Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (33)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Filatov, D. A.
Right arrow Articles by Charlesworth, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Filatov, D. A.
Right arrow Articles by Charlesworth, D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Biology and Evolution 19:898-907 (2002)
© 2002 Society for Molecular Biology and Evolution

Substitution Rates in the X- and Y-Linked Genes of the Plants, Silene latifolia and S. dioica

Dmitry A. Filatov2 and Deborah Charlesworth

*School of Biosciences, University of Birmingham;
{dagger}Institute of Cell, Animal, and Population Biology, University of Edinburgh


    Abstract
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Theory predicts that selection should be less effective in the nonrecombining genes of Y-chromosomes, relative to the situation for genes on the other chromosomes, and this should lead to the accumulation of deleterious nonsynonymous substitutions. In addition, synonymous substitution rates may differ between X- and Y-linked genes because of the male-driven evolution effect and also because of actual differences in per-replication mutation rates between the sex chromosomes. Here, we report the first study of synonymous and nonsynonymous substitution rates on plant sex chromosomes. We sequenced two pairs of sex-linked genes, SlX1-SlY1 and SlX4-SlY4, from dioecious Silene latifolia and S. dioica, and their non–sex-linked homologues from nondioecious S. vulgaris and Lychnis flos-jovis, respectively. The rate of nonsynonymous substitutions in the SlY4 gene is significantly higher than that in the SlX4 gene. Silent substitution rates are also significantly higher in both Y-linked genes, compared with their X-linked homologues. The higher nonsynonymous substitution rate in the SlY4 gene is therefore likely to be caused by a mutation rate difference between the sex chromosomes. The difference in silent substitution rates between the SlX4 and SlY4 genes is too great to be explained solely by a higher per-generation mutation rate in males than females. It is thus probably caused by a difference in per-replication mutation rates between the sex chromosomes. This suggests that the local mutation rate can change in a relatively short evolutionary time.


    Introduction
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Sex chromosomes are well known as an extreme instance of differences in gene density and recombination rates. The Y chromosomes of many species are genetically degenerate. Animal Y chromosomes carry many fewer genes than the ancestrally homologous X chromosomes (Lucchesi 1978; Lahn and Page 1999Citation ), though in plants with Y chromosomes it is not yet known whether these have lost many genes that are present on the X. Y chromosome degeneration is probably an evolutionary consequence of the lack of recombination, which makes natural selection less effective than in recombining regions of genomes (Charlesworth 1994; Charlesworth and Charlesworth 2000Citation ). When recombination is rare or absent, nonindependence of selection at different loci reduces the effective population size and may allow slightly deleterious substitutions that would otherwise be eliminated (Charlesworth 1994Citation ; Charlesworth and Charlesworth 2000Citation ; McVean and Charlesworth 2000Citation ). Deleterious mutations will accumulate and become fixed by the stochastic process of Muller's ratchet (stochastic loss of chromosomes with the fewest mutations; Gordo and Charlesworth 2000) and also by hitchhiking processes associated with the spread of advantageous mutations (selective sweeps; Rice 1987) and elimination of deleterious ones (background selection; Charlesworth 1994Citation ). In contrast, X chromosomes are gene rich and recombine in female meiosis, and natural selection may be even more effective than on the autosomes because of exposure of recessive mutations in hemizygous males (Charlesworth, Coyne, and Barton 1987Citation ).

The processes just described for Y chromosome degeneration all reduce effective population sizes for Y-linked genes, compared with the X chromosome. This should lead to reduced sequence diversity in degenerating Y chromosomes and to reduced efficacy of selection in Y-linked coding sequences (Charlesworth and Charlesworth 2000Citation ). The efficacy of selection can be examined by studying silent and nonsynonymous site divergence between homologous genes of related species. Assuming neutrality of mutations at silent sites, the substitution rate estimates the mutation rate (Kimura and Ohta 1971Citation ). Such sites should diverge in proportion to the product of the mutation rate and divergence time, and differences in silent site divergence between genes will reflect differences in their mutation rates (Kimura 1983Citation ).

If selection is less effective for Y chromosomal genes, nonsynonymous site divergence (Ka) should be higher, relative to divergence at silent sites (Ks), in the coding sequences of Y-linked than X-linked genes. We should thus find higher Ka/Ks values for Y-linked genes. It is difficult to test for faster accumulation of deleterious mutations in Y-linked genes, because many animal Y chromosomes are almost completely degenerate and contain very few genes. Of the small number of known human genes and pseudogenes with both X- and Y-linked copies (Lahn and Page 1999Citation ), few homologous sequences from non-human species have been studied. Comparisons of sequences of the SMCX-SMCY pair of genes from humans, the horse, and the mouse yielded a Ka/Ks ratio for SMCY about an order of magnitude higher than that for SMCX, supporting a reduced efficacy of selection for SMCY (Agulnik et al. 1997Citation ). Much smaller differences were, however, reported for the avian sex-linked CHD1 genes (Fridolfsson and Ellegren 2000Citation ). The human Y-linked DAZ gene, which has no X-linked homologue, can be compared with a homologous autosomal gene, DAZL1. The higher Ka/Ks ratio for DAZ could indicate reduced selective constraint (Agulnik et al. 1998Citation ), but a recent analysis suggests that the high Ka/Ks ratio in the DAZ gene is caused by a few sites undergoing directional selection, whereas other sites are under purifying selection (Bielawski and Yang 2001Citation ).

High divergence between animal X and Y chromosomes (Lahn and Page 1999Citation ) makes Ka and Ks estimates unreliable. Interpretation of such results is also difficult because an observed high Ka/Ks value for Y-linked genes may be caused by divergence in function (for example murine Zfy1 and Zfy2; see Johnston, Shimeld, and Sharpe 1998Citation ) rather than by lower efficacy of selection on the Y chromosome. Thus, for a reliable comparison of the substitution rates on the X and Y chromosomes, one should compare several homologous X- and Y-linked genes that are not too divergent from each other. Comparisons of five pairs of X- and Y-linked genes on the Drosophila miranda neo-Y and neo-X chromosomes have demonstrated higher Ka/Ks on the neo-Y chromosome (Yi and Charlesworth 2000Citation ; Bachtrog and Charlesworth, 2002Citation ). Two of the Y-linked genes may have lost function because the Ka/Ks ratio estimated from divergence from D. pseudoobscura is close to one, and no expression data are available (Yi and Charlesworth 2000Citation ). Three genes, however, have low Ka/Ks, suggesting that both neo-Y and neo-X copies are functional, yet Ka/Ks on the neo-Y branch of the phylogeny is significantly higher than that on the branch to the neo-X (Bachtrog and Charlesworth, 2002Citation ).

