Skip Navigation

This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary material
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Navajas, M.
Right arrow Articles by Cornuet, J.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Navajas, M.
Right arrow Articles by Cornuet, J.-M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Biology and Evolution 19:2313-2317 (2002)
© 2002 Society for Molecular Biology and Evolution

The Complete Sequence of the Mitochondrial Genome of the Honeybee Ectoparasite Mite Varroa destructor (Acari: Mesostigmata)

Maria Navajas*,1, Y. Le Conte{dagger}, M. Solignac{ddagger}, S. Cros-Arteil* and J.-M. Cornuet*

*Centre de Biologie et Gestion de Populations, Campus International de Baillarguet, Montferrier, France;
{dagger}UMR UAPV, Institut National de la Recherche Agronomique, Avignon cedex, France;
{ddagger}Laboratoire Populations, Génétique et Evolution, CNRS, Gif-sur-Yvette, France

Complete mitochondrial genome sequences are now available for 28 Arthropoda (see references at: http://www.jgi.doe.gov/programs/comparative/Mito_top_level.html), more than for any other invertebrate phylum. As in other metazoans, the mtDNA genome is circular and contains 37 genes: 22 for transfer RNAs (tRNA), 2 for rRNAs (rrnL and rrnS), and 13 for protein subunits (Wolstenholme 1992Citation ). There is also one major noncoding region which is thought to play a role in the initiation of transcription or replication (or both) of the DNA molecule (Goddard and Wolstenholme 1978Citation ).

Apart from tRNA genes, whose relative positions in the mitochondrial genome vary (Boore 1999Citation ), gene order has been long conserved in some lineages of Arthropoda. The arrangement found in most studied insects, for instance, differs from that of the chelicerate Limulus polyphemus by the location of only one tRNA (Staton, Daehler, and Brown 1997Citation ; Lavrov, Boore, and Brown 2000Citation ). This latter arrangement is believed to be ancestral for arthropods (Boore et al. 1995Citation ). However, variants of this gene order have been described. Among the Acari, complete mtDNA sequences are available for two ticks Ixodes hexagonus and Rhipicephalus sanguineus (Black and Roehrdanz 1998Citation ), whereas a broad sampling of gene boundaries is available from another tick Boophilus microplus (Campbell and Barker 1999Citation ). Notable rearrangements in the gene order were found for two of these ticks: R. sanguineous (Black and Roehrdanz 1998Citation ) and B. microplus (Campbell and Barker 1999Citation ). These rearrangements involve a translocation of an eight-gene block bounded by the genes nad1 and trnG (along with other tRNA rearrangements). Such major rearrangements of protein-coding mitochondrial genes are not specific to Acari because other important changes have been found in the insect Heterodoxus macropus (Shao, Campbell, and Barker 2001Citation ), the crustacean Pagurus longicarpus (Hickerson and Cunningham 2000Citation ), and the millipede Narceus annularus (Lavrov, Boore, and Brown 2002Citation ). The three species of Acari for which the complete mtDNA gene arrangement has been studied are all in the family Ixodidae (Parasitiformes: Metastigmata) (Black and Roehrdanz 1998Citation ; Campbell and Barker 1999Citation ). Nothing is known about gene order in other lineages of Acari. We provide here the complete sequence of the mitochondrial genome of Varroa destructor (Parasitiformes: Mesostigmata), a neoparasite of the western honeybee (Apis mellifera) and hence a major threat for beekeeping all around the world.

Total genomic DNA was isolated from a single female of V. destructor collected from a honeybee colony maintained in the INRA Zoology station at Avignon, France. Total DNA was isolated by a hexadecyltrimethylammonium bromide procedure (Navajas et al. 1998Citation ). The entire mitochondrial genome was amplified in two pieces with the Expand Long Template PCR kit (Roche). PCR primers were designed in the cox1 gene, using the published partial sequence of V. destructor (positions 239–257 in Anderson and Trueman 2000Citation ) and the universal primer N4-J-8944 located in the nad4 (Simon et al. 1994Citation ). Using these two PCR primers (5'GCGGTTCCCACTGGTATT3' and 5'GGAGCTTCAACATGAGCTTT3') and their reverse complementary sequences, we produced two fragments: fragment 1 of ca. 6,300 bp and fragment 2 of ca. 10,000 bp. Fragment 1 was sequenced by primer walking. Fragment 2 was digested by the Sau3A restriction enzyme, and the resulting reaction was cloned. Two short clones were sequenced, and their respective sequences were used to define new primers. These were used to produce overlapping PCR products that were cloned and sequenced by primer walking. The control region could be localized but not entirely sequenced due to the presence of large (157 bp) repeated elements. Its size could, however, be estimated after amplification with flanking primers.

