Skip Navigation


MBE Advance Access originally published online on July 28, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
20/10/1659    most recent
msg187v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (16)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Piskurek, O.
Right arrow Articles by Okada, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Piskurek, O.
Right arrow Articles by Okada, N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Mol. Biol. Evol. 20(10):1659-1668. 2003
DOI: 10.1093/molbev/msg187
© 2003 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038

Unique Mammalian tRNA-Derived Repetitive Elements in Dermopterans: The t-SINE Family and Its Retrotransposition Through Multiple Sources

Oliver Piskurek*, Masato Nikaido*, Boeadi{dagger}, Minoru Baba{ddagger} and Norihiro Okada*,§,

* Tokyo Institute of Technology, Faculty of Bioscience and Biotechnology, Department of Biological Sciences, Yokohama, Japan
{dagger} Museum Zoologi Bogor (Museum Zoologicum Bogoriense), Puslitbang Biologi-LIPI, Cibinong, Indonesia
{ddagger} Kitakyushu Museum and Institute of Natural History, Kitakyushu, Japan
§ National Institute for Basic Biology, Department of Cell Biology, Aichi, Japan

E-mail: nokada{at}bio.titech.ac.jp.


    Abstract
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Note Added in Proof
 Acknowledgements
 Literature Cited
 
Short interspersed nuclear elements (SINEs) are dispersed repetitive DNA sequences that are major components of all mammalian genomes. They have been described in almost all lineages of Euarchontoglires (rodents, rabbits, primates, flying lemurs, and tree shrews), except in flying lemurs. Most SINE family members are composed of three distinct regions: a 5' tRNA-related region, a tRNA-unrelated region, and a short tandem repeat at the 3' end that is AT-rich. The newly discovered SINE family in Cynocephalus deviates from this common structure. All 30 SINE loci analyzed in this family lack a tRNA-unrelated region and are composed exclusively of tRNA-related elements. Therefore, this novel SINE structure, described for the first time in mammalian genomes, was designated as t-SINE. The t-SINE family exhibits a high copy number and is specific to flying lemurs. Three major t-SINE subfamilies could be distinguished on the basis of characteristic nucleotides, deletions, insertions, and duplications. These sequence-specific characteristics within subfamilies and sub-subfamilies reveal that they are derived copies of distinct progenitors. We present evolutionary relationships between subfamilies and compare relationships between the subfamilies and the isoleucine tRNA gene. t-SINE amplification occurred through multiple sources and is supposedly mobilized via the L1-encoded reverse transcriptase-dependent retrotranspositional mechanism in trans.

Key Words: t-SINE • tRNA-derived • subfamilies • multiple source gene model • Cynocephalus variegatus • Dermoptera


    Introduction
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Note Added in Proof
 Acknowledgements
 Literature Cited
 
Short interspersed nuclear elements (SINEs) of approximately 70–500 bp are abundant components of eukaryotic genomes that are often present at >104 copies per genome (Weiner, Deininger, and Efstratiadis 1986; Britten et al. 1988; Okada 1991; Schmid and Maraia 1992; Deininger and Batzer 1993). Retroposons account for more than 40% of the human genome (Graur and Li 2000; International Human Genome Sequencing Consortium 2001). Whereas LINEs belong to the viral superfamily of retroposons that encodes reverse transcriptase (RT) and endonuclease (EN), SINEs are transposable elements of the nonviral retroposon superfamily that do not encode these enzymes (Weiner, Deininger, and Efstratiadis 1986). The high copy number of SINEs distinguishes them from other nonviral repetitive elements. Whereas SINEs propagate by retrotransposition, most other nonviral retroposons, such as processed retropseudogenes, are usually not subjected to multiple rounds of retrotransposition. Furthermore, other nonviral repetitive elements are nonfunctional and are normally present at low copy number. Still, there is evidence that these elements may occasionally become functional as components of novel genes (Brosius 1999).

To replicate via retrotransposition, SINEs use the existing enzymatic retrotranspositional machinery of their LINE partners. RNA-mediated retrotransposition, also known as target-primed reverse transcription (TPRT), represents the pioneering model for the relationship between SINEs and LINEs (Luan et al. 1993). Evidence supporting this LINE retrotransposition model is provided by an analysis of the Bombyx mori R2Bm RNA transcript. Initially, the R2Bm-encoded EN creates a first-strand nick that is utilized by the R2Bm RT, which subsequently reverse-transcribes copy DNA that is inserted at the 28S target site. The TPRT model gave rise to the suggestion that a similar mechanism may be used for SINE retrotransposition. It was proposed and established by our group that most SINEs share the 3' sequence of their partner LINEs (Ohshima et al. 1996; Okada et al. 1997; Terai, Takahashi, and Okada 1998; Kajikawa and Okada 2002). During retrotransposition, RTs encoded by LINEs recognize the corresponding identical 3' ends in SINEs, thus implementing SINE amplification via mobilization. This mechanism accounts for the majority of SINE retrotransposition in most nonmammalian species. The retrotranspositional machinery of the predominant mammalian LINE family, L1, is an exception to the conserved 3' end-specific region for RT recognition in that no 3' end–specific sequence (except the poly-A tail) is needed (Moran et al. 1996; Ostertag and Kazazian 2001). Additionally, Moran et al. (1996) revealed that mammalian L1 elements retrotranspose at high frequency in HeLa cells and that the integration of mammalian retroposons is mediated by L1-encoded RTs (Jurka 1997). Moreover, there is no RNA sequence specificity with respect to retrotransposition mediated by L1 in trans (Esnault, Maestre, and Heidmann 2000). In other words, each L1 element may not only mobilize its own transcribed RNA sequences, but may also mobilize SINE transcripts for retrotransposition via their 3' poly-A sequence. Thus, mammalian SINEs appear to be amplified by L1-encoded RTs via a mechanism that does not require an identical 3' end in the SINE, apart from the poly-A sequence.

SINEs are derived either from tRNA or 7SL RNA, with the majority of SINEs characterized thus far being derived from tRNAs. SINEs are found in a variety of eukaryotic species such as tobacco, the yellow fever mosquito, salmon, and mammals (for a list of references see Shedlock and Okada 2000). Examples of 7SL RNA–derived SINEs include the primate Alu families, the rodent B1 family, and two recently described SINE families in Tupaia (Tu type I and type II; Nishihara, Terai, and Okada 2002). SINEs derived from tRNA genes are composed of a tRNA-related region containing RNA polymerase III–specific internal promoter sequences, a tRNA-unrelated region, and an AT-rich region (Okada 1991; Okada et al. 1997).