The Ka/Ks tests use relative nonsynonymous and silent site divergence values to compensate for possible differences in mutation rates between the two sex chromosomes, and it is also of interest to test for such differences. On the autosomes, deleterious recessive mutations are sheltered by a second copy of the gene in females, whereas in males the X is hemizygous, and such mutations are exposed to selection. It should therefore be advantageous to reduce the X chromosome mutation rate (Kondrashov 1995; McVean and Hurst 1997Citation ). Theoretical arguments indeed suggest that the selective advantage of modifiers reducing the mutation rate on the X chromosome is higher than that for the autosomes (McVean and Hurst 1997Citation ). On the other hand, Y chromosomes often carry few genes, and their mutation rate can probably increase without negative consequences for fitness. Synonymous substitution rates may therefore differ between the sex chromosomes. We have previously shown that the low diversity of the first Silene latifolia Y-linked gene studied (SlY1) is not attributable to a reduced Y chromosome mutation rate; rather, it appears to evolve faster than its X-linked homologue (Filatov et al. 2001Citation ), in line with this theory. This finding, however, implies that one cannot test for differences in the efficacy of selection without also testing for mutation rate differences.

In species with male heterogamety, Y chromosomes are confined to males; therefore, they experience more cell divisions per generation than X chromosomes because of a greater number of cell divisions in the male germline (there are often more divisions per sperm than per egg). Although plants have no germ line (Poethig, Coe, and Johri 1986Citation ), more cell divisions occur in pollen than ovule production (Klekowski 1988Citation ). This may lead to the male-driven evolution effect: a higher mutation frequency in male than female gametes (Miyata et al. 1987Citation ; Shimmin, Chang, and Li 1993Citation ; Ellegren and Fridolfsson 1997Citation ; Smith and Hurst 1999Citation ). This alone can cause Y chromosomal genes to have higher mutation rates than X-linked ones. It is difficult to distinguish between this effect and a true difference in mutation rates (per replication) between the sex chromosomes because both processes lead to slower divergence of X-linked sequences than Y-linked ones (Smith and Hurst 1999Citation ). In birds, however, female heterogamety means that the two factors have opposing effects, and observations of a higher Z than W (female specific) chromosome mutation rate thus support a male-driven evolution effect (Ellegren and Fridolfsson 1997Citation ). In species with male heterogamety, the two hypotheses can be discriminated by comparing silent substitution rates of Y- and X-linked genes (RY, RX) and autosomal genes (RA), because autosomes are less restricted to females than is the X. It has been shown that under male-driven evolution, RY/RX <= 3, and RX/RA >= 2/3 (Miyata et al. 1987Citation ). On the basis of comparisons of X-linked and autosomal sequences from different species, a RX/RA value of 0.62 was estimated for rodents. The observed reduction in the X-chromosomal silent substitution rate for rodents is therefore too great to be explained by male-driven evolution, suggesting a true lower per-replication mutation rate of X-linked genes (McVean and Hurst 1997Citation ; Smith and Hurst 1999Citation ). Y-linked genes did not differ significantly from the autosomes, though there are few data (McVean and Hurst 1997Citation ). A recent analysis of divergence between mouse, rat, and human orthologues found chromosome-specific mutation rates, with the X-chromosome mutation rate lower than that of most, though not all, of the autosomes (Lercher, Williams, and Hurst 2001Citation ).

Here, we describe several tests for reduced efficacy of selection in Y-linked genes of the dioecious plant species S. latifolia and S. dioica, including analyses of codon usage in homologous X- and Y-linked genes. We also compare silent substitution rates on the sex chromosomes and find a higher rate on the Y than the X chromosome. Our results suggest that male-driven evolution is not the cause of the observed substitution rate differences. Per-replication mutation rates may therefore differ between the sex chromosomes, as in rodents.

The two species used in this study have chromosomal sex determination (XY males and XX females; Westergaard 1959Citation ). The species are close relatives (Goulson and Jerrim, 1997Citation ) and have morphologically similar sex chromosomes (Westergaard 1959Citation ). Silent site divergence between the two species is low for the two pairs of sex-linked genes for which extensive sequences are so far available (1.4% and 2.7% for the SlX1 and SlY1 genes, respectively, and 1.3% and 1.2% for SlX4 and SlY4), whereas divergence of these genes in either species from the homologues in nondioecious relatives is much higher (table 1 and fig. 1 ). The S. latifolia and S. dioica sex chromosomes probably evolved before the species separated. Consistent with this, silent site divergence between SlX4 and SlY4 is 15.5% for both dioecious species, much higher than that between the species. Between SlX1 and SlY1, however, divergence is only 2%, though SlX1 and SlY1 do not recombine (Filatov et al. 2000Citation ). Recombination between these genes may therefore have ceased recently (Atanassov et al. 2001Citation ). The difference in divergence between the SlX4-SlY4 and SlX1-SlY1 pairs of genes resembles the evolutionary strata discovered in human sex chromosomes (Lahn and Page 1999Citation ). One advantage of these species is the relatively low age of the sex chromosomes (Desfeux et al. 1996Citation ), so that divergence between homologous X- and Y-linked genes is low compared with animal sex chromosomes. The low divergence of the homologous X- and Y-linked genes, and the low Ka/Ks values in their coding sequences, allows us to assume that these genes have similar functions and experience similar selective pressures. Furthermore, most other species in the genus Silene do not have separate males and females (dioecy) and thus have no sex chromosomes (Desfeux et al. 1996Citation ). Thus, we can compare genes on the sex chromosomes with non–sex chromosomal homologues in nondioecious relatives, avoiding the difficulties of comparing different sets of genes between the sex chromosomes and autosomes (Smith and Hurst 1999Citation ).


View this table:
[in this window]
[in a new window]
 
Table 1 Estimates of Pairwise Divergence (D) Between the Two S. latifolia and S. dioica Sex-Linked Genes and the Non–Sex-Linked Homologues from S. vulgaris. The Divergence Estimates are Jukes-Cantor Distances ± Standard Error (SE) per 100 Sites. N Stands for the Number of Sites in Each Pairwise Comparison, and Subscripts of the D and N Parameters Indicate Types of Sites (t stands for total sites, i for intron sites, and sites in coding regions are denoted by a and s, for amino acid replacement and synonymous sites, respectively)

 


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1.—Exon-intron structure of the genes studied showing the regions sequenced. The exon-intron structure was inferred from comparison of the genomic DNA and cDNA sequences (Delichere et al. 1999Citation ; Filatov et al. 2000Citation ; Atanassov et al. 2001Citation ). Regions sequenced in the present study are indicated, and positions and directions of the PCR and sequencing primers are shown by small arrows. The following PCR primers were used: XY1+1 GATGGGGCCCGTTGATTGAGG, Y1-8 ACCCAAGTATTCTTTCCGTACC, XY1+3 AGGCTCGTTCTCCCTTTGTG, X1-7 ACTTGCAACGACTTCACTTTGAG, Y1+18 CCTCTTAACAAGATTCACTACGTC, XY1-10 TCCAGCAGAGCTTGAACAGTC, XY4+1 ACAATTGGTAGTAGATGTAAATG, X4-3 AATTACCGAAGACAGTAAAGCGTC, Y4-7 AATCACACAGTTGATCTCATTTTCC, and XY4-14 GTGGTCAATCACACAGTTGATATC. Sequencing primers are available on request.

