MBE Advance Access originally published online on March 5, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mol. Biol. Evol. 20(3):441-452. 2003
DOI: 10.1093/molbev/msg053
© 2003 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038
Rapid Evolution of the Sex-Determining Gene, transformer: Structural Diversity and Rate Heterogeneity Among Sibling Species of Drosophila
Department of Biology, McMaster University, Hamilton, Ontario, Canada
| Abstract |
|---|
|
|
|---|
While developmentally regulated genes are generally conserved, transformer (tra), a key locus involved in the regulation of sexual differentiation, is highly diverged between species of Drosophila. With an aim to understand its divergence between sibling species, we investigated tra sequence variation among members of the Drosophila melanogaster species complex, D. melanogaster, D. simulans, D. mauritiana, and D. sechellia. In this species group, tra divergence is rapid yet clocklike and exhibits large differences in protein size. D. melanogaster contains a 13amino acid tandem duplication, whereas D. sechellia possesses a 72amino acid tandem duplication representing a 30% increase in total amino acid residues. We also found evidence of a nonrandom distribution of replacement substitutions and heterogeneity in substitution rates using clustering statistics and a codon substitution model. We show that tra's rapid divergence in this species complex is the result of generally lower selective constraints around regions that encode arginine-serine (RS) domains and a significantly higher rate of substitutions around the insertion site of D. sechellia's large duplication. The proximity of rapidly diverged regions to sites of nucleotide insertion suggests that higher local rates of mutation may provide a causal mechanism for TRA's rapid divergence in this subgroup. A comparison of tra orthologs across the genus Drosophila suggest that TRA maintains an assortment of RS domains for proper sex determining function while much of the protein evolves relatively unconstrained.
Key Words: Sex determination neutral evolution selective constraints RS domains tandem duplication developmental system
| Introduction |
|---|
|
|
|---|
Early developmental processes have long been thought to be more conserved than late-acting processes, even between distantly related organisms. As a result, many classic phylogenetic inferences have been based on shared morphology from early ontogenetic stages (Gould 1977). With the availability of orthologous sequences from diverse taxa, biologists have begun to appreciate even more the extent of homology in development. Examples such as genes involved in embryonic pattern formation and cellular signaling have demonstrated the conservation of structure and function over a broad range of early acting developmental loci (Nusslein-Volhard 1994; Patel 1994; Chan and Jan 1999).
It is therefore surprising when an essential gene, expressed early in development, does not evolve in a typically conserved manner. The sex determining gene, transformer (tra), has previously been shown to possess the lowest sequence identity among known orthologous proteins between D. melanogaster and D. virilis (O'Neil and Beloté 1992). The primary function of tra is to act as a regulatory switch in the determination of sexual identity in each cell. Depending on the X:autosome ratio, tra is expressed as a functional protein (in XX females) or a truncated, nonfunctional protein (in XY males) (see fig. 1) via female-specific alternative splicing of tra premRNA controlled by the Sex-lethal protein, SXL. This switch is regulated by SXL binding to a polypyrimidine site in tra's first intron (Sosnowski, Beloté, and McKeown 1989; Handa et al. 1999) (see fig. 1). In females, TRA associates with the transformer-2 protein, TRA-2, via its arginine-serine (RS) domains, forming part of a protein complex that binds to target doublesex (dsx) premRNA repeat elements (Inoue et al. 1992). Then dsx premRNA is alternatively spliced in females to produce a female-specific product, whereas in males (without functional TRA), default splice sites result in a male-specific product. Each sex-specific protein regulates a host of downstream genes involved in sexual differentiation, including body size, genitalia development, mating preference, and pheromone production (Burtis and Baker 1989; Ferveur et al. 1997). The regulation of fruitless, which affects almost all aspects of male courtship behavior (Ryner et al. 1996), also involves tra.
|
So why has this important regulator of sexual differentiation evolved so rapidly? Two different aspects of transformer sequence variationwithin versus between specieshave been studied in the genus Drosophila and have suggested two contrary mechanisms of rapid tra divergence. In the first study, Walthour and Schaeffer (1994) observed drastically reduced levels of genetic variation in a natural population of D. melanogaster. After comparing levels of within species variation to that between species (Hudson, Kreitman, and Aguadé 1987), they rejected a neutral pattern of molecular evolution. Given that tra is located in a region of low to moderate recombination (Kliman and Hey 1993; Walthour and Schaeffer 1994), the authors suggested that directional selection via recent selective sweeps acting in or around the tra locus may have caused the pattern of low polymorphism in D. melanogaster and high divergence between species. In the second study, McAllister and McVean (2000) studied the species pair D. americana and D. virilis using population genetic and phylogenetic approaches. They concluded that high rates of neutral evolution may be sufficient to explain the high divergence between these species. The authors also tested the presence of a molecular clock on three published sequences of D. melanogaster, D. simulans, and D. erecta and found that a neutral evolutionary model could not be rejected in the three Sophophoran species.
