Skip Navigation


MBE Advance Access originally published online on March 5, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
20/3/388    most recent
msg058v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (42)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Burzynski, A.
Right arrow Articles by Wenne, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burzynski, A.
Right arrow Articles by Wenne, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Mol. Biol. Evol. 20(3):388-392. 2003
DOI: 10.1093/molbev/msg058
© 2003 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038

Evidence for Recombination of mtDNA in the Marine Mussel Mytilus trossulus from the Baltic

Artur Burzynski*,, Malgorzata Zbawicka*, David O. F. Skibinski{dagger} and Roman Wenne*

* Polish Academy of Sciences, Institute of Oceanology, Department of Genetics and Marine Biotechnology, Gdynia, Poland
{dagger} School of Biological Sciences, University of Wales Swansea, Swansea, United Kingdom


    Abstract
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Literature Cited
 
A number of studies have claimed that recombination occurs in animal mtDNA, although this evidence is controversial. Ladoukakis and Zouros (2001) provided strong evidence for mtDNA recombination in the COIII gene in gonadal tissue in the marine mussel Mytilus galloprovincialis from the Black Sea. The recombinant molecules they reported had not however become established in the population from which experimental animals were sampled. In the present study, we provide further evidence of the generality of mtDNA recombination in Mytilus by reporting recombinant mtDNA molecules in a related mussel species, Mytilus trossulus, from the Baltic. The mtDNA region studied begins in the 16S rRNA gene and terminates in the cytochrome b gene and includes a major noncoding region that may be analogous to the D-loop region observed in other animals. Many bivalve species, including some Mytilus species, are unusual in that they have two mtDNA genomes, one of which is inherited maternally (F genome) the other inherited paternally (M genome). Two recombinant variants reported in the present study have population frequencies of 5% and 36% and appear to be mosaic for F-like and M-like sequences. However, both variants have the noncoding region from the M genome, and both are transmitted to sperm like the M genome. We speculate that acquisition of the noncoding region by the recombinant molecules has conferred a paternal role on mtDNA genomes that otherwise resemble the F genome in sequence

Key Words: mtDNA recombination • Mytilus • D-Loop • DUI


    Introduction
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Literature Cited
 
In 1999, two papers suggested the possibility of recombination in human mtDNA (Awadalla, Eyre-Walker, and Maynard Smith 1999; Eyre-Walker, Smith, and Maynard Smith, 1999), thus challenging the paradigm that the inheritance of mtDNA is entirely clonal. Evidence for recombination has also been obtained in other clonal DNAs, for example chloroplast DNA (Marshall, Newton, and Ritland 2001). Patterns of variation produced by recombination can be similar to those resulting from recurrent mutation (McVean, Awadalla, and Fearnhead 2002) and there has been considerable debate on the subject in relation to both humans and other animals (e.g., Eyre-Walker 2000; McVean 2001). Recombination of mtDNA, and its detection, would be facilitated in circumstances where individuals are heteroplasmic and mtDNA is inherited paternally as well as maternally (Eyre-Walker 2000). These conditions are found in the mussel families Mytilidae and Unionidae, as well as in clams from the Veneridae family. Two mtDNA genomes, denoted F and M, are transmitted through the female and male lines of descent, respectively. Males are usually heteroplasmic for both genomes, whereas females are homoplasmic for the F genome (Skibinski, Gallagher, and Beynon 1994; Zouros et al. 1994; Stewart et al. 1995; Liu, Mitton, and Wu 1996; Passamonti and Scali 2001). The two genomes can show sequence divergence of 20% or more (Hoeh et al. 1997). There is evidence that F genomes can invade the M transmission route and replace the previous M genome (Hoeh et al. 1997). The consequence of this "role-reversal" is that the M-F sequence divergence is set to zero.