SINE families are classified into subfamilies based on DNA sequence. Because all characterized SINE families and subfamilies are restricted to particular phylogenetic groups, Shedlock and Okada (2000) suggested that they represent powerful noise-free Hennigian synapomorphies (Hennig 1966). Murphy et al. (2001a, 2001b) proposed a phylogeny that divides placental mammals into four major clades, namely Laurasiatheria, Euarchontoglires, Xenarthra, and Afrotheria. SINE families and subfamilies have been described in many lineages of these clades, except in xenarthran species. For example, in laurasiatherians, CHR-1 and CHR-2 represent SINE families specific to cetartiodactylan lineages (cetaceans, hippopotamuses, and ruminants; Shimamura et al. 1997, 1999). The AfroSINE family was created in a common ancestor of afrotherian species, and another AfroSINE subfamily is present only in the genomes of hyraxes, elephants, and sea cows (Nikaido et al. 2003). On the other hand, in Euarchontoglires (rodents, rabbits, primates, flying lemurs, and tree shrews), all recognized Alu-SINE subfamilies are distributed exclusively among primate genomes (Britten et al. 1988; Schmid 1996). As previously stated, 7SL RNA–derived SINEs are found in other Euarchontoglires lineages as well (Nishihara, Terai, and Okada 2002). No 7SL RNA–derived SINE family has yet been detected in rabbits or flying lemurs. The rabbit genome harbors the C repeat SINE family (Cheng et al. 1984) that appears to be derived from tRNA genes (Sakamoto and Okada 1985), although to date no SINE family has been characterized in the flying lemur genome.

Here, we describe the isolation and characterization of a unique tRNA-derived SINE family in dermopterans (flying lemurs or colugos). All 30 members of this new SINE family are composed exclusively of tRNA-related regions. Therefore, this novel SINE structure was denoted t-SINE. We discuss several aspects of t-SINEs including the evolution of variable subfamily formations, the flying lemur–specific t-SINE distribution, the multiple source gene model as an amplification mechanism, and the enzymatic retrotranspositional machinery of a corresponding LINE partner for the t-SINE family.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Note Added in Proof
 Acknowledgements
 Literature Cited
 
Flying Lemur Tissue and Extraction of DNA
Genomic DNA from the Malayan flying lemur (Cynocephalus variegatus) was isolated by phenol-chloroform extraction as described by Blin and Stafford (1976).

In Vitro Transcription of Total DNA
In vitro transcription of total genomic dermopterans DNA in HeLa cell extract was performed as described previously (Endoh and Okada 1986).

Construction and Screening of Genomic Libraries, in Vitro Runoff Transcription, and Sequencing of Cloned DNA
Genomic libraries were constructed by complete digestion of dermopteran genomic DNA with HindIII, followed by sedimentation through a sucrose gradient and selection of DNA fragments of up to 2 kbp. The size-fractionated genomic DNA was ligated into HindIII-digested pUC18 plasmids at 37°C overnight. Aliquots of the ligation reactions were transformed into Escherichia coli DH5-{alpha} cells. Colonies were transferred to membranes for screening. The first three SINE loci were identified by random selection and sequencing of ~60 kbp from the genomic library as described by Okada, Shedlock, and Nikaido (2003). Runoff transcripts were generated in vitro using total genomic dermopteran DNA as well as dermopteran plasmid DNA digested with Bpu1102I (GCTNAGC, TaKaRa, Japan) as described by Koishi and Okada (1991). Additional t-SINE loci were screened using internal primers (CYN-AB-F GTGCGCCRCTTGGGAAGC, CYN-AB-R CACTGGCTGAGCGAGGTGC, CYN-C-F GCCTGCCCGTGGCTCACT, CYN-C-R CACCAAGTCAAGGGTTAAGATCC) labeled by primer extension in the presence of [{alpha}-32P]dCTP. [{gamma}-32P]dATP-labeled internal primer sequences were also used to further investigate the evolution of the Cynocephalus t-SINE family. Hybridization was performed at 42°C overnight in a solution of 6x SSC, 1% SDS, 2x Denhardt's solution, and 100 µg/ml herring sperm DNA and washed at 50°C for 10 min in a solution of 2x SSC and 1% SDS. Positive phage clones that appeared to contain Cynocephalus t-SINE loci were isolated and the inserts sequenced using universal primers M4 and RV (TaKaRa) as well as internal Cynocephalus t-SINE specific primers (see above). Sequencing was performed with an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems). Nucleotide sequence data with the following accession numbers were deposited in GenBank: AY278325 through AY278354.

Dot-Blot Analysis and PCR
Genomic DNA of Saguinus oedipus, Lemur catta, Cynocephalus variegatus, Tupaia belangeri, Lepus crawshayi, Mus musculus, Pteropus dasymallus, and Sorex unguiculatus were arrayed onto a GeneScreen Plus membrane (Du Pont-NEN Products, Boston, Mass.) with a dot-blot apparatus (model DP-96, Advantec, Tokyo) and probed with a t-SINE specific oligonucleotide (GACACTGAGGGTTGCGATCCGTT). The total amount of genomic DNA for the dot-blot hybridization was titrated from 1,000 ng to 10 ng. Linearized plasmid DNA (1–100 ng) containing a Cynocephalus t-SINE sequence (CYN-CL56) was used as a positive control. The DNA samples were denatured for 10 min in 2 M NaOH prior to hybridization. Hybridization conditions were as described above, except that the washing step was performed two times at 50°C for 10 min.

Genomic DNA of Homo sapiens, Saguinus oedipus, Lemur catta, Cynocephalus variegatus, Tupaia belangeri, Lepus crawshayi, Mus musculus, and Pteropus dasymallus was amplified by polymerase chain reaction (PCR) using internal t-SINE primers (CYN-C-F, CYN-C-R). The PCR conditions were as follows: After initial denaturation for 3 min at 94°C, 33 cycles were performed consisting of 30 s denaturation at 94°C, 50 s annealing at 56°C, and 30 s elongation at 72°C.