In this paper, we evaluate sequence variation among all four sibling species of the D. melanogaster complexthe cosmopolitan species, D. melanogaster and D. simulans, and the island endemics, D. mauritiana and D. sechellia. The latter three species have diverged from each other within the last half a million years (Kliman et al. 2000). In light of its importance in the sex determination pathway, our goal is to understand both the pattern and mechanism of tra's rapid evolution and to gain insight into the functional nature of this essential regulatory protein. Our intent is to advance beyond general arguments of selection versus neutrality in order to better appreciate how various regions of the tra locus have evolved in different lineages. We report that this developmentally regulated gene has undergone rapid divergence under varying selective constraints and has evolved drastic changes in protein size in this species clade. We conclude that tra evolution in Drosophila has been shaped by an overall lack of selective constraints in addition to selective pressures on maintaining an array of RS domains.
| Materials and Methods |
|---|
|
|
|---|
Fly Strains
Nine isofemale strains each of D. melanogaster and D. simulans representing various geographical populations were sequenced in order to sample global transformer variation. D. melanogaster. Lines from India, Hawaii, and Malaysia originated from the (now defunct) Bowling Green Species Stock Centre. Two lines from State College, Pennsylvania were kindly provided by Brian Lazzaro (Cornell University). One line from Italy was collected by Alberto Civetta (University of Winnipeg). Three homozygous lines from Zimbabwe were provided by the Andrew Clark laboratory (Cornell University; originally from David Begun, University of California, Davis). D. simulans: Lines from Colombia, Florida, California and a strain of unknown origin (Solway-Hochman 1088) were also obtained from the Bowling Green Stock Centre. John Roote (Cambridge University) supplied flies from Ethiopia and Madagascar. Lines from Kenya, Italy and a strain of unknown origin (S-148) were obtained from the Ume
Stock Centre, Sweden. D. mauritiana: Two lines originated from the Bowling Green Stock Centre and two lines were obtained from the Ume
Stock Centre. D. sechellia: Three lines originated from the Bowling Green Stock Centre and one line (3151) was supplied by Alberto Civetta.
DNA Extraction, PCR Amplification, and Sequencing
A single fly protocol was employed to extract genomic DNA (Gloor and Engels 1992). Briefly, one fly is macerated in 10 mM Tris-Cl (pH 8.2), 1 mM EDTA, 25 mM NaCl, and 200 mg/ml proteinase-K and left to stand at room temperature for 30 min. The preparation is then heated at 95°C for 3 min. A fragment approximately 1 kb long (depending on the species) was amplified by a Perkin-Elmer 480 thermal cycler using the extracted genomic DNA in 1X PCR buffer (MBI Fermentas), 0.2 mM dNTPs, 1.0 pM primers, 2.5 mM MgCl2, and Taq polymerase (MBI Fermentas). For all four species, the same primers flanking the tra locus were used for amplification: 5'GTGCATCATTTAATTTCCAGCA3' and 5'TTTTAATGTACAAAACACACGAATG3'. The amplified product contains the full coding sequence along with tra's two introns, untranslated male exon, and 53 to 54 nucleotides of the 3' flanking region (fig. 1). PCR product was cut out of a 2% agarose gel, DNA extracted, and then purified (Qiagen). Sequencing was performed using an ABI 377 Prism DNA Sequencer using the same primers as above. Two internal primers were also used (5'GAGGTTCGAGAACAGGATCGG3' and 5'CGTTCACTGCTGCGACTTCGG3') so that polymorphisms could be confirmed on both strands. Discrepancies between strands were not observed. Two singletons in D. melanogaster (a replacement and silent polymorphism) were reconfirmed through independent DNA extraction, amplification, and sequencing. The large insertion found in D. sechellia made necessary the construction and use of a third set of internal primers (5'TAATGCGCAGTTGAGAGTCC3' and 5'GAAGTCGCAGCAGTGAACG3') for amplification and sequencing. The unusually large sequence found in D. sechellia was verified separately by three researcherseach independently extracted, amplified, and sequenced separate lines of this species. Approximate primer locations are shown in figure 1.
Sequence Analysis
In addition to the lines described above, we obtained 11 D. melanogaster sequences (O'Neil and Beloté 1992 [accession number M17478]; Walthour and Schaeffer 1994 [accession numbers L19464 to L19470 and L19618 to L19620]) and a D. erecta sequence (Walthour and Schaeffer 1994 [accession number X66527]) from GenBank to include in the melanogaster subgroup analyses. Sequences were labelled according to previously published designations. The published sequence of D. simulans (O'Neil and Beloté 1992 [accession number X66930]) was excluded from all analyses because six singletons (three of which cause nonsynonymous changes) were not observed in any of our nine D. simulans sequences. Although nucleotide diversity is quite high in D. simulans, such a high frequency of unique polymorphic sites originating from a single sequence suggests that this sequence may be in error.
Sequences from members of the subgenus Drosophila were also used, including D. virilis (O'Neil and Beloté 1992 [accession number X66528]) and 31 sequences from D. americana (McAllister and McVean 2000 [accession numbers AF208127 to AF208157]). Nucleotide and protein sequences were aligned using ClustalW (Thompson, Higgins, and Gibson 1994). Two estimates of nucleotide diversity,
, determined from the number of segregating sites in a sample of genes (Watterson 1975), and
, the average pairwise difference between haplotypes (Nei 1987), were calculated using DnaSP v3 (Rozas and Rozas 1997). Both are estimates of 4Neµ under neutral expectations. HKA tests used the published 5'-flanking region of Adh as a reference neutral locus (Kreitman and Hudson 1991). Positional heterogeneity of amino acid variation was assessed using the broken stick model of Goss and Lewontin (1996). Clustering of variable sites is measured by three statistics: Lmax, the maximum fractional interval length; Var(L), the variance in fractional interval length; and Q, a modified variance statistic. (A fourth statistic, Lmin or minimum interval length, is not accurate when a large fraction of the sites are variable, as is the case for tra, and was not used.) A computer program, Het2, was kindly provided by Peter Goss (Harvard University). In order to specify which region(s) possessed significant differences in rates of nucleotide substitution, we employed the permutation method of Hartmann and Golding (1998). Indels were removed from aligned coding regions and nucleotides were divided into subsets that comprise sites that are more prone to amino acid change (first and second codon positions, nondegenerate sites) as well as sites that serve as internal controls (third codon position, all nucleotide sites). Nondegenerate sites were chosen from a D. melanogaster sequence. Topologies with branch lengths were obtained using DNAML, (Phylip package v3.5c) (Felsenstein 1993) for each dataset. Sliding windows of various length then surveyed the sequence for regional rate heterogeneity via maximum likelihood (code kindly provided by Brian Golding, McMaster University).