 

    Materials and Methods
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Isolation of Genes
Genomic DNA was isolated from leaves of individual plants of each of the species as described earlier (Filatov and Charlesworth 1999). All PCR amplifications were done with ExpandTM High Fidelity PCR System (Boehringer Mannheim) and the following primer pairs (see fig. 1 ): XY1+1 and X1-7 for the S. latifolia SlX1 gene, XY1+1 and Y1-8 for the S. latifolia SlY1 gene, XY1+3 and X1-7 for the S. dioica SlX1 gene, Y1+18 and XY1-10 for the S. dioica SlY1 gene, XY1+1 and XY1-10 for the S. vulgaris and Lychnis flos-jovis gene homologous to SlX1 and SlY1, XY4+1 and X4-3 for the S. latifolia and S. dioica SlX4 gene, XY4+1 and Y4-7 for the S. latifolia and S. dioica SlY4 gene, XY4+1 and XY4-14 for the homologue of SlX4 and SlY4 in S. vulgaris and L. flos-jovis. SlX1, SlY1, SlX4, and SlY4 are single copy genes in S. latifolia (Delichere et al. 1999Citation ; Atanassov et al. 2001Citation ), and only one band was amplified from S. vulgaris and L. flos-jovis for these genes. The amplification products were cloned using the TOPO TA Cloning Kit (Invitrogen) and sequenced using an ABI Prism 377 automatic sequencer (Perkin-Elmer) and 29 specific primers (available on request). The ABI chromatogram sequence files were corrected, and contigs were assembled using ProSeq v2.9 (Filatov 2001Citation ). The sequences were aligned by the ClustalW Version 1.8 program (Thompson, Higgins, and Gibson 1994Citation ). Alignment of a 0.15-kb AT-rich region from intron 12 of the SlX1-SlY1 was uncertain because of multiple insertions and deletions, and this region was removed from the final alignment (fig. 1 ).

GenBank accession numbers for the sequences reported in this paper: AY084036, AY084037, AY084038, AY084039, AY084040, AY084041, AY084042, AY084043, AY084044, AY084045, AY084046, AY084047.

Nucleotide Substitution Rates
Pairwise divergence values and the topology of the gene trees were calculated using MEGA software (Kumar, Tamura, and Nei 1994Citation ). These topologies were used in the maximum likelihood (ML) analyses described subsequently. In all the ML analyses assuming a local molecular clock (Yoder and Yang 2000Citation ), substitution rates were assigned to the different branches shown in figure 2 . Likelihood ratio (LR) tests (Muse and Weir 1992Citation ) were used to test the significance of differences in substitution rates. LR tests, and the ML estimates of the relative substitution rates, were done with the baseml program from the PAML Version 3e package (Yang 2001Citation ). To compare nonsynonymous substitution rates in the SlX4 and SlY4 genes, we used ProSeq Version 2.9 (Filatov 2001Citation ) to extract all first and second codon positions from the data set for these genes, for use in the LR test. Similarly, to compare silent substitution rates in the X- and Y-linked genes, we performed LR tests on noncoding and fourfold degenerate sites. To obtain the ML estimates of the ratios of the substitution rates (RY/RX, RX/RA) and their standard errors, we assigned a sequence whose rate is the denominator to be the ancestral sequence (rate "#0" in baseml notation; see Yang 2001Citation ) and used the local molecular clock (Yoder and Yang 2000Citation ) with three substitution rates assigned as shown in figure 2 . The relative rates estimated by the baseml program estimate the RY/RX or RX/RA ratios depending on whether the X-linked or the autosomal sequence was assigned as ancestral.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2.—Neighbor-joining tree for fourfold degenerate and noncoding (mostly intron) sites of the (A) SlX1-SlY1 and (B) SlX4-SlY4 genes (2,618 and 699 sites, respectively) and their non–sex-linked homologues from S. vulgaris and L. flos-jovis. The branch lengths (Jukes-Cantor distances) were calculated using the baseml program (Yang 2001Citation ), assuming a separate substitution rate for each branch. Different shadings show locations of the genes: white for non–sex-linked genes, black for Y-linked, grey for X-linked genes. The branches correspond to the assignment of the three substitution rates in the baseml analysis and to the three Ka/Ks ratios in the codeml analysis (see Materials and Methods). Branch lengths are omitted for very short branches

 
To estimate Ka/Ks ratios for the X- and the Y-linked genes, the codeml program from the PAML Version 3e package (Yang 2001Citation ) was used, assuming the phylogeny in figure 2 . Each branch was assumed to have a separate substitution rate (no clock mode), and three Ka/Ks ratios were assigned as shown in figure 2 by different branch shadings. For the LR test, the model with three Ka/Ks ratios was compared with one with just two ratios, one for autosomal and one for the X- and the Y-linked genes.

Amino Acid Substitution Patterns
To compare the amino acid substitution patterns in the SlX4 and SlY4 genes, we used the approach of Wyckoff, Wang, and Wu (2000)Citation , using the codon mutation patterns tool of the ProSeq Version 2.9 software (Filatov 2001Citation ). As the S. dioica and S. latifolia amino acid sequences are nearly identical, only the S. latifolia-coding sequences were analyzed. Assuming the tree topology shown in figure 2B, the sequence of the gene ancestral to SlX4 and SlY4 was reconstructed using parsimony (Fitch 1971Citation ). Synonymous substitutions in the SlX4 and SlY4 genes were counted, and nonsynonymous substitutions were classified into four classes according to the Grantham (1974)Citation distance (D): conservative (D < 51), moderate (50 < D < 101), radical (100 < D < 151), and very radical (D > 150). The expected numbers (±Standard error [SE]) of mutations in each class were obtained in 5,000 repetitions of the following simulation (Wyckoff, Wang, and Wu 2000Citation ). Mutations were introduced as follows: the site of each mutation was chosen randomly and its nucleotide mutated to any other nucleotide, assuming transitions to be 1.5 times more frequent than transversions (based on the average transition-transversion ratio for the SlX4 and SlY4 genes). The ancestral coding sequence was mutated until the number of mutations at either synonymous sites (referred to subsequently as "expected S") or nonsynonymous sites ("expected N") reached the observed value.