The amino acid sequences of the protein-coding genes were inferred from the Drosophila mtDNA genetic code. Protein gene sequences were identified by their similarity to published arthropod mtDNA and by alignment with sequences from R. sanguineus and I. hexagonus. We identified tRNA genes by using their potential to be folded into tRNA-like secondary structures with the tRNscan-SE program–modifying parameters to identify unusual tRNAs (Lowe and Eddy 1997Citation ). The tRNA secondary structures were detected in this way for 20 out of the 22 tRNAs. The remaining trnC and trnS(agn) were detected by inspecting noncoding sequences for the tRNA-like secondary structure by eye.

The entire mitochondrial genome of V. destructor has an estimated size of 16,477 bp and belongs to the Korean mitochondrial haplotype described by De Guzman et al. (1998) that has been identified on A. mellifera in Europe, the Middle East, Africa, Asia, and the Americas (Anderson and Trueman 2000Citation ). The mitochondrial genome size of V. destructor is larger than those of the three Acari previously studied, which are ca. 15 kb and lies in the upper size range for arthropods (table 1 ). The gene organization map is given in figure 1 . The protein-encoding genes and the rRNA genes are all at the same relative position as in I. hexagonus and L. polyphemus and are considered ancestral in arthropods, but six and nine of the 22 tRNA genes, respectively, lie in different relative positions. In addition, the control region is located between the rrnL and rrnS ribosomal genes (see discussion below). The position of two tRNA clusters is conserved in V. destructor when compared with insects (Boore 1999Citation ): (1) trnA, trnR, trnN, trnS(agn), trnE, and trnF between the nad3 and nad5 genes, and (2) trnK and trnD between the cox2 and atp8 genes. Translation, initiation, and termination signals as well as the codon usage of the V. destructor mitochondrial genome do not display any unusual characteristics.


View this table:
[in this window]
[in a new window]
 
Table 1 Genome Size and A + T Content (in percentage) of the Entire Mitochondrial (mt) DNA Genome and of the Large Noncoding Region of Several Arthropoda

 


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 1.—Mitochondrial gene arrangement in V. destructor. Arrows indicate the direction of gene transcription. Abbreviations of protein-coding genes and rRNA genes: atp6 and atp8 = ATP synthase subunits 6 and 8; cox1–cox3 = cytochrome oxidase subunits 1–3; cob = cytochrome b; nad1–nad6 = NADH subunits 1–6; nad4L = NADH subunit 4L; rrnL and rrnS = large and small ribosomal subunits RNA. The tRNA genes are denoted by the one-letter amino acid abbreviation. The control region is shaded, and the repeats are represented by boxes

 
In V. destructor, we found the 22 tRNAs that are generally found in metazoan mitochondrial genomes. Identified anticodons were all identical to those of Drosophila. So are those of the ticks R. sanguineus and I. hexagonus, with the exception of the anticodon of the trnS(agn), which is UCU instead of GCU in Drosophila and V. destructor. Although several mismatches (seven TT) were found in the arms of the tRNA genes, their putative secondary structure is consistent with those previously described in Acari. In two cases trnC and trnS(agn), the structure appeared to be truncated and to lack the dihydrouridine (DHU)-arm found in the canonical tRNA. Instead, these arms are replaced by a DHU-arm–replacement loop. These modified structures in V. destructor tRNAs also have been described for two other Acari in the case of the trnS(agn) and for R. sanguineous in the case of trnC (Black and Roehrdanz 1998Citation ). Thus, cloverleaf structures seem unlikely for both tRNAs, although RNA analysis is required to confirm the proposed secondary structure. Among tRNAs encoded by metazoan mtDNAs, there is a remarkable diversity of structure. The modified secondary structure of the trnS(agn) is relatively common in Metazoa and has been suggested to have occurred early in metazoan evolution (Wolstenholme 1992Citation ). The modification of the standard secondary structure of trnC, although less common, also has been reported previously in several animal mtDNAs.

As in all other mitochondrial genomes sequenced so far, two genes for rRNAs were present in V. destructor, one for the small (rrnS) and one for the large (rrnL) ribosomal subunit. We identified the 5'- and 3'-ends of rrnS and rrnL by comparing their nucleotide sequences with those of the two other Acari sequenced, I. hexagonus and R. sanguineus. The trnV gene, which is located between the two rRNA genes in all arthropods studied so far, except in Heterodoxus macropus (Shao, Campbell, and Barker 2001Citation ), also lies next to the rrnL in V. destructor, despite the insertion of two other tRNA genes, trnS(ugn) and trnC, and of the control region (see below).