Sequence Analyses
Multiple sequence alignments were constructed using ClustalW (Thompson, Higgens, and Gibson 1994), and sequence analyses were performed with BioEdit (Hall 1999). Database searches were performed with BlastN (Altschul et al. 1997). Mouse and human tRNA sequences were obtained from the tRNA compilation of Sprinzl et al. (1998) and the tRNAscan-SE program (Lowe and Eddy 1997) and compared with known t-SINEs of Cynocephalus using DNA analysis software (Genetyx version 10.1). Using Tree-Puzzle 5.0 (Strimmer and von Haeseler 1996), a maximum likelihood analysis based on the HKY85 model was performed (Hasegawa, Kishino, and Yano 1985) using the discrete gamma distribution (eight categories) for site heterogeneity (Yang 1996). Puzzling supports were based on 1,000 replicates.


    Results and Discussion
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Note Added in Proof
 Acknowledgements
 Literature Cited
 
Identification of Retrotransposed t-SINEs Isolated from the Genome of Cynocephalus
We previously used in vitro transcription of total genomic DNA to detect SINEs in many species (Endoh and Okada 1986; Ohshima et al. 1993; Kawai et al. 2002). This technique was applied to the Cynocephalus genome to identify a new SINE family, and a discrete transcript of slightly fewer than 250 nucleotides was generated (fig. 1). This result clearly indicated that RNA polymerase III–transcribed repetitive elements were present in the genome of the flying lemur. The first three such loci were detected by random selection and sequencing of 100 clones from a genomic dermopteran library. To verify that these sequences were identical with the in vitro transcription product, an in vitro runoff transcription assay (Koishi and Okada 1991) was performed (data not shown). After the initial characterization of these novel repetitive sequences, 27 additional loci were detected by screening (see Materials and Methods). Curiously, all loci contained tRNA-related regions only, along with a poly-A tail.



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 1. In vitro transcription of total genomic DNA from squid (lane 1) and Cynocephalus variegatus (lane 2). An arrowhead shows a major discrete transcript of slightly less than 250 nucleotides. The length of the squid SINE is known to be 250 nucleotides (Ohshima et al. 1993)

 
Initially, the repetitive sequences appeared to be simple tRNA pseudogenes, which are generated in one of two ways—either by duplication of tRNA genes or by retrotransposition of tRNA itself. Duplications of tRNA genes occur at the DNA level and the resultant genes do not have direct repeats, whereas a tRNA pseudogene generated by retrotransposition occurs at the level of RNA and results in direct repeats flanking the gene. In the present case, the novel repetitive sequences were dispersed in the Cynocephalus genome and flanked by direct repeats (fig. 2), suggesting that they were amplified through retrotransposition. Accordingly, these repetitive sequences appeared to have many characteristics of SINEs, although most SINEs described to date are composed of a 5' tRNA-related region, a tRNA-unrelated region, and a 3' AT-rich region (Okada 1991; Okada et al. 1997). Given that all the novel repetitive dermopteran loci contained only tRNA-related regions, this unique SINE structure was designated as t-SINE. Although this novel Cynocephalus t-SINE family lacks the tRNA-unrelated region in every locus, all other essential SINE features are present, including clearly recognizable flanking direct repeats that are diagnostic of amplification via RNA intermediates (fig. 2), A and B boxes for internal RNA polymerase III promoters, a typical poly-A tail, and diagnostic nucleotides indicating that they have undergone multiple rounds of retrotransposition during evolution (see below).



View larger version (65K):
[in this window]
[in a new window]
 
FIG. 2. DNA sequence comparison of t-SINE loci flanking direct repeats. The flanking direct repeats with a length of 11–18 bp for 25 t-SINE loci are shown

 
Structural and Evolutionary Aspects of Cynocephalus t-SINE Family Members
Analysis of the repetitive sequences led us to divide the Cynocephalus t-SINE family into three different subfamilies, denoted {alpha}-, ß-, and {gamma}-types (fig. 3). Fourteen dimeric t-SINE loci were divided into 10 {alpha}-type sequences and 4 ß-type sequences while all 16 trimeric t-SINE loci were categorized in the {gamma}-type subfamily. A homology search revealed that the sequences are closely related to the isoleucine tRNA gene. The {alpha}-type sequences consist of two tRNA like regions, each with a 74%–80% identity to the human tRNAIle gene (table 1). Although conserved nucleotides in the {alpha}-type sequences are related to the ß- and {gamma}-type sequences, these two subfamilies are less related to the tRNAIle gene than the {alpha}-type sequence. However, a tRNA-like cloverleaf structure resembling the human tRNAIle gene (Sprinzl et al. 1998) could be constructed for all three subfamilies and their subunits. While these structures are partially disrupted by substitutions, insertions, and deletions in the ß- and {gamma}-type subunits, they are primarily conserved in both of the {alpha}-type subunits (fig. 4). This suggests a tRNAIle origin for the {alpha}-type subunits.



View larger version (107K):
[in this window]
[in a new window]
 
FIG. 3. Alignment of the 30 Cynocephalus t-SINE family members. DNA sequences are divided into three different subfamilies ({alpha}-, ß-, and {gamma}-type). Mouse and human Ile-tRNA gene sequences were added to the alignment to illustrate the high similarity of each subunit of the dimeric {alpha}-type loci to the Ile-tRNA gene. RNA polymerase III promoter boxes (A + B) are shown for all subunits of the dimeric {alpha}-type (CYN-C, CYN-CL46.2, 64, 162, 263, 290, 293.1, 298, 314, 374) and ß-type sequence (CYN-CL180, 293.2, 463.1, 463.2) as well as the trimeric {gamma}-type sequence (CYN-A, CYN-B, CYN-CL1, 8, 39, 46.1, 56, 66, 172, 173, 175, 177, 181, 433, 434, 438). Double stranded regions are boxed. The consensus sequence for each of the subfamilies is shown at the end of each section. Ac: Acceptor stem, D: D loop stem, An: Anticodon stem, Ps: T{psi}C stem

 

View this table:
[in this window]
[in a new window]
 
Table 1 Calculated Similarity for Two t-SINE tRNA-like Subunits and Subunit Identity Compared to the Human Isoleucine tRNA Gene.