Codon Bias
To detect preferred codons in Silene, we followed the approach proposed by Akashi (1995)Citation . We used 36 S. latifolia cDNA sequences from GenBank that have open reading frames (8,353 codons in total; accession numbers: M16887, X94358, Y12529, Y12603, X02432, Y08773, Y08774, Y08775, Y08776, Y08777, Y08778, Y08779, Y08780, Y12324, Y12325, AB000108, D82026, D82027, AB013611, AB013612, AF062480, Y08155, X02965, M16888, X80488, X80489, X80490, X80491, X80492, Y18517, Y18519, U53828, U53829, U53827, AJ310658, AJ310657). For these sequences, we calculated two measures of codon bias, the scaled {chi}2 (Shields et al. 1988Citation ) and the effective number of codons (ENC, see Wright 1990Citation ), as well as the relative usage of each codon (Akashi 1995Citation ), using ProSeq Version 2.9 software (Filatov 2001Citation ). To classify synonymous codons as preferred versus unpreferred, we tested for codons that are positively correlated with genes having high codon bias (Akashi 1995Citation ), assessing significance by t-tests (Sokal and Rohlf 1995Citation , p. 575).

To compare substitution patterns in the X- and Y-linked genes, we used the reconstructed coding region of the sequence ancestral to the SlX4 and SlY4 genes (see previously). Synonymous substitutions in the SlX4 and SlY4 genes were classified into preferred and unpreferred, and the numbers of such substitutions were compared by a G-test in a 2 x 2 contingency table (Sokal and Rohlf 1995Citation , pp. 725–743).

GC Content and Nucleotide Substitution Patterns
Stationarity of GC content was tested by the method proposed by Eyre-Walker (1994)Citation , as implemented in ProSeq Version 2.9 (Filatov 2001Citation ). In all pairwise comparisons of homologous sequences the numbers of nucleotides that are A or T in one sequence and G or C in the other, and vice versa, were counted and compared by G-tests.

Spontaneous deamination of 5-methylcytosine in methylated CG dinucleotides causes C->T transitions with high frequency (Robertson and Wolffe 2000Citation ). The role of methylation was tested using the following methods implemented in ProSeq Version 2.9 (Filatov 2001Citation ). The simplest method to detect the effect of methylation is to compare the observed number of CG pairs with that expected from the GC content. A deficiency of observed CG pairs suggests an effect of methylation. To test whether methylation may be the cause of differences in mutation rates in different genes, we compared the proportion of C->T transitions in CG pairs in the X- and Y-linked genes, using the nucleotide mutation patterns tool in ProSeq Version 2.9 (Filatov 2001Citation ). If the higher mutation rate on the Y is caused by more methylation than on the X chromosome, the proportion of such mutations is expected to be higher in the Y-linked than in the X-linked genes.


    Results
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Replacement Substitutions
Figure 1 shows the regions of the two genes sequenced, and Figure 2 shows trees for the two genes studied. Both outgroups are consistent in the position of the node which roots the homologous X- and Y-linked sequences. Figure 2 also shows the estimated divergence values between the sequences. Between the SlX1 and SlY1 genes of either S. latifolia or S. dioica, there were no replacement site differences, but between SlX4 and SlY4, Ka = 2.4 ± 0.5% for S. latifolia and 1.6 ± 0.4% for S. dioica. To compare the replacement substitution rates in these genes, we estimated their nonsynonymous site divergence from the homologous outgroup sequence of S. vulgaris (table 1 ). The nonsynonymous substitution rates are higher in the SlY4 gene than in SlX4, for both S. latifolia and S. dioica, but the SlY4 synonymous rates are also higher (table 1 ). The Ka values for the SlX4 and SlY4 genes differ significantly. This conclusion was confirmed by ML analysis of the substitution rates in the first and the second coding positions (740 bp) of the SlX4-SlY4 genes. A model with three rates (X-linked, Y-linked, and non–sex-linked; 2{Delta}L = 12.52, P < 0.001 by {chi}2 with df = 1) fits the data significantly better than the model with two rates (with X- and Y-linked genes having the same rate and different non–sex linked rate).

As explained previously, however, different nonsynonymous substitution rates in the SlX4 and SlY4 genes may result from either differences in the efficacy of selection in these genes or different mutation rates. The higher silent substitution rate in SlY4 than SlX4 suggests that the high SlY4 nonsynonymous rate may not indicate reduced efficacy of selection. To compensate for different mutation rates, we therefore compared Ka/Ks ratios for the X- and Y-linked genes. The ratio for SlY4 (Ka/Ks = 0.119 ± 0.0019) was only slightly higher than that for the SlX4 gene (Ka/Ks = 0.115 ± 0.0040), and the difference is not significant. LR test (see Materials and Methods), was also nonsignificant (2{Delta}L = 0.0).

Evolution of the X- and Y-Linked Amino Acid Sequences
If the efficacy of selection is lower in Y- than X-linked genes, another prediction is that Y-linked genes should accumulate more substitutions of nonconservative amino acids. We therefore compared the types of amino acid replacements in the SlY4 and SlX4 genes by estimating the numbers and types of mutations in the coding region of the S. latifolia SlX4 and SlY4 genes since they became separated (table 2 ). Silene dioica sequences are very similar to those of S. latifolia, and nearly all nonsynonymous differences between SlX4 and SlY4 in S. dioica are identical to those in S. latifolia. This analysis was not conducted for the SlX1-SlY1 genes because there are no nonsynonymous substitutions between these genes.


View this table:
[in this window]
[in a new window]
 
Table 2 Substitutions in the Coding Regions of the SlX4-SlY4 Genes. Data are Partitioned Into Synonymous and Four Nonsynonymous Substitution Classes According to the Physicochemical Differences Represented by Grantham Distances (D) (Grantham 1974) Between the Amino Acids. Expected Numbers of Substitutions (± standard deviation) Were Calculated, Given the Observed Number of Synonymous (S) or Pooled Nonsynonymous (N) Sites

 
Fourteen amino acid replacements were detected in the S. latifolia SlY4 gene but only three in SlX4 (table 2 ), which limits the sensitivity of the analysis. For both SlX4 and SlY4, the number of replacements in all nonsynonymous categories (see Materials and Methods) was lower than that expected from simulations conditioned on the observed number of silent substitutions in these genes (Wyckoff, Wang, and Wu 2000Citation ), in agreement with their low Ka/Ks ratios. The observed distribution of amino acid replacements also did not differ significantly from that expected, conditioning the simulations on the observed numbers of nonsynonymous substitutions (pooling the four nonsynonymous classes), suggesting that selection has not altered the pattern of replacements in the SlY4 gene.