There are 2,561 nt unassigned to genes in the sequenced mitochondrial molecule of V. destructor. The largest noncoding region is estimated to be 2,173 nt long and includes several repetitions of a 157-bp motif. This length is well in the range of other arthropods, which shows remarkable variability, from 263 nt for R. sanguineus to 4,601 nt for D. melanogaster, with an extreme size of 9–13 kb in some weevils (Zhang and Hewitt 1997Citation ). Outside this region, there are 388 bp unassigned to genes, scattered in short runs (1–93 bp). The largest noncoding region is believed to be involved in the regulation of transcription and replication (Goddard and Wolstenholme 1978Citation ); thus, it also is called the control region. This region is known to form secondary structures that are proposed to be involved in the generation of repeats in mtDNA during replication (Broughton and Dowling 1994Citation ). Eleven potential sites for the formation of 4- to 26-bp stem-loop structures with loops 6–23 bp were identified in the 460-nt region adjacent to the tandem repeat region. No mismatches were identified in the stems which were supported by 1–7 GC pairs. The 157-bp tandem repeat also has potential for forming two hairpins of 90 and 49 nt with a stable structure supported by 8 and 2 GC matches. These different features strongly suggest that this noncoding region plays a role in DNA replication or transcription initiation (or both) (Saccone, Attimonelli, and Sbisa 1985Citation ).

In invertebrates, the relative location of the control region in the genome shows great diversity. Even within the insects, regions flanking the control region may differ among taxa due to tRNA transposition (rearrangement) during evolution. In the case of V. destructor, the putative control region lies between the trnC and the rrnS genes which is unique to this species. The gene cluster rrnStrnV-rrnL is present in almost all other Arthropoda, and this arrangement is also common in vertebrates and others (Boore 1999Citation ). However, in some other metazoa, as in the Echinoidea Paracentrotus lividus, the two ribosomal genes are separated by a stretch of about 3.3 kbp which contains the nad1 and nad2 genes and a cluster of 15 tRNA genes (Cantatore et al. 1989Citation ). Other representatives from the Echinoidea also display two nonadjacent rRNA genes (with the trnV gene inserted or not inserted) (Boore 1999Citation ).

At the 3'-end of the control region, three nucleotides apart from the 3'-end of the trnC gene, we found an array of tandem repeats extending to a length estimated at 10 repeats of 157 bp plus a truncated repeat of 140 bp. This 1,710-bp region could not be sequenced fully due to the presence of the repeats (no unique internal sequencing primers could be designed), and only the sequence of three repeats at each end of the region could be obtained. All the six sequenced repeats were identical in sequence, suggesting that the remaining repeats also had the same sequence. According to this, the putative control region has the potential of forming 10 identical secondary structures plus a remaining shorter hairpin. Each of the 157-bp tandem repeat has the potential for forming two hairpins of 90 and 47 paired nucleotides with a stable structure supported by 8 and 2 GC matches.

Repeat sequences are common in control regions of many metazoans, and length variation due to variable number of repeats are observed frequently within and among closely related species (e.g., Moritz and Brown 1987Citation ; Campbell and Barker 1999Citation ; Dotson and Beard 2001Citation ). Variation of size and copy number of a repeat unit is responsible to a large degree for the size variation of the control region and also of the whole mitochondrial genome. Copy number variation of the tandem repeat also has been observed at the individual level, leading to the existence of mtDNA molecules of different sizes in an individual, a phenomenon known as length heteroplasmy. Mitochondrial DNA length heteroplasmy has been observed widely in animals (for reviews see Rand 1993Citation ; Zhang and Hewitt 1997Citation ). Preliminary results obtained through PCR suggest that heteroplasmy is present in V. destructor. However, this has to be confirmed through Southern blot hybridization because PCR is prone to artifacts in such situations (Fumagalli et al. 1996Citation ; Campbell, Sturm, and Barker 2001Citation ). In any case, the existence of long hairpin secondary structures, such as those found in the 157-bp motif, generally increase the probability of slipped-strand mispairing (see Levinson and Gutman 1987Citation ) by bringing closer the motif sequences to be mispaired.