To test evolutionary models of constant versus variable rates of substitution, molecular clock versus no clock, and the variability of dN/dS among lineages as well as codon sites, we used a maximum likelihood approach implemented by the program codeml in the PAML package v3.0b (Yang 1997). Under each model, estimates of the parameter,
= dN/dS, a measure of a protein's selective constraint, were obtained. Models were evaluated statistically by likelihood ratio tests. Pairwise estimates of dN and dS, nonsynonymous and synonymous substitutions per site, were calculated using the method of Nei and Gojobori (1986). To compare TRA divergence with that of other known proteins in the D. melanogaster species complex, we compared levels of divergence in the protein coding regions of loci that were found in the NCBI database for all four species of the D. melanogaster complex. These loci can be found in online Supplementary Material. Only the portion aligned in all four species was compared when partial sequences were available.
| Results |
|---|
|
|
|---|
Nucleotide Polymorphism in D. melanogaster and Its Sibling Species
The transformer locus was sequenced from the first position of its start codon to its 3' flanking region (fig. 1). In a previously published study on tra variation, Walthour and Schaeffer (1994) found two segregating sites, both silent, out of 1063 nucleotides spanning the tra locus in 10 sequences from a single North American population (Pennsylvania). One of these polymorphisms was a singleton, whereas the other was found at an intermediate frequency. In order to survey this species' allelic diversity, we sampled nine sequences from global populations of D. melanogaster. Among 926 nucleotide sites, we observe two polymorphic silent sites and one replacement polymorphism, which is only present in an Asian population. Thus, genetic variation at the tra locus is reduced not only in the Pennsylvanian population but also throughout the species range. In total, only four variable sites constituting six unique haplotypes, three of which vary in exons, were detected from a collection of 20 D. melanogaster sequences. Haplotype diversity was quite low among sequences from the Pennsylvanian population study (H = 0.15) while slightly higher among the worldwide sample (H = 0.25).
Two measures of nucleotide diversity,
and
, were calculated in order to compare the amount of variation found at the tra locus in D. melanogaster with that found in other species, as well as to published values for other loci (table 1). In D. melanogaster, nucleotide diversities from tra are smaller than the average value calculated for a sample of 24 loci reported by Moriyama and Powell (1996) and almost an order of magnitude lower than its ortholog in D. simulans. These differences are observed for both synonymous and replacement sites, as well as noncoding regions of the tra locus. Nucleotide variation is absent in both introns and 3' flanking region and nearly absent in the untranslated region of the male-specific exon (table 1).
|
Nucleotide variation among nine global strains of D. simulans is almost an order of magnitude greater than D. melanogaster at the tra locus and is similar to that reported for other loci from D. simulans (table 1). Haplotype diversity is also high (H = 0.89) compared with D. melanogaster. Four replacement and 12 synonymous polymorphic sites were found in the coding region. Singletons made up almost half of the total polymorphic sites.
The nucleotide diversity of tra is also relatively high in D. mauritiana (table 1). A total of 13 variable sites were distributed among four sequences and each sequence sampled represented a unique haplotype (H = 1.0). Variability is comparable between exonic versus intronic regions, except for the complete absence of substitutions in the 3' flanking region, which was common to all species sampled. In the coding regions, four replacement and four synonymous polymorphisms were observed. Compared with the overall level of coding region variation observed from four other loci sequenced in D. mauritiana, tra locus diversity is significantly higher (P < 0.01) than the species average. This is entirely due to the excess of replacement polymorphismsnonsynonymous diversity is almost an order of magnitude greater in tra compared with other D. mauritiana loci. In contrast, among four lines of D. sechellia, only one polymorphism was observed. This replacement singleton is situated in one of the tandem repeats unique to D. sechellia. The low level of polymorphism found at this locus, however, was statistically no different (P > 0.10) from levels found at other sequenced loci in D. sechellia such as asense, period, yp2, and zeste (table 1).
We further examined whether within and between species variation adheres to a neutral model. According to neutral expectations, similar dN/dS ratios should be found within and between species (McDonald and Kreitman 1991). In all cases, we did not detect any deviation from this expectation among species of the D. melanogaster complex (data not shown). Neutrality was not rejected even in pairwise species comparisons involving D. mauritiana which possessed a higher within-species dN/dS ratio (four replacement versus four synonymous polymorphisms, table 1). HKA tests, which simply compare within versus between species variation (Hudson, Kreitman, and Aguadé 1987), also failed to reject a neutral model with one exception. Only D. melanogaster revealed significant differences between expectations based on polymorphism and divergence. Using the complete D. melanogaster data set (N = 20 sequences) against a consensus D. simulans sequence, HKA tests revealed significant differences in both silent site comparisons (
2 = 4.36, P = 0.04) and total site comparisons (
2 = 5.36, P = 0.02).
Divergence and Constraints Among Species of the melanogaster Subgroup
Out of 16 loci which have been sequenced in all four species of the D. melanogaster complex (Supplementary Material), tra ranked second (after Acp26Aa) in average amino acid divergence, dN, between D. melanogaster and its three sibling species. Synonymous divergence, dS, on the other hand, ranked fifth. In terms of species pair divergence between the three sibling species of the D. simulans clade, D. sechellia, and D. mauritiana possessed the greatest differences (six fixed silent and six fixed replacement differences), particularly in nonsynonymous substitutions. The D. simulansD. mauritiana comparison reveals a relative deficiency of fixed differences (one fixed silent and one fixed replacement difference) as many of the polymorphisms remain shared between these species. Due to the presence of these shared ancestral polymorphism between D. simulans and D. mauritiana, monophyletic lineages were not statistically supported (data not shown).