 


View larger version (22K):
[in this window]
[in a new window]
 
FIG. 4. Cloverleaf structure of a human isoleucine tRNA gene (I), and predicted cloverleaf structures of the {alpha}-type (II), ß-type (III), and {gamma}-type (IV) consensus sequences

 
The evolutionary relationships among the novel t-SINE subfamilies were analyzed by comparing all the subunits between subfamilies (table 1). The first and second tRNA subunits of the ß-type are more similar to the first and second {alpha}-type subunit, respectively, than either of the two ß-subunits is to the tRNAIle gene. This result suggests that the ß-type sequence was derived from the {alpha}-type. The most obvious distinction is an 8-bp insertion in the first subunit ß-type region of the variable loop, which is absent in the first {alpha}-type subunit (fig. 4). Another distinction between the {alpha}-type sequences and the other subfamilies is the presence of a TCTTT sequence at the beginning of the poly-A tail that is absent in both the ß- and {gamma}-type sequences. In these two subfamilies, the poly-A tail begins with CGAAAAAGAC. Numerous other diagnostic nucleotides distinguish the {alpha}- and ß-type sequences (fig. 3, sites 13, 18, 26, 41, 43, 44, 51–53, 68, 89, 92, 122, 128, 130–132, 136, 139, 140, 142–144, 151, 152, 159). Although not as many obvious diagnostic nucleotides discriminate the ß- from the {gamma}-type sequences, quite a few are still recognized (fig. 3, sites 23, 36, 46, 84, 90, 91, 102, 103, 132, 169, 170).

While the 8-bp insertion is also present in the first subunit of the {gamma}-type, an additional truncated subunit with a length of 47 bp distinguishes the {gamma}- from the ß-type. The first and second subunits of the ß- and {gamma}-type sequences exhibit high sequence similarity (table 1). This not only supports the close relationship between the ß- and {gamma}-type sequences but also strongly suggests that the {gamma}-type subfamily is the youngest presented here. The average length of the 16 trimeric {gamma}-type sequences is 230 bp, whereas the average length of the 14 dimeric {alpha}- and ß-type sequences is <200 bp. Thus, the major discrete transcript shown in figure 1 may represent the trimeric {gamma}-type sequence and is likely the most abundant subfamily in the Cynocephalus genome. In a maximum likelihood analysis of all different subunits, the third {gamma}-type subunit is presented in a sister group relation to the second subunit of the ß-type (fig. 5). In other words, the sequence similarity of the third {gamma}-type subunit and the second ß-type subunit suggests an origin of the trimeric {gamma}-type subfamily after a partial duplication of the second subunit of the ß-type. The major tree topology in figure 5 does not change if subfamilies are divided in minor subfamilies (see below).



View larger version (8K):
[in this window]
[in a new window]
 
FIG. 5. Schematic of evolutionary relationships between consensus sequences of tRNA-like subunits (1st, 2nd, and 3rd) of the {alpha}-, ß-, and {gamma}-type t-SINEs analyzed using the maximum likelihood method. Numbers corresponding to internal nodes represent puzzle support values. Branch lengths represent nucleotide substitutions per site

 
Dimeric structures such as the {alpha}-type t-SINEs may be generated in a variety of ways (Rogers 1985). For example, a dimeric retroposon structure may result from the duplication of a tRNA gene. Alternatively, an original gene cluster of two functional tRNA genes may be responsible for the dimeric structure. This possibility was discussed for the two arginine tRNA-related monomers of the Twin SINE family from the vector mosquito Culex pipiens (Feschotte et al. 2001). The Twin SINE subunits are separated by a 39-bp spacer sequence that is believed to correspond to the DNA region ancestrally separating two functional tRNAArg genes. It has been hypothesized that the Twin SINE family originated from an unprocessed RNA polymerase III transcript containing a gene cluster of two tRNA sequences (Feschotte et al. 2001). However, the t-SINE family in Cynocephalus does not exhibit an obvious spacer region between the subunits. Therefore, the t-SINE may not have originated from an unprocessed polymerase III transcript of a tRNAIle gene cluster.

A dimeric retroposon structure may be generated in other ways, including retrotransposition of a tRNA pseudogene in the vicinity of a tRNA gene and duplication of retrotransposed tRNA. The latter scenario is possible because the sequence similarity between {alpha} subunit 1 and {alpha} subunit 2 is 73%. However, both subunits show greater similarity to the tRNAIle gene (table 1). The origin of dimeric Alu elements in the primate genome was described as a fusion of a free left Alu monomer (FLAM) with a free right Alu monomer (FRAM) (Jurka and Zuckerkandl 1991; Quentin 1992). An A-rich linker connects these two Alu precursors as well as many other dimeric SINE elements. Because there is no such poly-A linker found between the t-SINE subunits of the flying lemur, the fusion of two tRNAIle retrotransposed monomers may not be relevant. At the same time, the t-SINE transcription seems to be promoted by the first subunit in view of the fact that a critical nucleotide insertion in the B-Box of the second {alpha}-type subunit might be responsible for silencing this t-SINE subunit. The same B-Box mutation can be seen in the derived ß- and {gamma}-type sequences as well (fig. 3). A possible fusion of a transcriptionally active FLAM with a silenced FRAM was discussed in previous studies concerning the process of Alu dimerization (Jurka and Zuckerkandl 1991; Quentin 1992). The Alu fusion model involves two separate deletions in 7SL genes or 7SL RNA–derived SINEs followed by retrotransposition and fusion. Such a model might explain the origin of the dimeric t-SINEs as well. Human Alu-SINEs as well as rabbit C repeats show a common tendency to insert into regions where other SINEs have previously inserted. Whereas human Alu-SINEs are usually inserted at the 3' end into the poly-A region (Slagel et al. 1987), C repeats occasionally insert into the 5' end of previously existing SINE loci (Krane et al. 1991). Many examples regarding C repeats have been identified in which new SINE insertions occur near or within preexisting inserts (Krane et al. 1991). The former situation has occurred in the Cynocephalus genome as well (data not shown). Although there are several possible ways to generate a dimer or trimer structure as seen in t-SINEs, the precise mechanism remains to be resolved. Given that we could not detect t-SINE monomers that had been subjected to multiple rounds of retrotransposition, we can only suggest that a dimer or trimer structure may have some retrotranspositional advantage over a monomeric tRNA-like structure.