The base composition of the strand that encodes the majority of genes in the mtDNA of V. destructor has 39% of adenine, 41% of thymine, 8% of cytosine, and 12% of guanine, which makes an A + T content of 80.0%. Significant variation in nucleotide composition exists among mitochondrial genomes (see table 1 for Arthropoda). The overall A + T content of V. destructor is similar to that of two other Acari (R. sanguineus 77.9%, B. microplus 82.4%) and to those of several arthropods but higher than that of the third acari previously studied, I. hexagonus (72.6%), or of the extreme low value detected in the crustacean Artemia franciscana (64.5%) (Valverde et al. 1994Citation ). The A + T content of the coding strand for protein genes, calculated for each gene individually, was 80.9%, which is comparable with the value calculated for the entire mtDNA (80.0%). Different subsets of the mitochondrial genome of V. destructor, including protein-coding genes, ribosomal subunits, and control region, were examined for A + T content, and all display comparable values around 80%. The most noticeable result is the A + T content of the noncoding region (79.7%) that is very close to the value estimated for the entire mtDNA (80.0%). This region is usually AT-rich by comparison with the rest of the mtDNA genome. This bias is extreme in the mosquito Anopheles gambiae for which the A + T content of the AT-rich region is 16% higher than that of the entire genome (table 1 ). This situation applies to most arthropods examined, with the noticeable exception of all mites sequenced so far, together with the hexapod Triatoma dimidiata (Dotson and Beard 2001Citation ) and the myriapod Thyropygus sp. (Lavrov, Boore, and Brown 2002Citation ). These species all have a lower content of A + T in the noncoding region than in the entire genome (table 1 ). The higher A + T content generally found in the control region could be interpreted as a characteristic favoring the melting of DNA strands, required to initiate replication as well as transcription. The absence of such a higher A + T content in Acari (or even a lower content) may imply a higher efficiency of the enzymatic complex involved in the DNA denaturation before replication-transcription.

The annotated sequence of the entire mitochondrial genome of V. destructor is available from EMBL under the accession number AJ493124.

Acknowledgements

We thank M. Monnerot and M. Caillaud for helpful comments on the manuscript, S. Gimenez for technical assistance, and N. Fradet for his contribution in the identification of some tRNA genes. We also thank J.-Y. Rasplus for help with arthropod systematics. This work was supported by an EC grant, FEOGA B 02712, for beekeeping to Y.L.C.

Footnotes

Ross Crozier, Reviewing Editor

Keywords: Varroa destructor mitochondrial genome mtDNA gene order A + T content Back

Address for correspondence and reprints: Maria Navajas, Centre de Biologie et Gestion de Populations, Campus International de Baillarguet, CS 30 016, 34988 Montferrier-sur-Lez cedex, France. E-mail: navajas{at}ensam.inra.fr . Back

References

    Anderson D. L., J. W. H. Trueman, 2000 Varroa jacobsoni (Acari: Varroidae) is more than one species Exp. Appl. Acarol 24:165-189[ISI][Medline]

    Black W. C. IV,, R. L. Roehrdanz, 1998 Mitochondrial gene order in not conserved in Arthropods: Prostriate and metastriate tick mitochondrial genomes Mol. Biol. Evol 15:1772-1785[Abstract]

    Boore J. L., 1999 Animal mitochondrial genomes Nucleic Acids Res 27:1767-1780[Abstract/Free Full Text]

    Boore J. L., T. M. Collins, D. Stanton, L. L. Daehler, 1995 Deducing the patterns of arthopod phylogeny from mitochondrial DNA rearrangements Nature 376:163-165[Medline]

    Broughton R. E., T. E. Dowling, 1994 Length variation in mitochondrial DNA of the minnow Cyprinella spiloptera Genetics 138:179-190[Abstract]

    Campbell N. J., R. A. Sturm, S. C. Barker, 2001 Large mitochondrial repeats multiplied during the polymerase chain reaction Mol. Ecol. Notes 1:336-340

    Campbell N. J. H., S. C. Barker, 1999 The novel mitochondrial gene arrangement of the cattle tick, Boophilus microplus: fivefold tandem repetition of a coding region Mol. Biol. Evol 16:732-740[Abstract]

    Cantatore P., M. Roberti, G. Rainaldi, M. N. Gadaleta, C. Saccone, 1989 The complete nucleotide sequence, gene organization, and genetic code of the mitochondrial genome of Paracentrotus lividus J. Biol. Chem 264:10965-10975[Abstract/Free Full Text]

    de Guzman L. I., T. E. Rinderer, J. A. Stelzer, D. L. Anderson, 1998 Congruence of RAPD and mitochondrial DNA markers in assessing Varroa jacobsoni genotypes J. Apic. Res 37:49-51