The constancy of tra divergence rate between members of this species complex was supported using a codon-based maximum likelihood approach (Yang 1997). Evolutionary models which utilized a molecular clock were not significantly different from models employing free rate parameters between species lineages (table 2). In other words, models which allowed rates to vary between branches did not offer a significant improvement to constant rate models. This was the case whether we used D. erecta or D. melanogaster as the outgroup, or whether we employed representative sequences (N = 4) or all sequences (N = 37) with estimated substitution rate parameters specific (or "local") to each species (table 2). Different topologies were also compared and showed similar results.
|
The parameter
= dN/dS was estimated using a codon-based substitution model and provides evidence that tra's evolution is relatively unconstrained among species of this complex. Only three loci (Acp26Aa, Acp70, and asense) of 16 genes sequenced in all four species of the complex, revealed similar or lower levels of selective constraints (Supplementary Material). Over all tra coding regions,
was estimated as 0.20 (table 2). The inclusion of D. erecta increased
in all evolutionary models, including ones which factored in site and lineage variation. However, these models did not produce significantly better likelihoods. A null constant rate model maximized the likelihood at
= 0.32. To localize the region(s) of the gene with the least selective constraints, we subdivided the coding region into its three exons. Using the four sibling species with or without the inclusion of D. erecta, we found that all exons had moderate functional constraints, with exons 2 and 3 bearing slightly less constraints (table 2).
Duplications and Protein Size Evolution
TRA has dramatically diverged in size between the D. melanogaster sibling species. These differences in amino acid sequence lengtha fixed 13amino acid duplication in D. melanogaster as well as a 74amino acid duplication in D. sechelliaare shown in figure 2. One interesting feature is that both species-specific sets of repeats are tandemly arranged, suggesting common mechanisms of origin. The 222-bp duplication in D. sechellia corresponds to a region near the N-terminus, and both repeats lie adjacent to each other. Immediately 3' to D. sechellia's second repeat are D. melanogaster's two tandemly arranged repeats (fig. 2). Another feature of interest is that each of the inserts contains regions that code for arginine-serine (RS) domains. One such domain is found in the D. melanogaster duplication, whereas in D. sechellia, two large RS-rich regions are found (fig. 3). In both cases, basic amino acid regions are also present (fig. 3).
|
|
Distribution of Variable Sites and Substitution Rates
Amino acid variation among species of the D. melanogaster complex appear to be clustered in regions near the RS domains and in a C-terminal segment of the coding region (fig. 2). To test if replacement substitutions are randomly distributed, we used the broken stick model of Goss and Lewontin (1996). The distribution of amino acid sites that are variable within the D. melanogaster complex is significantly nonrandom using two of the statistics recommended by Goss and Lewontin (table 3). On the other hand, when D. erecta is included with the four sibling species, the distribution of variable amino acid sites is not significantly different from random expectations (table 3). In contrast to replacement sites, variable synonymous sites are not distributed significantly different from random expectations, with or without the inclusion of D. erecta sequence.
|
While the broken stick model simply tests the observed distribution of variable sites against a random distribution, a sliding window permutation analysis identifies the regions that significantly differ in substitution rate (Hartmann and Golding 1998). Using either nondegenerate nucleotide sites (n = 333 bp) or a data set with first and second codon positions (n = 364 bp), only one region possessed a significantly different substitution rate (N = 37 sequences, P > 0.05). This region included several windows of moderate size (<20 nucleotides), all of which spanned the cluster of substitutions surrounding the putative D. sechellia insertion site (open box in fig. 2). Similar results were obtained either using topologies with interspersed sequences of D. mauritiana and D. simulans or by constraining each species to have a monophyletic origin. When data sets with only third positions sites (n = 183 bp) or all coding sites (n = 549 bp) were applied, there appeared no regions with significantly different substitution rates.
Rate heterogeneity among sites was also supported using maximum likelihood and a codon-based substitution model (Yang 1997). These analyses differ from the previous broken stick and permutation tests as they test for differences in substitution rate between codon sites as opposed to the regional clustering of substitutions. We observed that a model which incorporated rate heterogeneity between sites (allowing for three separate categories of substitution rates for the discrete-gamma distribution) fit the data significantly better than a model that used a single category of substitution rate when tested on these four species (2
l = 10.6, P < 0.01). When tra was subdivided into its exons, the second exon alone gave significant results (table 2). Using all available tra sequences (N = 37) from the melanogaster subgroup, it was found that a variable dN/dS between sites model produced a significantly better likelihood (2
l = 37.7, P < 0.01) (table 3).
The observed heterogeneity of substitution rate may be specific to members of the D. melanogaster complex since when D. erecta sequence is included, rate heterogeneity no longer significantly improves the likelihood (table 2). It also appears evident from the transformer protein sequence alignment of these five species, that regions which appear well conserved in the D. melanogaster complex have been substituted in the D. erecta protein (fig. 2). This does not mean, however, that these regions are not constrained. In fact, substitutions in the C-terminal segment for which amino acid variability was not found within the D. melanogaster species clade are relatively conservative amino acid replacements in D. erecta (see fig. 2), suggesting that it may represent a functionally important domain.
| Discussion |
|---|
|
|
|---|
Evolution of tra in the melanogaster Subgroup
Compared with other loci sequenced among species of the D. melanogaster complex (Moriyama and Powell 1996; Kliman et al. 2000; Supplementary Material), transformer is highly variable. Previous studies on tra variation have suggested both selective (Walthour and Schaeffer 1994) and neutral (McAllister and McVean 2000) modes of evolution. Our findings generally support a high rate of neutral evolution among these sibling species and furthermore direct our attention to regions within the tra locus, which may be under higher rates of neutral mutation.