Codon Bias
Low efficacy of selection for Y-linked genes also predicts reduced codon bias in Y- compared with X-linked genes. We cannot compare segregating and fixed synonymous substitutions on the X and Y chromosomes (Akashi 1995Citation ) because there are few sequence variants in the Y-linked genes (Filatov et al. 2000, 2001Citation ). As an alternative, we compared the numbers of substitutions from preferred to unpreferred synonymous codons (referred to below as "unpreferred" substitutions) and unpreferred to preferred codons ("preferred" substitutions) in the SlX4 and SlY4 genes. If there is selection for codon usage in the X-linked genes, but it is less effective for Y-linked genes, this should result in excess unpreferred over preferred substitutions in the Y-linked genes. The average codon bias of S. latifolia genes is low, with a mean ENC (Wright 1990Citation ) of 54.7 and a range of 36.9–61. Only 11 codons, each for a different amino acid, are significantly positively correlated with codon bias and may thus be inferred to be major codons (TTC, CTC, ATA, GTC, TCA, ACT, CAC, AAC, AAG, GAG, and GGA). Seven other codons, encoding a further six different amino acids (CCA, GCA, CAG, GAC, TGT, CGT, AGG), show substantial positive, but nonsignificant, correlations with codon bias, suggesting that these codons may also be preferred in S. latifolia. However, more cDNA sequences will be needed to test this.

Using only the putative major codons, eight unpreferred and two preferred substitutions were observed in the SlY4 gene and only one preferred substitution in SlX4. The excess of unpreferred over preferred substitutions in the SlY4 gene is marginally significant (G-test = 3.85, P < 0.05). Using all 18 codons positively correlated with codon bias, regardless of significance, we find 12 unpreferred and seven preferred synonymous substitutions in SlY4 (G-test = 1.33, NS) versus one preferred in the SlX4 gene. There are only six synonymous differences between SlY1 and SlX1, so this analysis is not possible for these genes.

Silent Substitution Rates
As noted previously, the intron and synonymous site divergence of the SlY4 gene from its homologue in the nondioecious S. vulgaris are significantly higher than that in SlX4 (table 1 ). A similar, but less pronounced, effect is found for SlY1 and SlX1 (table 1 ). To test the significance of the substitution rate differences in the branches of the gene trees for X- and Y-linked and autosomal loci (fig. 1 ), we did LR tests (Muse and Weir 1992Citation ) using the local molecular clock mode of the baseml program (Yang 2001Citation ). We estimated the likelihood of the null model with three evolutionary rate parameters, one for each of the X-linked, Y-linked, and non–sex-linked branches (fig. 2 ). This was compared with the likelihoods of the following alternative models with two rate parameters (table 3 ): (1) X- and Y-linked genes forced to have the same rate, (2) X-linked and non–sex-linked gene rates forced to be equal, and (3) Y-linked and non–sex-linked genes having the same rate. The three-parameter model fits the data significantly better than any of the two-parameter models (table 3 ). Thus, silent substitution rates differ significantly between the X- and Y-linked and non–sex-linked genes, with both X-linked genes having significantly lower substitution rates than either their Y-linked or non–sex-linked homologues.


View this table:
[in this window]
[in a new window]
 
Table 3 Log-Likelihood Ratios for the Comparison of the Null Model, with Three Substitution Rates, and the Three Models with Two Rates (see text). The Significance is Tested Using the Approximation That the Log-Likelihood Ratios are Chi-square–Distributed (Muse and Weir 1992). The Chi-square Values Have One Degree of Freedom, as the Models Differ by One Parameter

 
Male-Driven Evolution
To test for male-driven evolution, we estimated RY/RX and RX/RA ratios and their SE by ML, assuming the gene tree topologies in figure 2 and using the model with three substitution rates described previously. All the ratios were estimated for silent sites, using only fourfold degenerate and noncoding (mostly intron) sites (2,618 sites for the SlY1-SlX1 genes, and 699 sites for the SlY4-SlX4 genes). RX/RA is 0.25 ± 0.06 for SlY1-SlX1 and 0.47 ± 0.15 for SlY4-SlX4, both significantly below 2/3. For SlY4-SlX4, RY/RX is 4.24 ± 1.18, marginally significantly greater than three. Thus, the difference in substitution rates for these genes is difficult to explain by male-driven evolution. For the SlY1 and SlX1 genes, however, RY/RX is 1.91 ± 0.39, well within the range predicted under male-driven evolution.

Possible Causes of Mutation Rate Differences
In mammals, the substitution rates of different genomic regions have been reported to correlate with their GC contents (Wolfe, Sharp, and Li 1989Citation ), though this was recently questioned (Hurst and Williams 2000Citation ). The possibility of different GC contents of the X- and Y-linked sequences is therefore worth examining. However, GC content is similar in all the species compared (data not shown). We also found no significant nonstationarity of the GC content of the genes studied, using the approach proposed by Eyre-Walker (1994)Citation .

Methylation is another possible cause of substitution rate differences between X- and Y-linked and autosomal genes. The observed numbers of CG pairs were significantly lower than that expected (in brackets) from the overall GC content. For S. latifolia, the values were, for SlY4 and SlX4, respectively: 42 (78), 47 (78), and for S. dioica SlY4 and SlX4 42 (76) and 49 (78). The deficiency of CG pairs is even greater in the SlX1 and SlY1 genes: 52 (123), 56 (124), 60 (125), 58 (124) for S. latifolia SlY1 and SlX1, and S. dioica SlY1 and SlX1 genes, respectively. This suggests that methylation inflates the number of C->T transitions in these genes. If the higher mutation rate in Y-linked genes is caused by overmethylation of the Y chromosome, C->T mutations should be a higher proportion of all mutations in CG dinucleotides, in Y-linked compared with X-linked genes. To test this, we used the reconstructed ancestral sequences (see Materials and Methods) to estimate these proportions for the X- and Y-linked genes. For the two dioecious species, the average proportion of C->T transitions in CG dinucleotides is higher in the X-linked genes (8.3% for SlX1 and 12.5% for SlX4) than in their Y-linked homologues (8.1% for SlY1 and 8.9% for SlY4). Thus, although methylation is an important mutagenic factor in these genes, the difference in substitution rates between the Y and the X chromosomal genes is not attributable to methylation.

To compare mutation patterns in the Y- and X-linked genes, we also counted the numbers of all types of mutations by comparing the ancestral and the actual sequences. The difference in mutation pattern between the homologous X- and Y-linked genes was significant neither for all sites nor for just silent sites. However, the transition (ts)/transversion (tv) ratio for SlY4 was much lower (1.24 ± 0.005) than that for the SlX4 gene (1.82 ± 0.016). A similar trend was observed in the SlX1 (ts/tv = 2.14 ± 0.015) and the SlY1 (ts/tv = 1.88 ± 0.009) pair of genes. The reasons for these differences in the substitution pattern are unclear, but this is the opposite of what would be expected if the difference were caused by C->T transitions in CG dinucleotides caused by methylation differences. The number of (C or G)->(A or T) substitutions is not significantly different from the number in the opposite direction (2 x 2 contingency G-test), corroborating our conclusion that GC content in these genes does not deviate significantly from stationarity.