Copy Number of t-SINEs in Cynocephalus, Their Taxonomic Distribution, and Phylogenetic Inference
To estimate the t-SINE copy number, the size of the mammalian genome was postulated to be 3 x 109 bp. Given the fact that the first three t-SINE loci were found by random selection and sequencing of ~60 kbp of genomic dermopteran DNA, the assumed copy number is 1.5 x 105 t-SINEs per haploid genome. On the other hand, we performed a dot-blot experiment (fig. 6) to examine the t-SINE distribution in Cynocephalus and other mammalian species. Based on the results of this experiment, the assumed t-SINE copy number was estimated as 1 x 106. Because the {gamma}-type sequences seem to be the most abundant t-SINE members in the Cynocephalus genome, the sequence designed as a probe was specific to the duplicated third {gamma}-type subunit. The high copy number shown by the dot-blot experiment is supposedly caused by the additional hybridization of the probe to the second subunit of ß- and {gamma}-type sequences (see above), and probably even to the second {alpha}-type subunit as well.



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 6. Genomic DNA dot-blot. DNA from several mammalian sources was immobilized in decreasing amounts (1,000 ng, 500 ng, 100 ng, 10 ng). Cloned DNA was used as a positive control (t-SINE) and negative control (squid SINE) at 100 ng, 50 ng, 10 ng, and 1 ng. AN: Anthropoidea (Saguinus oedipus) ST: Strepsirhini (Lemur catta), DE: Dermoptera (Cynocephalus variegatus), SC: Scandentia (Tupaia belangeri), LA: Lagomorpha (Lepus crawshayi), RO: Rodentia (Mus musculus), CH: Chiroptera (Pteropus dasymallus), EU: Eulipotyphla (Sorex unguiculatus)

 
Hence, the assumed copy number estimated from the hybridization signal is three to four times higher than could have been expected had the probe hybridized to one sequence position only. However, the dot-blot hybridization exhibited a strong signal for Cynocephalus only. The dot-blot hybridization therefore illustrates that the t-SINE family discovered in Cynocephalus variegatus is restricted to dermopteran genomes. To support this result, a PCR was performed for the flying lemur and other mammalian species using internal t-SINE primers designed from the {alpha}-type subfamily (fig. 7). A strong band of the expected size (140 bp) was observed only for the Cynocephalus sample. Thus, the new t-SINE family is specific to dermopterans and cannot be used as a molecular marker to determine the phylogenetic position of flying lemurs.



View larger version (127K):
[in this window]
[in a new window]
 
FIG. 7. Polymerase chain reaction analysis with internal t-SINE primers. Genomic DNA from mammalian sources was amplified by PCR using primers CYN-C-F and CYN-C-R as described in Materials and Methods. M: Marker ({Phi} X174-Hinc II digest), AN1: Anthropoidea (Homo sapiens), AN2: Anthropoidea (Saguinus oedipus). See figure 6 for the abbreviations of other mammalian species

 
A close relationship between anthropoids (higher primates) and dermopterans has been proposed on the basis of large data sets of nuclear and mitochondrial DNA of eutherian mammals (Madson et al. 2001; Murphy et al. 2001a; Arnason et al. 2002). In contrast, Schmitz et al. (2002) considered that the monophyly of primates is supported by analyzing SINE insertions (absent in flying lemurs), and suggests that the colugo is mistakenly joined with anthropoids in phylogenetic tree reconstructions based on similarities in the nucleotide compositions of mitochondrial DNA. A discussion of the phylogenetic position of dermopterans has been ongoing since the traditional morphology-based Archonta hypothesis (Gregory 1910; Sargis 2002). Because of their relatively ancient history, the identification of 7SL RNA–derived SINEs in Cynocephalus would contribute to the understanding of its phylogenetic position. 7SL RNA–derived SINEs had been identified only in primates and rodents until their recent discovery in tree shrews (Nishihara, Terai, and Okada 2002). These animals, together with rabbits and flying lemurs, belong to the Euarchontoglires. Thus, we might expect to find 7SL RNA–derived SINEs or their ancestral sequences in rabbits and flying lemurs as well.

Members of the Cynocephalus t-SINE Family Are Amplified Through Multiple Sources and Are Potentially Retrotransposed by L1-Encoded RT in trans
Both SINEs and processed retropseudogenes belong to the nonviral superfamily of retroposons. Once processed retropseudogenes are integrated into a genome, they generally do not propagate further. Conversely, SINEs may propagate and generate progeny during evolution. Each SINE copy has the potential to propagate depending on the circumstances in the genome (Schmid and Maraia 1992; Shedlock and Okada 2000). In cases where SINEs are integrated into unfavorable chromosomal locations, it is possible that they accumulate too many mutations and ultimately lose their ability to propagate. Since all propagating SINE loci are dependent on the retrotranspositional LINE machinery, SINEs may also become inactive if their partner LINE family becomes inert. However, if mutations are introduced into a SINE copy but do not influence its ability to propagate, the progeny may be distinguished by these mutations (diagnostic nucleotides). The "mother copy" with these mutations is called a source gene. In the master gene model only a very limited number of master SINE loci are responsible for long-term amplification of non-propagating offspring copies. This model was proposed by earlier studies of Alu subfamilies (Shen et al. 1991; Deininger et al. 1992; Deininger and Batzer 1995). At present, however, most SINEs are believed to amplify according to the multiple source gene model and can be divided into subfamilies (source genes) that are able to propagate. The amplification rate of source genes will increase or decrease over evolutionary time depending on whether accumulated mutations deactivate them faster or slower (Schmid and Maraia 1992; Shedlock and Okada 2000).

For the new t-SINE family described here, we demonstrated the existence of different subfamilies, each containing several members. Moreover, subfamilies can be further divided into sub-subfamilies based on several diagnostic nucleotides. For example, the {gamma}-type subfamily may be divided into two sub-subfamilies ([{gamma}1: CYN-A, CYN-CL1, 39, 56, 177, 181, 433, 438] [{gamma} 2: CYN-B, CYN-CL8, 46.1, 66, 172, 173, 175, 434]) that are based on several diagnostic nucleotides (fig. 3, sites 25, 26, 29, 66, 171, 209). {gamma} 2 may be subdivided into {gamma} 2.1 (CYN-B, CYN-CL8) and {gamma} 2.2 (CYN-CL46.1, 66, 172, 173, 175, 434) based on one diagnostic nucleotide (fig. 3, site 171). Several {gamma} 1 sequences cluster together as well ({gamma} 1.1: CYN-CL56, 181, 433, 438; fig. 3, sites 100–103; {gamma} 1.2: CYN-CL1, 39, 177; fig. 3, sites 46, 143). Finally, it is possible to divide the {alpha}-type subfamily in two sub-subfamilies, namely {alpha} 1 (CYN-C, CYN-CL263, 293.1, 298, 314) and {alpha} 2 (CYN-CL46.2, 64, 162, 290, 374) based on one diagnostic nucleotide (fig. 3, site 79).