Sibling species of the D. melanogaster species complex offer an attractive model system, as many loci have been surveyed for both polymorphism and divergence and each species' effective population size has been satisfactorily estimated (Kliman et al. 2000). Sequence variation at the tra locus in the two sibling species D. simulans and D. mauritiana revealed relatively high levels of polymorphism consistent with other conspecific loci. The low diversity found in D. sechellia supports previous studies, indicating that it has a small effective population size (Hey and Kliman 1993; Kliman et al. 2000). This finding is consistent with the discovery of a large nucleotide insertion in the coding region of D. sechellia, which suggests that tra can accommodate major changes in protein structure. The insertion in D. sechellia may be mildly deleterious in its effect on fitness, as such mutations are more likely to be fixed due to increased drift in species with small population sizes (Ohta 1973).
But while the divergence of tra in this species subgroup reveal features consistent with a neutral model and low functional constraint, how do we explain the reduced variation in D. melanogaster? Our results confirm that tra has low levels of polymorphism, relative to other conspecific loci, across a global sample of D. melanogaster, and HKA tests performed on species-wide variation suggest a nonneutral model of evolution, consistent with Walthour and Schaeffer's (1994) previous results. In fact, the recombinational landscape in D. melanogaster, D. simulans, and D. mauritiana correlates rather well to the observed levels of species diversity at the tra locus, consistent with the presence of a recent selective sweep (or alternatively background selection). True, Weir, and Laurie (1996) compared rates of recombination between these three species and found high and almost equivalent coefficient of exchanges in D. mauritiana and D. simulans (
0.1). D. melanogaster exhibited a so-called "centromere effect," whereby a suppression of crossovers takes place around the centromere and decreases with cytological distance. In the region of the third chromosome where tra resides, recombination rate in D. melanogaster was shown to be an order of magnitude lower than its siblings, D. simulans and D. mauritiana (True, Weir, and Laurie 1996). Any effect of selection (either positive or negative) will be more evident in D. melanogaster, where recombination is lower (Hill and Robertson 1966; Charlesworth, Morgan, and Charlesworth 1993; Hudson and Kaplan 1995).
While tra variation within D. melanogaster is unusually low, phylogenetic tests using all four species of the D. melanogaster complex suggest a neutral mechanism of change. In the D. virilis/D. americana subgroup, McAllister and McVean (2000) demonstrated rapid yet neutral evolution of the tra locus. In addition, using three representative sequences of D. melanogaster, D. simulans, and D. erecta, they found their divergence to be consistent with a molecular clock. With the inclusion of the two sibling species D. mauritiana and D. sechellia, as well as a D. simulans sequence that is noticeably different from the previously published sequence (see Materials and Methods), we too show that species of this subgroup evolve in a clocklike manner. These sibling species diverged from D. melanogaster within the last 3 Myr and from a D. simulans common ancestor within the last 0.5 Myr (Kliman et al. 2000). However, we note that while it has been argued that violations of the molecular clock assumption may provide evidence for lineage-specific selection (Yang and Nielsen 1998), its corollary may not necessarily be correct (i.e., a clocklike substitution rate may not necessarily indicate neutral evolution). For example, Acp26Aa, exhibiting the highest nonsynonymous divergence rate among genes that were available from all four species of the D. melanogaster complex (Supplementary Material), also reveals a clocklike evolutionary rate. Yet positive selection has been found to act on this locus using standard tests of neutrality (Aguadé 1998; Tsaur, Ting, and Wu 1998). Furthermore, significant heterogeneity between sites also suggests positive selection among regions of the Acp26Aa locus (Supplementary Material). Therefore, tra's rapid and clocklike behavior in both the melanogaster and the virilis subgroups (McAllister and McVean 2000) may indicate the constant fixation of neutral substitutions or, alternatively, the constant fixation of advantageous alleles acting in each of these lineages. McDonald-Kreitman and HKA tests of selective neutrality generally corroborate the former hypothesis. These results emphasize the need to utilize both within and between species studies of variation when inferring the action of natural selection or genetic drift.
Rapid Evolution and the Nature of Constraints on RS Domains
TRA is highly diverged not only between sibling species of the D. melanogaster complex but also throughout the genus Drosophila. So, why does this key developmental gene appear to lack the strong selective constraints typical among other developmental loci? And what is the significance of insertions within the melanogaster subgroup that appear to maintain the total proportion of RS domains (fig. 3)? One explanation is that only certain regions of this locus are required for proper functioning, and all other regions evolve under reduced selective constraints. Our results suggest that much of this protein is evolving relatively unhampered while maintaining a certain fraction of RS domains.
TRA is part of a protein family containing arginine-rich and serine-rich (RS) domains. These SR proteins are involved in spliceosome assembly and the regulation of alternative splicing (Fu 1995). Specifically, RS domains are thought to help bridge 5' and 3' splice sites in premRNA transcripts by interacting with other SR proteins (Fu 1995). In Drosophila sex determination, TRA interacts with another SR protein, TRA-2, to form part of the spliceosome complex (Hoshijima et al. 1991). If RS domains (i.e., protein regions with a high concentration of arginine-serine dipeptides) used for spliceosome recruitment represent the major functional part of the protein, it may not be surprising that TRA has undergone high rates of neutral evolution. Domain-swap experiments have demonstrated the exchangeability of loosely conserved TRA RS domains between different SR proteins as well as between distantly related orthologs. For example, RS domains from the suppressor-of-white-apricot protein can be substituted by TRA RS domains to yield partial function (Li and Bingham 1991). In another experiment, SXL, which acts as a splicing suppressor in Drosophila sex determination, was transformed into a splicing activator by the addition of RS domains from another SR protein, U2AF (Valcárcel et al. 1993). Finally, in a transgenic experiment with tra, O'Neil and Beloté (1992) transferred the wild type tra gene of D. virilis to D. melanogaster by P-element mediated germ line transformation. The much diverged D. virilis gene was capable of shifting male structures in D. melanogaster flies, which were chromosomally female but homozygous for a tra deletion, towards femaleness.