    Discussion
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Selection on Genes in the X and Y Chromosomes
As explained previously, the effective population size, Ne, in the nonrecombining regions of Y chromosomes is predicted to be reduced, compared with that in the homologous X-linked genes. The consequent lower effectiveness of both positive and negative selection is thought to be the main cause of the genetic degeneration of the Y chromosome (Charlesworth and Charlesworth 2000Citation ). Previously, we demonstrated greatly reduced DNA diversity in the SlY1 gene compared with the SlX1 (Filatov et al. 2000, 2001Citation ). DNA diversity is about an order of magnitude lower in the Y-linked, compared with the orthologous X-linked gene, in S. latifolia and S. dioica. Similar results have been obtained for the SlY4 and SlX4 genes (V. Laporte, D. Filatov, and D. Charlesworth, unpublished data). A substantially reduced efficacy of natural selection is therefore also expected in Y-linked genes.

Whether reduced effective population size leads to a higher nonsynonymous replacement rate depends on the distribution of the selection coefficients on such mutations, which is unknown (Keightley 1998Citation ). If selection against amino acid replacements is strong enough, the 10-fold reduction in the effective population size on the Y chromosome could still leave Ne sufficiently large that selection can maintain genes' amino acid sequences, accounting for our finding of no significant difference in the distribution of amino acid replacements between the SlX4 and SlY4 genes.

To detect a reduced effectiveness of natural selection, it may thus be most helpful to analyze weakly selected substitutions. In both SlX4 and SlY4, even conservative amino acid replacements accumulate less than expected under neutrality (table 2 ). Selection acting on synonymous codons should, however, be weak. For D. melanogaster the selection coefficient was estimated to be about 10-5 (Akashi 1995Citation ). We indeed detect a significant excess of unpreferred over preferred synonymous substitutions in SlY4. However, this is only marginally significant, and there are too few substitutions in SlX4 to compare the X- and Y-linked homologues. More data are needed, both to establish the preferred codons in Silene and to have sufficient data from sex-linked genes to draw more reliable conclusions. It seems unlikely, however, that a reduced Y-chromosome effective population size can explain both the higher synonymous and nonsynonymous divergence for Y-linked genes. The relationship between Nes and expected divergence is nonlinear (see Akashi, Kliman, and Eyre-Walker 1998Citation ). It is therefore unlikely that nonsynonymous and synonymous substitution would be affected to the same degree, so this hypothesis cannot account for the absence of a higher Ka/Ks ratio in SlY4 compared with the SlX4 gene.

Our findings therefore suggest that a higher mutation rate on the Silene Y chromosome may be responsible for the higher number of amino acid replacements in SlY4, rather than reduced efficacy of selection. In principle, it is possible to distinguish these possibilities using diversity and divergence data (McDonald and Kreitman 1991; Akashi 1995Citation ). Unfortunately, the diversity on the Y chromosome is too low (Filatov et al. 2000, 2001Citation ), and this analysis will not be possible without large amounts of sequence data to provide sufficient variants.

Mutation Rates on the X and Y Chromosomes
It is clear that the silent substitution rate in the Y-linked genes is higher than that in the X-linked homologues (figure 2 ), and LR tests demonstrate the significance of the differences in silent substitution rates between the X-linked, Y-linked, and non–sex-linked genes (table 3 ). The most parsimonious explanation for the differences in silent substitution rates is that the mutation rates differ. Assuming that the ancestral mutation rate for the X- and Y-linked genes was the same as the rate in the non–sex-linked genes in S. vulgaris and L. flos-jovis, our results show a reduction in both X-linked genes and acceleration in SlY4. Even without this assumption, the X-linked rate is significantly lower than in the Y-linked genes, and at least for the SlY4-SlX4 gene, this is difficult to explain solely by male-driven evolution.

If the effect observed in Silene is caused by a higher number of cell divisions during pollen compared with ovule production, it must affect both SlX1-SlY1 and SlX4-SlY4 gene pairs. The difference between SlX1 and SlY1 is much lower than that between the SlX4 and SlY4 genes, however, suggesting that male-driven evolution is not the chief cause of the difference in silent substitution rates. Furthermore, for the substitution rate on the Y chromosome to be three times higher than that on the X chromosome, an enormous excess of cell divisions (and mutations) in males, compared with females, is required (Miyata et al. 1987Citation ). This might occur in wind-pollinated plants, which produce huge amounts of pollen (though this is not largely caused by extra cell divisions per generation). It is certainly not plausible for S. latifolia and S. dioica, which are pollinated mostly by moths (Goulson and Jerrim 1997Citation ) and have moderate pollen production. Lower mutation rates on the X chromosome, and higher rates on the Y chromosome, have often been interpreted as resulting from male-driven evolution (Shimmin, Chang, and Li 1993Citation ; Huang et al. 1997Citation ). Our results suggest that this effect is unlikely to be the main cause of the different silent substitution rates between the Silene sex chromosomes. Although we cannot rule out a contribution from male-driven evolution, it seems likely that the differences between the X- and Y-linked genes' substitution rates reflect different per-replication mutation rates.

The reasons for different mutation patterns and rates between different regions of genomes are poorly understood (Matassi, Sharp, and Gautier 1999Citation ; Eyre-Walker and Hurst 2000Citation ; Lercher, Williams, and Hurst 2001Citation ), and the same is true for Silene. We cannot account for the observed substitution rate difference between the X- and the Y-linked genes in terms of different GC content (Wolfe, Sharp, and Li 1989Citation ; Hurst and Williams 2000Citation ). Although recombination itself may be mutagenic (Strathern, Shafer, and McGill 1995Citation ) and there are, of course, differences in the recombinational environment between the X- and the Y-linked genes, the trend is in the opposite direction from that required to explain the mutation rate difference: the nonrecombining Y chromosome has the higher mutation rate. The S. latifolia Y chromosome is more methylated than the X chromosome (Vyskot et al. 1993Citation ), which could lead to more C->T transtitions caused by deamination of 5-methyl cytosine (Robertson and Wolffe 2000Citation ). Our analysis demonstrated that this hypothesis also does not explain the difference in mutation rates between the X- and the Y-linked genes. Interestingly, the fairly recent origin of the Silene sex chromosomes (Desfeux et al. 1996Citation ) and the moderate divergence between the homologous X- and Y-linked genes in the dioecious species, imply mutation rate changes within a few million years.


    Acknowledgements
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
D.C. was supported by the Natural Environment Research Council of Great Britain, D.A.F. by a grant to D.C. from the Leverhulme Trust and by start-up funds from the University of Birmingham.