The delineation of subfamilies suggests the existence of a small number of progenitors that were responsible for the amplification of t-SINE members. Thus, for t-SINEs, an amplification process that is equivalent to SINEs having a common structure (containing a tRNA-unrelated region as well) must also exist. In the multiple source gene model, SINE offspring copies serve as multiple sources for subsequent SINE amplifications (Schmid and Maraia 1992; Shedlock and Okada 2000). This evolutionary model appears to be appropriate for the amplification of t-SINEs (fig. 8). Unlike in the master gene model, which implies long-term persistence of individual source genes, t-SINE source genes were shown to be derived from each other. The t-SINE subfamilies were subjected to dimerization, duplication (trimerization), deletions, insertions, and substitutions. Certain source genes were successfully retrotransposed during evolution, and their offspring copies can clearly be recognized to shape subfamily characteristics. Whereas {alpha}-type sequences were revealed to form the oldest t-SINE subfamily with a 74%–80 % identity to the tRNAlle, ß-type t-SINEs were shown to be derived from {alpha}-type t-SINEs to which they are 75%–76 % identical. The youngest t-SINE subfamily was presented through the {gamma}-type sequences, which are 81%–92 % identical to the ß-type t-SINE subunits (table 1). The number of t-SINE copies determined in this study is too limited to assume the age of major t-SINE lineages. Because the rate of amplification is expected to be tightly linked to overall copy numbers, and because {gamma}-type sequences are the most abundant in the genome of the flying lemur, it is expected that the {gamma}-type source gene is highly active and very successful in its retrotransposition of offspring copies. The high retrotranspositional frequency of UnaSINE1 may reflect the affinity of tRNA-derived regions for ribosomes in order to bring the latter into proximity with polysomes that are synthesizing UnaL2 proteins (Kajikawa and Okada 2002). It might further be expected that a trimeric structure consisting exclusively of tRNA-related subunits (as represented in the {gamma}-type subfamily) strengthens its affinity for ribosomes. While this hypothesis has not yet been proven, it is apparent that the youngest trimeric-structured t-SINE subfamily members are the most dominant in the flying lemur genome.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 8. Multiple source genetic model for t-SINE subfamily amplification. The multiple source gene model illustrates the amplification process of t-SINE subfamilies in the genome of Cynocephalus. Some offspring of a parent t-SINE become inactive, some give rise to nonpropagating copies, and others propagate and become multiple sources ({alpha}-, ß-, and {gamma}-type and their sub-subfamily source genes) for new t-SINE copies during evolution

 
SINEs utilize the retrotranspositional enzymes of their partner LINEs and therefore the retrotranspositional machinery of a corresponding LINE must be functional for t-SINE amplification (Ohshima et al. 1996; Jurka 1997; Okada et al. 1997). Ohshima et al. (1996) proposed that tRNA-derived SINEs in different nonmammalian species were generated by fusion with the 3' ends of their respective LINEs. Kajikawa and Okada (2002) conclusively demonstrated the mechanism by which SINEs acquire retrotranspositional activity via LINE-encoded RTs that recognize the tRNA-unrelated region of SINEs (identical to that in LINEs). Apart from the 3' poly-A region, t-SINEs do not contain a tRNA-unrelated region that could serve as a recognition site for an RT encoded by a corresponding LINE family. On the other hand, Jurka (1997) proposed that Alu and other mammalian retroposons make use of the L1 retrotranspositional machinery. The recognition specificity of the 3'-end sequence of RNA is more relaxed in the LINE family, L1 (Okada et al. 1997). L1 elements and Alu-SINEs do not share a common 3' sequence except for a poly-A tail (Boeke 1997), but L1-encoded proteins are believed to be linked to the amplification of their partner Alu-SINEs (Esnault, Maestre, and Heidmann 2000). Interestingly, in primate genomes the copy number of L1 elements is smaller (L1-mediated cis retrotransposition) than that of Alus (L1 mediated trans retrotransposition). Another example in which trans preference is dominant over cis preference is the larger copy number of UnaSINE1 compared to its partner LINE-family UnaL2 (Kajikawa and Okada 2002). Thus, several examples exist in which L1 elements not only mobilize their own transcribed RNA sequences but also retrotranspose SINE transcripts via the 3' poly-A sequence. It is very likely that t-SINE retrotransposition is mediated through the 3' tail via recognition by L1-encoded RTs in trans.


    Note Added in Proof
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Note Added in Proof
 Acknowledgements
 Literature Cited
 
Recently, Schmitz and Zischler (2003) published independently eight sequences of the new tRNA-derived SINE family in Cynocephalus variegatus and obtained quite a few similar results.


    Acknowledgements
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Note Added in Proof
 Acknowledgements
 Literature Cited
 
This work was supported by research grants from the German Academic Exchange Service (DAAD) and from the Ministry of Education, Culture, Sports, Science and Technology of Japan. We thank the Indonesian Institute of Sciences (LIPI) for research permissions (no. 6541/I/KS/1999 and no. 3452/SU/KS/2002), and the Director of the Research Center for Biology–LIPI for his sponsorship.


    Footnotes
 
Associate Editor, Naruya Saitou Back


    Literature Cited
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Note Added in Proof
 Acknowledgements
 Literature Cited
 

    Altschul, S. F., T. L Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipmann. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]

    Arnason, U., J. A. Adegoke, K. Bodin, E. W. Born, Y. B. Esa, A. Gullberg, M. Nilsson, R. V. Short, X. Xu, and A. Janke. 2002. Mammalian mitogenomic relationships and the root of the eutherian tree. Proc. Natl. Acad. Sci. USA 99:8151-8156.[Abstract/Free Full Text]

    Blin, N., and D. W. Stafford. 1976. A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acid Res. 3:2303-2308.