While most of the tra locus is practically unalignable between both Drosophila and Sophophoran subgenera (O'Neil and Beloté 1992; McAllister and McVean 2000), the presence of RS domains remains conserved. We have compared the numbers and concentration of RS amino acid dipeptides between species of Drosophila (fig. 3) and show that a fraction of the protein has been maintained to consist of domains of RS dipeptides. The fraction of RS dipeptides ranges from 10.9% in D. hydei (fig. 3) to 19.2% in D. melanogaster (fig. 2). Even with the large insertions in the D. melanogaster species complex, the proportion of RS domains remains relatively similar and ranges between 14.6% and 19.2%. Thus, the basic functional requirements of TRA may be fulfilled if at least 10% to 20% of its protein remain RS dipeptides, allowing a large remainder to be functionally unconstrained and amenable to rapid evolutionary change. This, of course, may be an oversimplification as the location of these RS domains, as well as basic amino acid domains, may also prove to be important. Rooney, Zhang, and Nei (2000) demonstrated a similar phenomenon in primate protamines, whereby the proportion of arginine residues, important for DNA binding, remains conserved across distant taxa.
Different species lineages appear to exhibit different selective constraints. In other words, regions of the tra locus possess varying levels of purifying selection that are lineage-specific. When D. erecta, a species that diverged from the D. melanogaster lineage between 10 and 15 MYA, is included in either the broken stick or maximum likelihood heterogeneity tests, heterogeneity in the distribution of replacement substitutions and substitution rate, respectively, is not statistically supported (tables 2 and 3). Although many of the amino acid substitutions between D. erecta and its sister species are conservative in nature, they nevertheless suggest that different selective constraints may be acting in both lineages. The inclusion of D. erecta in analyses that test for the random distribution of replacement sites and rate heterogeneity between sites contrasts similar analyses in the subgenus DrosophilaD. virilis' inclusion produces an even more significant nonrandom effect (table 3). This contrast does not appear to be the result of a difference in statistical power since both subgenera possess similar amounts of replacement changes (table 3). Other evidence which may indicate that functional constraints have evolved in a lineage-specific manner concern the particular regions of conserved versus low constraints. In the subgenus Drosophila, McAllister and McVean (2000) found a very high dN/dS ratio in the third exon of D. americana and D. virilis lineages (dN/dS = 1.19) but a very low ratio in D. hydei lineages (dN/dS = 0.01) and a more moderate ratio (similar to the melanogaster subgroup) in the second exon (dN/dS = 0.31). Interestingly, RS domains are not found in the third exon and may indicate differences in purifying selection among the basic amino acid domains (fig. 3). Differences in selective constraint in exon 1 were also evident between these two lineages. In contrast, our results show that among species of the D. melanogaster complex, selective constraints were equally moderate in the second and third exons (dN/dS = 0.24). The presence of varying selective constraints in tra orthologs may ultimately affect the affinity of their RS domains to regulate splicing. This affinity may be affected by conformational changes in the protein structure or by direct changes to the RS domains themselves. Differences in the size of these RS domains are also apparent and may provide a mechanism for the net loss or gain of other such domains in the protein. For example, D. hydei (the species with the lowest fraction of RS dipeptides) possesses a relatively large consecutive run of RS dipeptides (fig. 3) possibly reducing the selective constraints in other RS-rich regions of the protein.
We must also remark that the size and nature of the repeats found at the tra locus are unprecedented in this species clade. Not only are the lengths of these tandem duplications relatively large (39 and 222 bp in D. melanogaster and D. sechellia, respectively) compared with the overall size of the protein but also that these two tandem duplications are situated directly adjacent to each other (fig. 2). Another interesting property of these repeats is the apparent correlation between repeat structure and rapid divergence. For example, the only region which exhibited significantly higher rates of amino acid substitution is found around the putative D. sechellia insertion site (fig. 2). This region may designate a mutational hotspot for both nonsynonymous substitutions and duplications in these closely related species, thus providing a nonselective causal mechanism for rapid evolutionary change. A similar correlation between repeat structure and rapid divergence is also observed at the tra locus in the subgenus Drosophilaa series of indel polymorphisms are found among D. americana sequences within its largest RS domain (data not shown). This correlation between repeated sequences and faster rates of evolution may be part of a general pattern of divergence (Huntley and Golding 2000).
Rapid Evolution of a Key Developmental Regulator of Sexual Dimorphism
While the relationship between development and evolution is a central theme in evolutionary biology, there exists an unfortunate lack of variational studies on early acting ontogenetic genes (Richter et al. 1997). This study attempts to address this concern by examining the rapid evolution of a gene from a well-characterized early acting developmental pathway that controls sexual identity. TRA is involved in the regulation of somatic sexual differentiation in females by binding (with TRA2 and other spliceosome proteins) to regulatory elements in doublesex and fruitless (Hoshijima et al. 1991; Steinmann-Zwicky 1994), and it indirectly controls aspects of female sexual differentiation, including all somatic and behavioral components (i.e., Ferveur et al. 1997; Arthur et al. 1998; Gatti, Ferveur, and Martin 2000). Consequently, changes to the transformer protein, particularly in the RS domain's binding affinity, may affect targeted processes of sexual differentiation such as pheromone production, mating behavior, abdominal pigmentation, and bristle number. For example, slight stoichiometric changes in the amount of downstream target transcripts, initiated by amino acid changes in TRA, may affect sex-specific phenotypes. This is consistent with the growing evidence that many reproductive traits are rapidly evolving during the early stages of species divergence (Civetta and Singh 1998; Singh and Kulathinal 2000).