    Footnotes
 
Wolfgang Stephan, Reviewing Editor

Keywords: sex chromosomes efficacy of selection mutation rates Back

Address for correspondence and reprints: Dmitry A. Filatov, School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, United Kingdom. d.filatov{at}bham.ac.uk . Back


    References
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 

    Agulnik A. I., C. E. Bishop, J. L. Lerner, S. I. Agulnik, V. V. Solovyev, 1997 Analysis of mutation rates in the SMCY/SMCX genes shows that mammalian evolution is male driven Mamm. Genome 8:134-138[Web of Science][Medline]

    Agulnik A. I., A. Zharkikh, H. Boettger-Tong, T. Bourgeron, K. McElreavey, C. E. Bishop, 1998 Evolution of the DAZ gene family suggests that Y-linked DAZ plays little, or a limited, role in spermatogenesis but underlines a recent African origin of human populations Hum. Mol. Genet 7:1371-1377[Abstract/Free Full Text]

    Akashi H., 1995 Inferring weak selection from patterns of polymorphism and divergence at "silent" sites in Drosophila DNA Genetics 139:1067-1076[Abstract]

    Akashi H., R. M. Kliman, A. Eyre-Walker, 1998 Mutation pressure, natural selection, and the evolution of base composition in Drosophila Genetica 103:49-60

    Atanassov I., C. Delichère, D. A. Filatov, D. Charlesworth, I. Negrutiu, F. Monéger, 2001 A putative monofunctional fructose-2,6-bisphosphatase gene is located on X and Y sex chromosomes in white campion (Silene latifolia) Mol. Biol. Evol 18:2162-2168.[Abstract/Free Full Text]

    Bachtrog D., B. Charlesworth, 2002 Reduced adaptation of a non-recombining neo-Y chromosome Nature 416:323-326[Web of Science][Medline]

    Bielawski J. P., Z. Yang, 2001 Positive and negative selection in the DAZ gene family Mol. Biol. Evol 18:523-529[Abstract/Free Full Text]

    Charlesworth B., 1994 The effect of background selection against deleterious alleles on weakly selected, linked variants Genet. Res 63:213-228[Web of Science][Medline]

    Charlesworth B., D. Charlesworth, 2000 The degeneration of Y chromosomes Philos. Trans. R. Soc. Lond. B 355:1563-1572[Abstract/Free Full Text]

    Charlesworth B., J. A. Coyne, N. H. Barton, 1987 The relative rates of evolution of sex chromosomes and autosomes Am. Nat 130:113-146[Web of Science]

    Delichère C., M. Veuskens, M. Hernould, N. Barbacar, A. Mouras, I. Negrutiu, F. Moneger, 1999 SlY1, the first active gene cloned from a plant Y chromosome encodes a WD-repeat protein EMBO J 18:4169-4179[Web of Science][Medline]

    Desfeux C., S. Maurice, J. P. Henry, B. Lejeune, P. H. Gouyon, 1996 Evolution of reproductive systems in the genus Silene Proc. R. Soc. Lond. B 263:409-414[Medline]

    Duret L., L. D. Hurst, 2001 The elevated GC content at exonic third sites is not evidence against neutralist model of isochore evolution Mol. Biol. Evol 18:757-762[Abstract/Free Full Text]

    Ellegren H., A. K. Fridolfsson, 1997 Male-driven evolution of DNA sequences in birds Nat. Genet 17:182-184[Web of Science][Medline]

    Eyre-Walker A., 1994 DNA mismatch repair and synonymous codon evolution in mammals Mol. Biol. Evol 11:88-98[Abstract]

    Eyre-Walker A., L. D. Hurst, 2000 Evolution of isochores Nat. Rev. Genet 2:549-555

    Filatov D. A., 2001 Processor of sequences (ProSeq) manual University of Birmingham, Birmingham, UK. (http://www.biosciences.bham.ac.uk/labs/filatov/proseq.pdf)

    Filatov D. A., D. Charlesworth, 1999 DNA polymorphism, haplotype structure and balancing selection in the Leavenworthia PgiC locus Genetics 153:1423-1434[Abstract/Free Full Text]

    Filatov D. A., V. Laporte, C. Vitte, D. Charlesworth, 2001 DNA diversity in sex linked and autosomal genes of the plant species Silene latifolia and S. dioica Mol. Biol. Evol 18:1442-1454[Abstract/Free Full Text]

    Filatov D. A., F. Moneger, I. Negrutiu, D. Charlesworth, 2000 Low variability in a Y-linked plant gene and its implications for Y-chromosome evolution Nature 404:388-390[Medline]

    Fitch W. M., 1971 Toward defining the course of evolution: minimum change for a specific tree topology Syst. Zool 20:406-416[Web of Science]

    Fridolfsson A. K., H. Ellegren, 2000 Molecular evolution of the avian CHD1 genes on the Z and W sex chromosomes Genetics 155:1903-1912[Abstract/Free Full Text]

    Gordo I., B. Charlesworth, 2000 The degeneration of asexual haploid populations and the speed of Muller's ratchet Genetics 154:1379-1387[Abstract/Free Full Text]

    Goulson D., K. Jerrim, 1997 Maintenance of the species boundary between Silene dioica and S. latifolia (red and white campion) Oikos 79:115-126[Web of Science]

    Grantham R., 1974 Amino acid difference formula to help explain protein evolution Science 185:862-864[Abstract/Free Full Text]

    Huang W., B. H.-J. Chang, X. Gu, D. Hewett-Emmett, W.-H. Li, 1997 Sex differences in mutation rate in higher primates estimated from AMG intron sequences J. Mol. Evol 44:463-465[Web of Science][Medline]

    Hurst L. D., E. J. B. Williams, 2000 Covariation of GC content and the silent site substitution rate in rodents: implications for methodology and for the evolution of isochores Gene 261:107-114[Web of Science][Medline]

    Johnston C. M., S. M. Shimeld, P. Sharpe, 1998 Molecular evolution of the Zfy and Znf6 gene families Mol. Biol. Evol 15:129-137[Abstract]

    Keightley P. D., 1998 Inference of genome-wide mutation rates and distributions of mutation effects for fitness traits: a simulation study Genetics 150:1283-1293[Abstract/Free Full Text]

    Kimura M., 1983 The neutral theory of molecular evolution Cambridge University Press, Cambridge

    Kimura M., T. Ohta, 1971 Theoretical aspects of population genetics Princeton University Press, Princeton, NJ

    Klekowski E. J., 1988 Mutation, developmental selection, and plant evolution Columbia University Press, New York

    Kondrashov A. S., 1995 Modifiers of mutation-selection balance: general-approach and the evolution of mutation-rates Genet. Res., Cambs 66:53-69

    Kumar S., K. Tamura, M. Nei, 1994 MEGA—molecular evolutionary genetics analysis software for microcomputers Comput. Appl. Biosci 10:189-191[Abstract/Free Full Text]

    Lahn B. T., D. C. Page, 1999 Four evolutionary strata on the human X chromosome Science 286:964-967[Abstract/Free Full Text]