Using PCR amplification of a segment of the COIII gene, Ladoukakis and Zouros (2001) exploited this situation and demonstrated the existence of recombinant molecules within the gonadal tissue of heteroplasmic male Mytilus galloprovincialis from the Black Sea. It seemed likely that the recombinant molecules originated recently, perhaps within the individuals from which they were recovered. They were absent from the populations studied, and their relative fitnesses were not ascertained. The heteroplasmic males studied by Ladoukakis and Zouros (2001) were atypical in that the nonrecombinant genomes present were not as highly diverged as typical F and M genomes, and thus the M genomes were assumed to be recently role-reversed. It was suggested that the consequent lower sequence divergence was high enough to facilitate the detection of recombinant molecules but low enough to suppress mismatch repair to a level that did not inhibit homologous recombination. Males of Mytilus trossulus from the Baltic Sea are also heteroplasmic for two genomes that are not as highly diverged as typical F and M genomes (Wenne and Skibinski 1995), and evidence for role reversal has been obtained (Quesada, Wenne, and Skibinski 1999).

In the present study, we demonstrate the existence of two recombinant mtDNA variants from within the noncoding region of M. trossulus. The variants, derived from homoplasmic sperm samples, are at polymorphic frequencies within the Baltic population studied and behave as M genomes.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Literature Cited
 
Samples of the mussel M. trossulus were collected from the Gulf of Gdansk in the southern Baltic. Mussels were sexed by microscopic examination of mantle tissue, and DNA was isolated from eggs (for the F genome) or sperm (for the recombinant genomes). An M genome sequence was obtained from sperm from a Mytilus edulis individual from Swansea Bay in South Wales. Gametes were obtained by vigorous washing of the mantle cavity with sterile seawater and pelleted by centrifugation at 500 g. They were then suspended in STE100 buffer (0.1M NaCl, 1 M EDTA, 0.05 M Tris-HCl, pH 8.0) and lysed with 0.3% SDS and 300 µg/ml proteinase K at 56°C overnight. Total DNA was obtained using phenol/chloroform extraction followed by ethanol precipitation. Purified DNA was suspended in TE buffer (1 mM EDTA, 0.01 M Tris-HCl, pH 8.0) at approximately 10 µg/ml.

Primers suitable for amplification of the major noncoding region from Mytilus were designed using the M. edulis sequence obtained by Hoffman, Boore, and Brown (1992) (GenBank accession number M83756). The forward primer (CBM1) was AGAACGGCGTGAGCTAGTTC (16S rRNA gene, nucleotide positions 3313 to 3332), the reverse primer (CBM2) sequence was ACCTTCACCAGGCGTTTAAG (cytochrome b gene, nucleotide positions 4833 to 4814). For checking for presence of the M genome characteristic of M. edulis, the specific primers M1 (AAACCCTTCGTCCACAAGG) and M2 (AGCCTTTTTGTCATCATTCTGT) were used. Approximately 20 ng of total DNA was used for PCR amplifications, which were carried out in a volume of 20 µl with primers at 0.4 µM, nucleotides at 200 µM, magnesium chloride at 1.5 mM, high fidelity DyNAzyme EXT2 DNA polymerase (0.5 U), and appropriate reaction buffer from Finnzymes. Thirty-three cycles were used with denaturation at 94°C (for 1 min, but 3 min for first cycle), annealing at 54°C, 30 s, and extension at 72° C for 1 min 30 s (but 5 min for the last cycle).

Selected PCR products were purified by alkaline phosphatase (shrimp alkaline phosphatase from Amersham) and exonuclease I (USB) treatment (1/13 U/µl SAP along with 20/13 U/µl exonuclease I for 45 min at 37°C followed by enzyme inactivation at 80°C for 15 min) and sequenced directly with BigDye kit from PE Applied Biosystems using the above PCR primers as first run sequencing primers. Sequencing reactions were resolved on an ABI 310 genetic analyzer or ABI 377 sequencer (both from PE). New primers were designed based on the sequences obtained and used in additional sequencing runs in order to obtain the full sequence of each PCR product. The SeqManII program from DNASTAR Lasergene facilitated sequence assembly. Sequences alignments were made using ClustalW (Higgins, Thompson, and Gibson 1996). All sequences obtained have been deposited in GenBank (accession numbers AY115479 to AY115482). Nucleotide diversity between sequences was calculated using DnaSP version 3.53 (Rozas and Rozas 1999). The Kimura two-parameter distance between sequences and the UPGMA trees were calculated using MEGA2 version 2.1 (Kumar et al. 2001). Statistical analysis of potential recombined fragments was performed by runs tests implemented in GENECONV version 1.81 (http://www.math.wustl.edu/~sawyer) (Sawyer 1989).