The rapid divergence of this essential developmental gene among sibling species may present another facet in our understanding of early species divergence. We suggest that random genetic drift serves to quickly change much of tra's protein structure and over time, accumulated change may induce various nonneutral effects on downstream targets. Therefore, rapid TRA divergence through neutral drift may contribute to the considerable variation found among Drosophila mating systems. The transgenic experiment of O'Neil and Beloté (1992), which restored only partial sexual function, is consistent with the idea that slight changes in TRA structure may affect a cascade of sexual traits. It remains an intriguing possibility that the rapid evolution of transformer may indirectly contribute to important species differences in Drosophila.
| Supplementary Material |
|---|
|
|
|---|
All new transformer species/strain sequences presented in this paper are found in GenBank under accession numbers, AY183382 to AY183407. A table summarizing a set of evolutionary analyses on genes sequenced among all four species of the D. melanogaster complex is provided on this journal's Web site.
| Acknowledgements |
|---|
|
|
|---|
This work was financially supported by the Natural Sciences and Engineering Research Council of Canada.
| Footnotes |
|---|
Pierre Capy, Associate Editor
E-mail: rkulathinal{at}oeb.harvard.edu. ![]()
| Literature Cited |
|---|
|
|
|---|
Aguadé, M. 1998. Different forces drive the evolution of the Acp26Aa and Acp26Ab accessory gland genes in the Drosophila melanogaster species complex. Genetics 150:1079-1089.
Arthur, B. I., J. M. Jallon, B. Caflisch, Y. Choffat, and R. Nothiger. 1998. Sexual behaviour in Drosophila is irreversibly programmed during a critical period. Curr. Biol. 8:1187-1190.[CrossRef][Web of Science][Medline]
Burtis, K. C., and B. S. Baker. 1989. Drosophila doublesex gene controls somatic sexual differentiation by producing alternatively spliced mRNA's encoding related sex-specific polypeptides. Cell 56:997-1010.[CrossRef][Web of Science][Medline]
Chan, Y. M., and Y. N. Jan. 1999. Conservation of neurogenic genes and mechanisms. Curr. Opin. Neurobiol. 9:582-588.[CrossRef][Web of Science][Medline]
Charlesworth, B., M. T. Morgan, and D. Charlesworth. 1993. The effect of deleterious mutations on neutral molecular variation. Genetics 134:1289-1303.[Abstract]
Civetta, A., and R. S. Singh. 1998. Sex and speciation: genetic architecture and evolutionary potential of sexual versus non-sexual traits in the sibling species of the Drosophila melanogaster complex. Evolution 52:1080-1092.[CrossRef]
Felsenstein, J. 1993. PHYLIP (phylogeny inference package). Version 3.5. Distributed by the author, Department of Genetics,. University of Washington, Seattle.
Ferveur, J.-F., F. Savarit, C. J. O'kane, G. Sureau, R. J. Greenspan, and J.-M. Jallon. 1997. Genetic feminization of pheromones and its behavioural consequences in Drosophila males. Science 276:1555-1558.
Fu, X.-D. 1995. The superfamily of arginine/serine-rich splicing factors. RNA 1:663-680.[Web of Science][Medline]
Gatti, S., J.-F. Ferveur, and J.-R. Martin. 2000. Genetic identification of neurons controlling a sexually dimorphic behaviour. Curr. Biol. 10:667-670.[CrossRef][Web of Science][Medline]
Gloor, G., and W. Engels. 1992. Single-fly preps for PCR. D. I. S. 71:148-149.
Goss, P. J. E., and R. C. Lewontin. 1996. Detecting heterogeneity of substitution along DNA and protein sequences. Genetics 143:589-602.[Abstract]
Gould, S. J. 1977. Ontogeny and phylogeny. Harvard University Press, Cambridge, Mass.
Handa, N., O. Nureki, K. Kurimoto, I. Kim, H. Sakamoto, Y. Shimura, Y. Muto, and S. Yokoyama. 1999. Structural basis for recognition of the tra mRNA precursor by the sex-lethal protein. Nature 398:579-585.[CrossRef][Medline]
Hartmann, M., and G. B. Golding. 1998. Searching for substitution rate heterogeneity. Mol. Phylogen. Evol. 9:64-71.[CrossRef][Web of Science][Medline]
Hey, J., and R. M. Kliman. 1993. Population genetics and phylogenetics of DNA sequence variation at multiple loci within the Drosophila melanogaster species complex. Mol. Biol. Evol. 10:804-822.[Abstract]
Hill, W. G., and A. Robertson. 1966. The effect of linkage on limits to artificial selection. Genet. Res. 8:269-294.[Web of Science][Medline]
Hoshijima, K., K. Inoue, I. Higuchi, H. Sakamoto, and Y. Shimura. 1991. Control of doublesex alternative splicing by transformer and transformer-2 in Drosophila. Science 252:8333-8336.
Hudson, R. R., and N. L. Kaplan. 1995. Deleterious background selection with recombination. Genetics 141:1605-1617.[Abstract]
Hudson, R. R., M. Kreitman, and M. Aguadé. 1987. A test of neutral molecular evolution based on nucleotide data. Genetics 116:153-159.
Huntley, M., and G. B. Golding. 2000. Evolution of simple sequence in proteins. J. Mol. Evol. 51:131-140.[Web of Science][Medline]
Inoue K., K. Hoshijima, I. Higuchi, H. Sakamoto, and Y. Shimura. 1992. Binding of the Drosophila transformer and transformer-2 proteins to the regulatory elements of doublesex primary transcript for sex-specific RNA processing. Proc. Natl. Acad. Sci. USA 89:8092-8096.