    Lercher M. J., E. J. B. Williams, L. D. Hurst, 2001 Local similarity in evolutionary rates extends over whole chromosomes in human-rodent and mouse-rat comparisons: implications for understanding the mechanistic basis of the male mutation bias Mol. Biol. Evol 18:2032-2039[Abstract/Free Full Text]

    Lucchesi J. C., 1978 Gene dosage compensation and the evolution of sex chomosomes Science 202:711-716[Abstract/Free Full Text]

    Matassi G., P. M. Sharp, C. Gautier, 1999 Chromosomal location effects on gene sequence evolution in mammals Curr. Biol 9:786-791[Web of Science][Medline]

    McDonald J. H., M. Kreitman, 1991 Adaptive protein evolution at the Adh locus in Drosophilia Nature 351:652-654[Medline]

    McVean G. A. T., B. Charlesworth, 2000 The effects of Hill-Robertson interference between weakly selected mutations on patterns of molecular evolution and variation Genetics 155:929-944[Abstract/Free Full Text]

    McVean G. T., L. D. Hurst, 1997 Evidence for a selectively favorable reduction in the mutation rate of the X chromosome Nature 386:388-392[Medline]

    Miyata T., H. Hayashida, K. Kuma, K. Mitsuyasa, T. Yasunaga, 1987 Male-driven molecular evolution: a model and nucleotide sequence analysis Cold Spring Harbor Symp. Quant. Biol 52:863-867[Abstract/Free Full Text]

    Muse S. V., B. S. Weir, 1992 Testing for equality of evolutionary rates Genetics 132:269-276[Abstract]

    Poethig R. S., E. H. Coe, M. M. Johri, 1986 Cell lineage patterns in maize embryogenesis: a clonal analysis Dev. Biol 117:392-404[Web of Science]

    Rice W. R., 1987 Genetic hitchhiking and the evolution of reduced genetic activity of the Y sex chromosome Genetics 116:161-167[Abstract/Free Full Text]

    Robertson K. D., A. P. Wolffe, 2000 DNA methylation in health and disease Nat. Rev. Genet 1:11-19[Web of Science][Medline]

    Shields D. C., P. M. Sharp, D. G. Higgins, F. Wright, 1988 "Silent" sites in Drosophila genes are not neutral: evidence of selection among synonymous codons Mol. Biol. Evol 5:704-716[Abstract]

    Shimmin L. C., B. H. J. Chang, W.-H. Li, 1993 Male-driven evolution of DNA sequences Nature 362:745-747[Medline]

    Smith N. G. C., L. D. Hurst, 1999 The causes of synonymous rate variation in the rodent genome: can substitution rates be used to estimate the sex bias in mutation rate? Genetics 152:661-673[Abstract/Free Full Text]

    Sokal R. R., F. J. Rohlf, 1995 Biometry 3rd edition. Freeman, San Francisco

    Strathern J. N., B. K. Shafer, C. B. McGill, 1995 DNA synthesis errors associated with double-strand-break repair Genetics 140:965-972[Abstract]

    Thompson J. D., D. G. Higgins, T. J. Gibson, 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice Nucleic Acids Res 22:4673-4680[Abstract/Free Full Text]

    Vyskot B., A. Araya, J. Veuskens, I. Negrutiu, A. Mouras, 1993 DNA methylation of sex chromosomes in a dioecious plant, Melandrium album Mol. Gen. Genet 239:219-224[Web of Science][Medline]

    Westergaard M., 1959 The mechanism of sex determination in dioecious flowering plants Adv. Genet 9:217-281[Web of Science]

    Wolfe K. H., P. M. Sharp, W.-H. Li, 1989 Mutation rates differ among regions of the mammalian genome Nature 337:283-285[Medline]

    Wright F., 1990 The ‘effective number of codons' used in a gene Gene 87:23-29[Web of Science][Medline]

    Wyckoff G. J., W. Wang, C.-I. Wu, 2000 Rapid evolution of male reproductive genes in the descent of man Nature 403:304-309[Medline]

    Yang Z., 2001 PAML (phylogenetic analysis by maximum likelihood) Version 3e. University College London

    Yi S., B. Charlesworth, 2000 Contrasting patterns of molecular evolution of the genes on the new and old sex chromosomes of Drosophila miranda Mol. Biol. Evol 17:703-717[Abstract/Free Full Text]

    Yoder A., Z. Yang, 2000 Estimation of primate speciation dates using local molecular clocks Mol. Biol. Evol 17:1081-1090[Abstract/Free Full Text]

Accepted for publication February 1, 2002.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GeneticsHome page
D. A. Filatov, E. C. Howell, C. Groutides, and S. J. Armstrong
Recent Spread of a Retrotransposon in the Silene latifolia Genome, Apart From the Y Chromosome
Genetics, February 1, 2009; 181(2): 811 - 817.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
M{a} L. Buide
Disentangling the causes of intrainflorescence variation in floral traits and fecundity in the hermaphrodite Silene acutifolia
Am. J. Botany, April 1, 2008; 95(4): 490 - 497.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
T. R. Dreszer, G. D. Wall, D. Haussler, and K. S. Pollard
Biased clustered substitutions in the human genome: The footprints of male-driven biased gene conversion
Genome Res., October 1, 2007; 17(10): 1420 - 1430.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
R. Ming, J. Wang, P. H. Moore, and A. H. Paterson
Sex chromosomes in flowering plants
Am. J. Botany, February 1, 2007; 94(2): 141 - 150.
[Abstract] [Full Text] [PDF]


Home page
Proc R Soc BHome page
H. Ellegren
Characteristics, causes and evolutionary consequences of male-biased mutation
Proc R Soc B, January 7, 2007; 274(1606): 1 - 10.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. E. Ironside and D. A. Filatov
Extreme Population Structure and High Interspecific Divergence of the Silene Y Chromosome
Genetics, October 1, 2005; 171(2): 705 - 713.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. A. Filatov
Evolutionary History of Silene latifolia Sex Chromosomes Revealed by Genetic Mapping of Four Genes
Genetics, June 1, 2005; 170(2): 975 - 979.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
D. A. Filatov
Substitution Rates in a New Silene latifolia Sex-Linked Gene, SlssX/Y
Mol. Biol. Evol., March 1, 2005; 22(3): 402 - 408.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
M. Tanurdzic and J. A. Banks
Sex-Determining Mechanisms in Land Plants
PLANT CELL, June 1, 2004; 16(suppl_1): S61 - S71.
[Full Text] [PDF]


Home page
Mol Biol EvolHome page
D. A. Filatov
A Gradient of Silent Substitution Rate in the Human Pseudoautosomal Region
Mol. Biol. Evol., February 1, 2004; 21(2): 410 - 417.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (33)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Filatov, D. A.
Right arrow Articles by Charlesworth, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Filatov, D. A.
Right arrow Articles by Charlesworth, D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?