    Results and Discussion
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Literature Cited
 
The major noncoding region has previously been amplified in a sample of 400 M. trossulus from the Gulf of Gdask (Zbawicka, Skibinski, and Wenne 2003). A number of length variants were detected. Two of these, designated 1 and 1a, occurred in 5% and 36% of male mussels, respectively. Comparisons of variants present in somatic tissue and gametes demonstrated that the 1 and 1a variants behave like the M genome in M. edulis, that is, they are present only in heteroplasmic males and are always transmitted to sperm.

The present study considers the 1 and 1a variant molecules in an attempt to detect recombination. Genomes that occur in heteroplasmic males are the natural candidates for the detection of recombinant events. However, the possibility that strand switching during PCR amplification of heteroplasmic DNA might generate artifactual recombinant molecules should be considered. That variants 1 and 1a are such artifacts seems most unlikely for several reasons. First, Ladoukakis and Zouros (2001) provided direct evidence against artifacts by cloning of PCR product molecules from artificially heteroplasmic targets. Second, the sperm DNA samples used in the present study were observed to be homoplasmic, giving only a single PCR product. Even if there was some minor somatic contamination, the use of such samples reduces the possibility of artifacts arising from recombinational events within the PCR reaction, compared with the use of heteroplasmic somatic DNA. Finally, identical strand switching events would need to be postulated to repeatedly generate only variants 1 and 1a, in circumstances in which a hypothetical parental molecule within the PCR mix was not itself amplified.

One copy of each of the 1 and 1a variants was sequenced. In addition, the same primers were used to amplify and sequence the major noncoding region of the F genome (from eggs of an M. trossulus female) and the M genome (from sperm of an M. edulis male). The M. edulis M specific M1 and M2 primers failed to detect the M genome in M. trossulus. Pairwise dotplot comparisons of the 1 and 1a variants with both F and M sequences are shown in figure 1. It is clear that different regions of the 1 and 1a variants have differential similarity to the F and M sequences. A global alignment of all four sequences was constructed. Nucleotide diversity was used as a measure of genetic divergence between pairs of sequences: F versus M, F versus 1, F versus 1a, 1 versus M, and 1a versus M. Estimates were made over the whole alignment in a sliding window of 50 bp (fig. 2A). Four regions were selected for further analysis: a 5' flank comprising the very end of rRNA gene and the beginning of noncoding region (1 to 223), a middle region showing the highest M versus F divergence (376 to 786), a core that was quite highly conserved among all sequences (786 to 1191), and a 3' coding region having a complete tRNATyr gene and the beginning of the cytochrome b gene (1289 to 1456). The dotplot analysis (fig. 1) suggests that the segment between the 5' flank and middle region in variant 1 has high homology with a region in the vicinity of the tRNATyr gene of the M sequence; there are only three nucleotide differences over an aligned region of 42 bp. For this reason, the fragment (224 to 376) was excluded. Between the core and the 3' coding regions the M sequence has a 70 bp deletion not shared by any other sequence. Hence this region was also excluded.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1. DotPlot comparisons of 1 (upper row) and 1a (lower row) variants with F (left column) and M (right column) sequences. A window of 15 bp and similarity threshold of 80% are used

 


View larger version (17K):
[in this window]
[in a new window]
 