    Boeke, J. D. 1997. LINEs and Alus—the poly A connection. Nat. Genet. 16:6-7.[CrossRef][ISI][Medline]

    Britten, R. J., W. F. Baron, D. B. Stout, and E. H. Davidson. 1988. Sources and evolution of human Alu repeated sequences. Proc. Natl. Acad. Sci. USA 85:4770-4774.[Abstract/Free Full Text]

    Brosius, J. 1999. RNAs from all categories generate retrosequences that may be exapted as novel genes or regulatory elements. Gene 238:115-134.[CrossRef][ISI][Medline]

    Cheng, J. F., R. Printz, T. Callaghan, D. Shuey, and R. C. Hardison. 1984. The rabbit C family of short, interspersed repeats. Nucleotide sequence determination and transcriptional analysis. J. Mol. Biol. 176:1-20.[CrossRef][ISI][Medline]

    Deininger, P. L., and M. A. Batzer. 1993. Evolution of retroposons. Evol. Biol. 27:157-196.

    1995. SINE master genes and population biology. Pp. 43–60 in R. Maraia, ed. The impact of short, interspersed elements (SINEs) on the host genome. R. G. Landes, Georgetown, Tex.

    Deininger, P. L., M. A. Batzer, C. A. Hutchison, 3rd, and M. H. Edgell. 1992. Master genes in mammalian repetitive DNA amplification. Trends Genet. 8:307-311.[ISI][Medline]

    Endoh, H., and N. Okada. 1986. Total DNA transcription in vitro: a procedure to detect highly repetitive and transcribable sequences with tRNA-like structures. Proc. Natl. Acad. Sci. USA 83:251-255.[Abstract/Free Full Text]

    Esnault, C., J. Maestre, and T. Heidmann. 2000. Human LINE retrotransposons generate processed pseudogenes. Nat. Genet. 24:363-367.[CrossRef][ISI][Medline]

    Feschotte, C., N. Fourrier, I. Desmons, and C. Mouches. 2001. Birth of a retroposon: the Twin SINE family from the vector mosquito Culex pipiens may have originated from a dimeric tRNA precursor. Mol. Biol. Evol. 18:74-84.[Abstract/Free Full Text]

    Graur, D., and W. H. Li. 2000. Fundamentals of molecular evolution, 2nd ed. Sinauer Associates, Sunderland, Mass.

    Gregory, W. K. 1910. The orders of mammals. Bull. Am. Mus. Nat. Hist. 27:1-524.

    Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41:95-98.

    Hasegawa, M., H. Kishino, and T. Yano. 1985. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. J. Mol. Evol. 22:160-174.[CrossRef][ISI][Medline]

    Hennig, W. 1966. Phylogenetic systematics. University of Illinois Press, Urbana-Champaign, Ill.

    International Human Genome Sequencing Consortium. 2001. Initial sequencing and analysis of the human genome. Nature 409:860-921.[CrossRef][Medline]

    Jurka, J. 1997. Sequence patterns indicate an enzymatic involvement in integration of mammalian retroposons. Proc. Natl. Acad. Sci. USA 94:1872-1877.[Abstract/Free Full Text]

    Jurka, J., and E. Zuckerkandl. 1991. Free left arms as precursor molecules in the evolution of Alu sequences. J. Mol. Evol. 33:49-56.[CrossRef][ISI][Medline]

    Kajikawa, M., and N. Okada. 2002. LINEs mobilize SINEs in the eel through a shared 3' sequence. Cell 111:433-444.[CrossRef][ISI][Medline]

    Kawai, K., M. Nikaido, M. Harada, S. Matsumura, L.-K. Lin, Y. Wu, M. Hasegawa, and N. Okada. 2002. Intra- and interfamily relationships of Vespertilionidae inferred by various molecular markers including SINE insertion data. J. Mol. Evol. 55:284-301.[CrossRef][ISI][Medline]

    Koishi, R., and N. Okada. 1991. Distribution of the salmonid Hpa 1 family species demonstrated by in vitro runoff transcription assay of total genomic DNA: a procedure to estimate repetitive frequency and sequence divergence of a certain repetitive family with a few known sequences. J. Mol. Evol. 32:43-52.[CrossRef][ISI][Medline]

    Krane, D. E., A. G. Clark, J.-F. Cheng, and R. C. Hardison. 1991. Subfamily relationships and clustering of rabbit C repeats. Mol. Biol. Evol. 8:1-30.[Abstract]

    Lowe, T. M., and S. R. Eddy. 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25:955-964.[Abstract/Free Full Text]

    Luan, D. D., M. H. Korman, J. L. Jakubczak, and T. H. Eickbush. 1993. Reverse transcription of R2Bm RNA is primed by a nick at the chromosomal target site: a mechanism for non-LTR retrotransposition. Cell 72:595-605.[CrossRef][ISI][Medline]

    Madson, O., M. Scally, C. J. Douady, D. J. Kao, R. W. DeBry, R. Adkins, H. M. Amrine, M. J. Stanhope, W. W. de Jong, and M. S. Springer. 2001. Parallel adaptive radiations in two major clades of placental mammals. Nature 409:610-614.[CrossRef][Medline]

    Moran, J. V., S. E. Holmes, T. P. Naas, R. J. DeBeradinis, J. D. Boeke, and H. H. Kazazian, Jr. 1996. High frequency retrotransposition in cultured mammalian cells. Cell 87:917-927.[CrossRef][ISI][Medline]

    Murphy, W. J., E. Eizirik, W. E. Johnson, Y. P. Zhang, O. A. Ryder, and S. J. O'Brien. 2001a. Molecular phylogenetics and the origins of placental mammals. Nature 409:614-618.[CrossRef][Medline]

    Murphy, W. J., E. Eizirik, and S. J. O'Brien, et al. (11 co-authors). 2001b. Resolution of the early placental mammal radiation using bayesian phylogenetics. Science 294:2348-2351.[Abstract/Free Full Text]

    Nikaido, M., H. Nishihara, Y. Fukumoto, and N. Okada. 2003. Ancient SINEs from African endemic mammals. Mol. Biol. Evol. 20:522-527.[Abstract/Free Full Text]

    Nishihara, H., Y. Terai, and N. Okada. 2002. Characterization of novel Alu- and tRNA-related SINEs from the tree shrew and evolutionary implications of their origins. Mol. Biol. Evol. 19:1964-1972.[Abstract/Free Full Text]

    Ohshima, K., M. Hamada, Y. Terai, and N. Okada. 1996. The 3' ends of tRNA-derived short interspersed repetitive elements are derived from the 3' ends of long interspersed repetitive elements. Mol. Cell. Biol. 16:3756-3764.[Abstract]

    Ohshima, K., R. Koishi, M. Matsuo, and N. Okada. 1993. Several short interspersed elements (SINEs) in distant species may have originated from a common ancestral retrovirus: characterization of a squid SINE and a possible mechanism for generation of tRNA-derived retroposons. Proc. Natl. Acad. Sci. USA 90:6260-6264.[Abstract/Free Full Text]

    Okada, N. 1991. SINEs: short interspersed repeated elements of the eukaryotic genome. Trends Ecol. Evol. 6:358-361.