Kliman, R. M., P. Andolfatto, J. A. Coyne, F. Depaulis, M. Kreitman, A. J. Berry, J. Mccarter, J. Wakeley, and J. Hey. 2000. The population genetics of the origin and divergence of the Drosophila simulans complex species. Genetics 156:1913-1931.
Kliman, R. M., and J. Hey. 1993. Reduced natural selection associated with low recombination in Drosophila melanogaster. Mol. Biol. Evol. 10:1239-1258.[Abstract]
Kreitman, M., and R. R. Hudson. 1991. Inferring the evolutionary histories of the Adh and Adh-dup loci in Drosophila melanogaster from patterns of polymorphism and divergence. Genetics 127:565-582.[Abstract]
Li, H., and P. M. Bingham. 1991. Arginine/serine-rich domains of the su(wa) and tra RNA processing regulators target proteins to a subnuclear compartment implicated in splicing. Cell 67:335-342.[CrossRef][Web of Science][Medline]
McAllister, B. F., and G. A. McVean. 2000. Neutral evolution of the sex-determining gene transformer in Drosophila. Genetics 154:1711-1720.
Mcdonald, J. H., and M. Kreitman. 1991. Adaptive protein evolution at the Adh locus in Drosophila. Nature 351:652-654.[CrossRef][Medline]
Moriyama, E. N., and J. R. Powell. 1996. Intraspecific nuclear DNA variation in Drosophila. Mol. Biol. Evol. 13:261-277.[Abstract]
Nei, M. 1987. Molecular evolutionary genetics. Columbia University Press, New York.
Nei, M., and T. Gojobori. 1986. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 3:418-426.[Abstract]
Nusslein-Volhard, C. 1994. Of flies and fishes. Science 266:572-574.
Ohta, T. 1973. Slightly deleterious mutant substitutions in evolution. Nature 246:96-98.[CrossRef][Medline]
O'Neil, M. T., and J. M. Beloté. 1992. Interspecific comparison of the transformer gene of Drosophila reveals an unusually high degree of evolutionary divergence. Genetics 131:113-128.[Abstract]
Patel, N. H. 1994. Developmental evolution: insights from studies of insect segmentation. Science 266:581-590.
Richter, B., M. Long, R. C. Lewontin, and E. Nitasaka. 1997. Nucleotide variation and conservation at the dpp locus, a gene controlling early development in Drosophila. Genetics 145:311-323.[Abstract]
Rooney, A. P., J. Zhang, and M. Nei. 2000. An unusual form of purifying selection in a sperm protein. Mol. Biol. Evol. 17:278-283.
Rozas, J., and R. Rozas. 1997. dnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15:174-175.
Ryner, L. C., S. F. Goodwin, D. H. Castrillon, A. Anand, A. Villella, B. S. Baker, J. C. Hall, B. J. Taylor, and S. A. Wasserman. 1996. Control of male sexual behavior and sexual orientation in Drosophila by the fruitless gene. Cell 87:1079-1089.[CrossRef][Web of Science][Medline]
Singh, R. S., and R. J. Kulathinal. 2000. Sex gene pool evolution and speciation: a new paradigm. Genes Genet. Syst. 75:119-130.[CrossRef][Web of Science][Medline]
Sosnowski, B. A., J. M. Beloté, and M. Mckeown. 1989. Sex-specific alternative splicing of RNA from the transformer gene results from sequence-dependent splice site blockage. Cell 58:449-459.[CrossRef][Web of Science][Medline]
Steinmann-Zwicky, M. 1994. Sex determination of the Drosophila germ line: tra and dsx control somatic inductive signals. Development 120:707-716.[Abstract]
Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.
True, J. R., B. S. Weir, and C. C. Laurie. 1996. A genome-wide survey of hybrid incompatibility factors by the introgression of marked segments of Drosophila mauritiana chromosomes into Drosophila simulans. Genetics 142:819-837.[Abstract]
Tsaur, S.-C., Ting, C.-T., and C.-I. Wu. 1998. Positive selection driving the evolution of a gene of male reproduction, Acp26Aa, of Drosophila: II. Divergence versus polymorphism. Mol. Biol. Evol. 15:1040-1046.[Abstract]
Valcárcel, J., R. Singh, P. D. Zamore, and M. R. Green. 1993. The protein sex-lethal antagonizes the splicing factor U2AF to regulate alternative splicing of transformer pre-mRNA. Nature 362:171-175.[CrossRef][Medline]
Walthour, C. S., and S. W. Schaeffer. 1994. Molecular population genetics of sex determination genes: the transformer gene of Drosophila melanogaster. Genetics 136:1367-1372.[Abstract]
Watterson, G. A. 1975. On the number of segregating sites in genetical models without recombination. Theor. Popul. Biol. 7:256-276.[CrossRef][Web of Science][Medline]
Yang, Z. 1997. PAML: a program package for phylogenetic analysis by maximum likelihood. CABIOS 13:555-556.
Yang, Z., and R. Nielsen. 1998. Synonymous and nonsynonymous rate variation in nuclear genes of mammals. J. Mol. Evol. 46:409-418.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
M. Telonis-Scott, A. Kopp, M. L. Wayne, S. V. Nuzhdin, and L. M. McIntyre Sex-Specific Splicing in Drosophila: Widespread Occurrence, Tissue Specificity and Evolutionary Conservation Genetics, February 1, 2009; 181(2): 421 - 434. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pane, A. De Simone, G. Saccone, and C. Polito Evolutionary Conservation of Ceratitis capitata transformer Gene Function Genetics, October 1, 2005; 171(2): 615 - 624. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jagadeeshan and R. S. Singh Rapidly Evolving Genes of Drosophila: Differing Levels of Selective Pressure in Testis, Ovary, and Head Tissues Between Sibling Species Mol. Biol. Evol., September 1, 2005; 22(9): 1793 - 1801. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