FIG. 2. (A) F and M sequences and variants 1 and 1a were aligned using ClustalW. Gap opening and extension penalties were 10 and 0, respectively. Nucleotide diversity between the pairs of sequences, F versus M, F versus 1, F versus 1a, 1 versus M, and 1a versus M, are given for a sliding window of 50 bp. Diversity is plotted as a positive value for F sequence comparisons and a negative value for M sequence comparisons. For symmetry, M versus F is shown as the inverse of F versus M. (B) Unrooted UPGMA trees of the four sequences, relating the 5' flank, middle, core, and 3' coding regions computed from Kimura two-parameter distances. (C) Schematic representation of the alignment showing regional similarities to the F and M genomes. The thick boxes represent regions of similarity to the M genome (black indicates distance from F > 0.1) and F genome (open indicates distance from M > 0.1), respectively. The thin boxes represent regions with distances less than 0.1 from both sequences. Regions with comparable similarity to both F and M genomes are indicated in gray

 
Distance values for 5' flank, middle, core, and 3' coding regions were calculated and used to construct UPGMA trees (fig. 2B). Apart from the core region where distances are uniformly low, all the trees have a single long branch, with other branches being relatively short. The differences in tree structure between regions reflect the marked similarity or difference of the 1 and 1a sequences to the other two sequences. Variant 1a and the M sequence are very similar in the 5' flank (d = 0.015 ± 0.009), as are variant 1 and the F sequence (d = 0.020 ± 0.010). In the middle region, the 1 and 1a variants resemble the M genome (d = 0.061 ± 0.025 and 0.084 ± 0.009, respectively) but are divergent from the F genome (d = 0.763 ± 0.082 and 0.793 ± 0.085, respectively). The core part shows very small overall divergence (d in the range of 0.02 to 0.04). In the 3' coding region, the 1 and 1a variants resemble the F genome (d = 0.006 ± 0.006 and d = 0, respectively) but are divergent from the M genome (d = 0.271 ± 0.051 and d = 0.281 ± 0.051, respectively). The tRNATyr gene sequences from 1 and 1a are identical to that from the F sequence and differ from the M sequence. The partial cytochrome b sequences derived from the F genome and the 1 and 1a variants are also identical and quite different from that of the M sequence.

The GENECONV analysis was performed on the global alignment to detect potential recombinant fragments (table 1). The analysis provides good statistical support for the hypothesis that variants 1 and 1a are mosaic, resembling F or M in different regions. The breakpoints suggested by this analysis receive good support statistically and fit well with the regions identified above based on the distance analysis. However, there are some discrepancies. For example, the GENECONV analysis supports a number of fragments that begin or end within the core region. In addition, a nonhomologous exchange would be needed to transfer the short region in the vicinity of the tRNATyr gene from M to variant 1. Taking into account these considerations, the results of the distance analysis, and the GENECONV analysis, a consensus schematic representation of the similarities and differences between the four genomes is given in figure 2C. This indicates that several independent recombination events may have occurred within male lineages of the Baltic M. trossulus mtDNA. To obtain variant 1, a homologous exchange would be needed to replace the middle region of the F genome with that of the M genome. To obtain variant 1a, a homologous exchange would be needed to replace the 5' region of the core of the F genome with that of the M genome. Different recombinational events would be implicated if the ancestral relationships between the genomes were not as assumed above.


View this table:
[in this window]
[in a new window]
 
Table 1 Potential Recombinant Fragments Between Pairs of Sequences.

 
A previous study by Ladoukakis and Zouros (2001) provided direct evidence for homologous recombination in the mtDNA coding region of the COIII gene in the mussel M. galloprovincialis from the Black Sea. In the present study, we report evidence for recombination in a different species of mussel, M. trossulus from the Baltic, and in a different part of the mtDNA molecule, that spanning the major noncoding region. This is a step towards establishing that mtDNA recombination might be a general phenomenon in Mytilus and that recombinational events might not be restricted to particular regions of the molecule. It is questionable whether these results might be considered evidence for mtDNA recombination in general, given current doubts about the existence or prevalence of mtDNA recombination in humans (Eyre-Walker and Awadalla 2001; McVean 2001). The mussel populations examined in these two studies are unusual in that maternal and paternal genomes now diverge in sequence but are not as highly diverged as for example the M and F genomes in the related species M. edulis (e.g., Skibinski, Gallagher, and Beynon 1994), and as Ladoukakis and Zouros (2001) have pointed out, this might facilitate recombination as well as its detection. Clearly, further studies are needed to determine whether there is any causal relationship between recombination and doubly uniparental inheritance of mtDNA generally.

