November 1, 2004; 16(11): 3033 - 3044. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Fujimori, T. Yamashino, T. Kato, and T. Mizuno Circadian-Controlled Basic/Helix-Loop-Helix Factor, PIL6, Implicated in Light-Signal Transduction in Arabidopsis thaliana Plant Cell Physiol., August 15, 2004; 45(8): 1078 - 1086. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Gong, Y.-P. Shen, L.-G. Ma, Y. Pan, Y.-L. Du, D.-H. Wang, J.-Y. Yang, L.-D. Hu, X.-F. Liu, C.-X. Dong, et al. Genome-Wide ORFeome Cloning and Analysis of Arabidopsis Transcription Factor Genes Plant Physiology, June 1, 2004; 135(2): 773 - 782. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Matsushima, Y. Fukao, M. Nishimura, and I. Hara-Nishimura NAI1 Gene Encodes a Basic-Helix-Loop-Helix-Type Putative Transcription Factor That Regulates the Formation of an Endoplasmic Reticulum-Derived Structure, the ER Body PLANT CELL, June 1, 2004; 16(6): 1536 - 1549. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rose, S. Manikantan, S. J. Schraegle, M. A. Maloy, E. A. Stahlberg, and I. Meier Genome-Wide Identification of Arabidopsis Coiled-Coil Proteins and Establishment of the ARABI-COIL Database Plant Physiology, March 1, 2004; 134(3): 927 - 939. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bernhardt, M. M. Lee, A. Gonzalez, F. Zhang, A. Lloyd, and J. Schiefelbein The bHLH genes GLABRA3 (GL3) andENHANCER OF GLABRA3 (EGL3) specify epidermal cell fate in the Arabidopsis root Development, December 29, 2003; 130(26): 6431 - 6439. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-Y. Yang, Y.-M. Kim, S. Lee, P.-S. Song, and M.-S. Soh Overexpression of a Mutant Basic Helix-Loop-Helix Protein HFR1, HFR1-{Delta}N105, Activates a Branch Pathway of Light Signaling in Arabidopsis Plant Physiology, December 1, 2003; 133(4): 1630 - 1642. [Abstract] [Full Text] |
||||
![]() |
P. C. Bailey, C. Martin, G. Toledo-Ortiz, P. H. Quail, E. Huq, M. A. Heim, M. Jakoby, M. Werber, and B. Weisshaar Update on the Basic Helix-Loop-Helix Transcription Factor Gene Family in Arabidopsis thaliana PLANT CELL, November 1, 2003; 15(11): 2497 - 2502. [Full Text] [PDF] |
||||
![]() |
G. Chatel, G. Montiel, M. Pre, J. Memelink, M. Thiersault, B. Saint-Pierre, P. Doireau, and P. Gantet CrMYC1, a Catharanthus roseus elicitor- and jasmonate-responsive bHLH transcription factor that binds the G-box element of the strictosidine synthase gene promoter J. Exp. Bot., November 1, 2003; 54(392): 2587 - 2588. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Komatsu, M. Maekawa, S. Ujiie, Y. Satake, I. Furutani, H. Okamoto, K. Shimamoto, and J. Kyozuka LAX and SPA: Major regulators of shoot branching in rice PNAS, September 30, 2003; 100(20): 11765 - 11770. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Toledo-Ortiz, E. Huq, and P. H. Quail The Arabidopsis Basic/Helix-Loop-Helix Transcription Factor Family PLANT CELL, August 1, 2003; 15(8): 1749 - 1770. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||