    Okada, N., M. Hamada, I. Ogiwara, and K. Ohshima. 1997. SINEs and LINEs share common 3' sequence: a review. Gene 205:229-243.[CrossRef][ISI][Medline]

    Okada, N., A. M. Shedlock, and M. Nikaido. 2003. TE mapping in molecular systematics. In P. Capy, ed. Mobile genetic elements and their application in genomics. Humana Press, Totowa, N.J. (in press).

    Ostertag, E. M., and H. H. Kazazian, Jr. 2001. Biology of mammalian L1 retrotransposons. Annu. Rev. Genet. 35:501-538.[CrossRef][ISI][Medline]

    Quentin, Y. 1992. Fusion of a free left Alu monomer and a free right Alu monomer at the origin of the Alu family in the primate genomes. Nucleic Acids Res. 20:487-493.[Abstract/Free Full Text]

    Rogers, J. H. 1985. The origin and evolution of retroposons. Int. Rev. Cytol. 93:187-279.[ISI][Medline]

    Sakamoto, K., and N. Okada. 1985. Rodent type 2 Alu family, rat identifier sequence, rabbit C family, and bovine or goat 73-bp repeat may have evolved from tRNA genes. J. Mol. Evol. 22:134-140.[CrossRef][ISI][Medline]

    Sargis, E. J. 2002. Primate origins nailed. Science 298:1564-1565.[Free Full Text]

    Schmid, C. W. 1996. Alu: structure, origin, evolution, significance and function of one-tenth of human DNA. Prog. Nucleic Acids Res. Mol. Biol. 53:283-319.

    Schmid, C. W., and R. Maraia. 1992. Transcriptional regulation and transpositional selection of active SINE sequences Curr. Opin. Genet. Dev. 2:874-882.[CrossRef][Medline]

    Schmitz, J., M. Ohme, B. Suryobroto, and H. Zischler. 2002. The colugo (Cynocephalus variegatus, Dermoptera): the primates gliding sister? Mol. Biol. Evol. 19:2308-2312.[Abstract/Free Full Text]

    Schmitz, J., and H. Zischler. 2003. A novel family of tRNA-derived SINEs in the colugo and two new retrotransposable markers separating dermopterans from primates. Mol. Phylogenet. Evol. 28:341-349.[CrossRef][ISI][Medline]

    Shedlock, A. M., and N. Okada. 2000. SINE insertions: powerful tools for molecular systematics. Bioessays 22:148-160.[CrossRef][ISI][Medline]

    Shen, M. R., M. A. Batzer, and P. L. Deininger. 1991. Evolution of the master Alu gene(s). J. Mol. Evol. 33:311-320.[CrossRef][ISI][Medline]

    Shimamura, M., H. Abe, M. Nikaido, K. Ohshima, and N. Okada. 1999. Genealogy of families of SINEs in cetaceans and artiodactyls: the presence of a huge superfamily of tRNAGlu-derived families of SINEs. Mol. Biol. Evol. 16:1046-1060.[Abstract]

    Shimamura, M., H. Yasue, K. Ohshima, H. Abe, H. Kato, T. Kishiro, M. Goto, I. Munechika, and N. Okada. 1997. Molecular evidence from retroposons that whales form a clade within even-toed ungulates. Nature 388:666-670.[CrossRef][Medline]

    Slagel, V., E. Flemington, V. Traina-Dorge, H. Bradshaw, and P. Deininger. 1987. Clustering and subfamily relationships of the Alu family in the human genome. Mol. Biol. Evol. 4:19-29.[Abstract]

    Sprinzl, M., C. Horn, M. Brown, M. Ioudovitch, and S. Steinberg. 1998. Compilation of tRNA sequences and sequences of tRNA genes. Nucleic Acids Res. 26:148-153.[Abstract/Free Full Text]

    Strimmer, K., and A. von Haeseler. 1996. Quarter puzzling: a quarted maximum-likelihood method for reconstructing tree topologies. Mol. Biol. Evol. 13:964-969.[ISI]

    Terai, Y., K. Takahashi, and N. Okada. 1998. SINE cousins: the 3'-end tails of two oldest and distantly related families of SINEs are descended from the 3' ends of LINEs with the same genealogical origin. Mol. Biol. Evol. 15:1460-1471.[Free Full Text]

    Thompson, J. D., D. G. Higgens, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]

    Weiner, A. M., P. L. Deininger, and A. Efstratiadis. 1986. Nonviral retroposons: genes, pseudogenes, and transposable elements generated by the reverse flow of genetic information. Annu. Rev. Biochem. 55:631-661.[CrossRef][ISI][Medline]

    Yang, Z. 1996. Among-site rate variation and its impact on phylogenetic analyses. Trends Ecol. Evol. 11:367-372.[CrossRef]

Accepted for publication May 29, 2003.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Biol EvolHome page
B. Tawari, I. K. M. Ali, C. Scott, M. A. Quail, M. Berriman, N. Hall, and C. G. Clark
Patterns of Evolution in the Unique tRNA Gene Arrays of the Genus Entamoeba
Mol. Biol. Evol., January 1, 2008; 25(1): 187 - 198.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
G. Churakov, A. F.A. Smit, J. Brosius, and J. Schmitz
A Novel Abundant Family of Retroposed Elements (DAS-SINEs) in the Nine-Banded Armadillo (Dasypus novemcinctus)
Mol. Biol. Evol., April 1, 2005; 22(4): 886 - 893.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Pelissier, C. Bousquet-Antonelli, L. Lavie, and J.-M. Deragon
Synthesis and processing of tRNA-related SINE transcripts in Arabidopsis thaliana
Nucleic Acids Res., July 28, 2004; 32(13): 3957 - 3966.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available