In the study of Ladoukakis and Zouros (2001), recombinants were detected in a high proportion of heteroplasmic individuals studied. The recombinant genomes were produced in individuals heteroplasmic from two variants that had a combined frequency of 0.96 in the Black Sea population. Despite the suggestion of potential for a high rate of production of recombinant molecules, none of those detected had become established in the population or contributed to a high level of population diversity. This could be consistent with the recombinant molecules having relatively lower fitness, but as Ladoukakis and Zouros (2001) point out, more work is required to establish this.

There is evidence of introgression of M. edulis mtDNA into Baltic M. trossulus (Quesada, Wenne, and Skibinski 1995). The M. edulis M genome is however at very low frequency in the Baltic. It thus appears possible from the present study that some genomes produced by recombination between the M. edulis M and F genomes or their descendants in the Baltic have taken over the role as paternal genome. This in turn provides a possible explanation for the polymorphic frequencies of these recombinant genomes.

The noncoding region analyzed in the present study might, by analogy with other animal mtDNAs, contain regulatory sequences, for example, those associated with the initiation of replication. Both the recombinant genomes reported here have the noncoding region derived from the M. edulis M genome rather than from the F genome. RFLP studies of whole mtDNA and PCR amplified segments have shown high similarity of Baltic mtDNA to the M. edulis F rather than M genome (Quesada, Wenne, and Skibinski 1995; Wenne and Skibinski 1995). It is thus possible that this acquisition of the noncoding region by the recombinant molecules has conferred a paternal role on mtDNA genomes that otherwise resemble the F genome in sequence. This would implicate the noncoding region in the maintenance of DUI. Thus, even if recombination is quite frequent in Mytilus, it may not have any phylogenetic consequences unless it involves regulatory elements resulting in the emergence of new paternal lines. Studies of recombination focusing on other regions of the mtDNA as well as the noncoding region are needed to further test these ideas.


    Footnotes
 
E-mail: burzynski{at}cbmpan.gdynia.pl. Back

Fumio Tajima, Associate Editor Back


    Literature Cited
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Literature Cited
 

    Awadalla, P., A. Eyre-Walker, and J. Maynard Smith. 1999. Linkage disequilibrium and recombination in hominid mitochondrial DNA. Science 286:2524-2525.[Abstract/Free Full Text]

    Eyre-Walker, A. 2000. Do mitochondria recombine in humans? Philos. Trans. R. Soc. Lond. B Biol. Sci. 355:1573-1580.[Abstract/Free Full Text]

    Eyre-Walker, A., and P. Awadalla. 2001. Does human mtDNA recombine? J. Mol. Evol. 53:430-435.[CrossRef][Web of Science][Medline]

    Eyre-Walker, A., N. H. Smith, and J. Maynard Smith. 1999. How clonal are human mitochondria? Proc. R. Soc. Lond. B Biol. Sci. 266:477-483.[Medline]

    Higgins, D. G., J. D. Thompson, and T. J. Gibson. 1996. Using Clustal for multiple sequence alignments. Methods Enzymol. 266:383-402.[Web of Science][Medline]

    Hoeh, W. R., D. T. Stewart, C. Saavedra, B. W. Sutherland, and E. Zouros. 1997. Phylogenetic evidence for role-reversals of gender-associated mitochondrial DNA in Mytilus (bivalvia: Mytilidae). Mol. Biol. Evol. 14:959-967.[Abstract]

    Hoffman, R. J., J. L. Boore, and W. M. Brown. 1992. A novel mitochondrial genome organization for the blue mussel Mytilus edulis. Genetics 131:397-412.[Abstract]

    Karlin, S., and S. F. Altschul. 1990. Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proc. Natl. Acad. Sci. USA 87:2264-2268.[Abstract/Free Full Text]

    Kumar, S., K. Tamura, I. B. Jakobsen, and M. Nei. 2001. MEGA2: Molecular evolutionary genetics analysis software. Arizona State University, Tempe.