    Dotson E. M., C. B. Beard, 2001 Sequence and organization of the mitochondrial genome of the Chagas disease vector, Triatoma dimidiata Insect Mol. Biol 10:205-215[ISI][Medline]

    Fumagalli L., P. Taberlet, L. Favre, J. Hausser, 1996 Origin and evolution of homologous repeated sequences in the mitochondrial DNA control region of shrews Mol. Biol. Evol 13:31-46[Abstract]

    Goddard J. M., D. R. Wolstenholme, 1978 Origin and direction of replication in mitochondrial DNA molecules from Drosophila melanogaster Proc. Natl. Acad. Sci. USA 75:3886-3890[Abstract/Free Full Text]

    Hickerson M. J., C. W. Cunningham, 2000 Dramatic mitochondrial gene rearrangements in the hermit crab Pagurus longicarpus (Crustacea, Anomura) Mol. Biol. Evol 17:639-644[Abstract/Free Full Text]

    Lavrov D. V., J. L. Boore, W. M. Brown, 2000 The complete mitochondrial DNA sequence of the horseshoe crab Limulus poluphemus Mol. Biol. Evol 17:813-824[Abstract/Free Full Text]

    ———. 2002 Complete mtDNA sequences of two millipedes suggest a new model for mitochondrial gene rearrangements: duplication and nonrandom loss Mol. Biol. Evol 19:163-169[Abstract/Free Full Text]

    Levinson G., G. A. Gutman, 1987 Slipped-strand mispairing: a major mechanism for DNA sequence evolution Mol. Biol. Evol 4:203-221[Abstract]

    Lowe T. M., S. R. Eddy, 1997 tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequences Nucleic Acids Res 25:955-964[Abstract/Free Full Text]

    Moritz C., W. M. Brown, 1987 Tandem duplications in aminal mitochondrial DNA: variation in incidence and gene content Proc. Natl. Acad. Sci. USA 84:7183-7187[Abstract/Free Full Text]

    Navajas M., J. Lagnel, J. Gutierrez, P. Boursot, 1998 Species wide homogeneity of nuclear ribosomal ITS2 sequences in the spider mite Tetranychus urticae contrasts with extensive mitochondrial COI polymorphism Heredity 80:742-752

    Rand D. M., 1993 Endotherms, ectotherms and mitochondrial genome-size variation J. Mol. Evol 37:281-295[ISI][Medline]

    Saccone C., M. Attimonelli, E. Sbisa, 1985 Primary and higher order structural analysis of animal mitochondrial DNA Pp. 37–47 in E. Quagliariello et al., eds. Achievements and perspectives of mitochondrial research, Vol. 2. Biogenesis. Elsevier, New York

    Shao R., N. J. H. Campbell, S. C. Barker, 2001 Numerous gene rearrangements in the mitochondrial genome of the wallaby louse, Heterodoxus macropus (Phthiraptera) Mol. Biol. Evol 18:858-865[Abstract/Free Full Text]

    Simon C., F. Frati, A. Beckenbach, B. Crespi, H. Liu, P. Flook, 1994 Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers Ann. Entomol. Soc. Am 87:651-701

    Staton J. L., L. L. Daehler, W. N. Brown, 1997 Mitochondrial gene arrangement of the horseshoe crab Limulus polyphemus L.: conservation of major features among arthopod classes Mol. Biol. Evol 14:867-874[Abstract]

    Valverde J. R., B. Batuecas, C. Moratilla, R. Marco, R. Garesse, 1994 The complete mitochondrial DNA sequence of the crustacean Artemia franciscana 39:400–408

    Wolstenholme D. R., 1992 Animal mitochondrial DNA: structure and evolution Int. Rev. Cytol 141:173-216[ISI][Medline]

    Zhang D. X., G. M. Hewitt, 1997 Insect mitochondrial control region: a review of its structure, evolution and usefulness in evolutionary studies Biochem. Syst. Ecol 25:99-120

Accepted for publication July 17, 2002.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Biol EvolHome page
S. E. Masta and J. L. Boore
Parallel Evolution of Truncated Transfer RNA Genes in Arachnid Mitochondrial Genomes
Mol. Biol. Evol., May 1, 2008; 25(5): 949 - 959.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
S. E. Masta and J. L. Boore
The Complete Mitochondrial Genome Sequence of the Spider Habronattus oregonensis Reveals Rearranged and Extremely Truncated tRNAs
Mol. Biol. Evol., May 1, 2004; 21(5): 893 - 902.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary material
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Navajas, M.
Right arrow Articles by Cornuet, J.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Navajas, M.
Right arrow Articles by Cornuet, J.-M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?