    Ladoukakis, E. D., and E. Zouros. 2001. Direct evidence for homologous recombination in mussel (Mytilus galloprovincialis) mitochondrial DNA. Mol. Biol. Evol. 18:1168-1175.[Abstract/Free Full Text]

    Liu, H. P., J. B. Mitton, and S. K. Wu. 1996. Paternal mitochondrial DNA differentiation far exceeds maternal mitochondrial DNA and allozyme differentiation in the freshwater mussel, Anadonta grandis grandis. Evolution 50:952-957.[CrossRef][Web of Science]

    Marshall, H. D., C. Newton, and K. Ritland. 2001. Sequence-repeat polymorphisms exhibit the signature of recombination in lodgepole pine chloroplast DNA. Mol. Biol. Evol. 18:2136-2138.[Free Full Text]

    McVean, G. A. T. 2001. What do patterns of genetic variability reveal about mitochondrial recombination? Heredity 87:613-620.[CrossRef][Web of Science][Medline]

    McVean, G. A. T., P. Awadalla, and P. Fearnhead. 2002. A coalescent-based method for detecting and estimating recombination from gene sequences. Genetics 160:1231-1241.[Abstract/Free Full Text]

    Passamonti, M., and V. Scali. 2001. Gender-associated mtDNA heteroplasmy in the venerid clam Tapes philippinarum (Mollusca Bivalvia). Curr. Genet. 39:117-124.[CrossRef][Web of Science][Medline]

    Quesada, H., R. Wenne, and D. O. F. Skibinski. 1995. Differential introgression of mitochondrial DNA across species boundaries within the marine mussel genus Mytilus. Proc. R. Soc. Lond. B 262:51-56.[Abstract/Free Full Text]

    1999. Interspecies transfer of female mitochondrial DNA is coupled with role-reversals and departure from neutrality in the mussel Mytilus trossulus. Mol. Biol. Evol. 16:655-665.[Abstract]

    Rozas, J., and R. Rozas. 1999. DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15:174-175.[Abstract/Free Full Text]

    Sawyer, S. A. 1989. Statistical tests for detecting gene conversions. Mol. Biol. Evol. 6:526-538.[Abstract]

    Skibinski, D. O. F., C. Gallagher, and C. M. Beynon. 1994. Sex-limited mitochondrial-DNA transmission in the marine mussel Mytilus edulis. Genetics 138:801-809.[Abstract]

    Stewart, D. T., C. Saavedra, R. R. Stanwood, R. R. Ball, and E. Zouros. 1995. Male and female mitochondrial DNA lineages in the blue mussel (Mytilus edulis) species group. Mol. Biol. Evol. 12:735-747.[Abstract]

    Wenne, R., and D. O. F. Skibinski. 1995. Mitochondrial DNA heteroplasmy in European populations of the mussel Mytilus trossulus. Mar. Biol. 122:619-624.[CrossRef][Web of Science]

    Zbawicka, M., D. O. F. Skibinski, and Wenne R. 2003. Doubly uniparental transmission of mitochondrial DNA length variants in the mussel Mytilus trossulus Mar. Biol. (in press).

    Zouros, E., A. O. Ball, C. Saavedra, and K. R. Freeman. 1994. An unusual type of mitochondrial DNA inheritance in the blue mussel Mytilus. Proc. Natl. Acad. Sci. USA 91:7463-7467.[Abstract/Free Full Text]

Accepted for publication November 8, 2002.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Biol EvolHome page
A. Burzynski and B. Smietanka
Is Interlineage Recombination Responsible for Low Divergence of Mitochondrial nad3 Genes in Mytilus galloprovincialis?
Mol. Biol. Evol., July 1, 2009; 26(7): 1441 - 1445.
[Abstract] [Full Text] [PDF]


Home page
Proc R Soc BHome page
M. Neiman and D. R Taylor
The causes of mutation accumulation in mitochondrial genomes
Proc R Soc B, April 7, 2009; 276(1660): 1201 - 1209.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Cao, B. S. Ort, A. Mizi, G. Pogson, E. Kenchington, E. Zouros, and G. C. Rodakis
The Control Region of Maternally and Paternally Inherited Mitochondrial Genomes of Three Species of the Sea Mussel Genus Mytilus
Genetics, March 1, 2009; 181(3): 1045 - 1056.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
B. S. Ort and G. H. Pogson
Molecular Population Genetics of the Male and Female Mitochondrial DNA Molecules of the California Sea Mussel, Mytilus californianus
Genetics, October 1, 2007; 177(2): 1087 - 1099.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
I. Theologidis, C. Saavedra, and E. Zouros
No Evidence for Absence of Paternal mtDNA in Male Progeny From Pair Matings of the Mussel Mytilus galloprovincialis
Genetics, June 1, 2007; 176(2): 1367 - 1369.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Burzynski
Two Events Are Responsible for an Insertion in a Paternally Inherited Mitochondrial Genome of the Mussel Mytilus galloprovincialis
Genetics, February 1, 2007; 175(2): 959 - 962.
[Abstract] [Full Text] [PDF]


Home page
J MOLLUS STUDHome page
J. M. Serb
Discovery Of Genetically Distinct Sympatric Lineages in the Freshwater Mussel Cyprogenia Aberti (Bivalvia: Unionidae)
J. Mollus. Stud., November 1, 2006; 72(4): 425 - 434.
[Abstract] [Full Text] [PDF]


Home page
J HeredHome page
D. Rubinoff, S. Cameron, and K. Will
A Genomic Perspective on the Shortcomings of Mitochondrial DNA for "Barcoding" Identification
J. Hered., November 1, 2006; 97(6): 581 - 594.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Burzynski, M. Zbawicka, D. O. F. Skibinski, and R. Wenne
Doubly Uniparental Inheritance Is Associated With High Polymorphism for Rearranged and Recombinant Control Region Haplotypes in Baltic Mytilus trossulus
Genetics, November 1, 2006; 174(3): 1081 - 1094.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Mizi, E. Zouros, and G. C. Rodakis
Multiple Events Are Responsible for an Insertion in a Paternally Inherited Mitochondrial Genome of the Mussel Mytilus galloprovincialis
Genetics, April 1, 2006; 172(4): 2695 - 2698.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
X. Guo, S. Liu, and Y. Liu
Evidence for Recombination of Mitochondrial DNA in Triploid Crucian Carp
Genetics, March 1, 2006; 172(3): 1745 - 1749.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. Breton, G. Burger, D. T. Stewart, and P. U. Blier
Comparative Analysis of Gender-Associated Complete Mitochondrial Genomes in Marine Mussels (Mytilus spp.)
Genetics, February 1, 2006; 172(2): 1107 - 1119.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
A. D. Tsaousis, D. P. Martin, E. D. Ladoukakis, D. Posada, and E. Zouros
Widespread Recombination in Published Animal mtDNA Sequences
Mol. Biol. Evol., April 1, 2005; 22(4): 925 - 933.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
A. Mizi, E. Zouros, N. Moschonas, and G. C. Rodakis
The Complete Maternal and Paternal Mitochondrial Genomes of the Mediterranean Mussel Mytilus galloprovincialis: Implications for the Doubly Uniparental Inheritance Mode of mtDNA
Mol. Biol. Evol., April 1, 2005; 22(4): 952 - 967.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Cao, E. Kenchington, E. Zouros, and G. C. Rodakis
Evidence That the Large Noncoding Sequence Is the Main Control Region of Maternally and Paternally Transmitted Mitochondrial Genomes of the Marine Mussel (Mytilus spp.)
Genetics, June 1, 2004; 167(2): 835 - 850.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
J. M. Serb and C. Lydeard
Complete mtDNA Sequence of the North American Freshwater Mussel, Lampsilis ornata (Unionidae): An Examination of the Evolution and Phylogenetic Utility of Mitochondrial Genome Organization in Bivalvia (Mollusca)
Mol. Biol. Evol., November 1, 2003; 20(11): 1854 - 1866.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
20/3/388    most recent
msg058v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (42)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Burzynski, A.
Right arrow Articles by Wenne, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burzynski, A.
Right arrow Articles by Wenne, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?