Molecular Biology and Evolution 18:1389-1400 (2001)
© 2001 Society for Molecular Biology and Evolution
Predicting Evolutionary Potential. I. Predicting the Evolution of a Lactose-PTS System in Escherichia coli
Department of Biology, University of Rochester
| Abstract |
|---|
|
|
|---|
Genomes contain not only information for current biological functions, but also information for potential novel functions that may allow the host to adapt to new environments. The field of experimental evolution studies that potential by selecting for novel functions and deducing the means by which the function evolved, but until now it has not attempted to predict the outcomes of such experiments. Here I present a model system that is being developed specifically to examine the issue of what kind of information is most useful in predicting how novel functions will evolve. The system is the evolution of a Lac-PTS transport system and a phospho-ß-galactosidase hydrolase system as a novel pathway for metabolism of lactose in Escherichia coli. Two kinds of information, sequence-based phylogenetic inference and biochemical activity, are considered as predictors of which E. coli genes will evolve the required new functions. Both biochemical data and phylogenetic inference predict that the cryptic celABC genes, which currently specify a PTS-ß-glucoside transport system, are most likely to evolve into a PTS-lactose transport system. Phylogenetic inference predicts that the bglA gene, which currently specifies a phospho-ß-glucosidase, is most likely to evolve into a phospho-ß-galactosidase. In contrast, biochemical data predict that the cryptic bglB gene, which also currently specifies a phospho-ß-glucosidase, is most likely to evolve into a phospho-ß-galactosidase.
| Introduction |
|---|
|
|
|---|
For over 30 years, microorganisms have been used as model systems to study the evolution of new functions (Mortlock 1984
The usual strategy is to apply selection for utilization of a novel resource, typically a carbon source, that cannot be used by the wild-type organism. Such studies have demonstrated several means by which organism can evolve the ability to use novel resources: (1) by constitutive expression of a gene whose product was already able to metabolize the novel resource but which was uninducible by that resource (reviewed in Mortlock 1984
), (2) by activation of cryptic genes or operons that could not be expressed in the wild-type organism but could be expressed following a mutation or transposition of a mobile element (Hall, Yokoyama, and Calhoun 1983
; Hall, Betts, and Kricker 1986
; Hall and Betts 1987
; Parker and Hall 1988
; Hall and Xu 1992
), and (3) by base substitutions that alter the catalytic properties of a protein so that it acquires a new or expanded substrate range to include the novel resource (Hall 1976, 1981
; Hall et al. 1983
; Clarke 1984
; Hall, Betts, and Wootton 1989
).
An alternative strategy is simply to select for better adaptation to a laboratory environment such as a chemostat or serial transfer in minimal medium. In those cases, the measure of evolution is not a specific new activity, but improved competitive fitness (Lenski and Travisano 1994
).
None of those studies has attempted to predict which genes will evolve or what the nature of the evolved products will be. In effect, experimental evolutionists did exactly what evolutionary biologists have always done: explain what has happened by characterizing the outcomes.
Recently, attention has begun to shift in the direction of understanding the evolutionary potential that is inherent in current genomes (Hall 1995, 1999a, 1999b
; Hall and Malik 1998
). That shift is partially occasioned by the availability of complete sequences of microbial genomes, with the resulting sense that if we know the sequence of a genome we should surely be able to describe its potential for evolving new functions.
In at least one case, we can speak with some assurance about the evolutionary potential of a gene for a particular novel function. The ebgA gene of E. coli K12 can evolve to replace the lacZ gene as a source of ß-galactosidase for the metabolism of lactose and other ß-galactoside sugars (Hall 1986
). That evolution is the result of amino acid substitutions that dramatically improve the catalytic efficiency of Ebg enzyme for the new substrates (Hall 1976, 1978, 1981
; Hall, Betts, and Wootton 1989
). The potential of ebgA for the improved efficiency is limited to exactly two base substitutions, one near the 5' end and one near the 3' end of the gene, that alter active-site amino acids (Hall 1995
; Hall and Malik 1998
). That potential, however, was not predicted; it was deduced after the fact.
Although the complete sequences of 45 microbial genomes are available in the public databases, and at least that many more are underway, it is not clear that sequence information is the most effective way to predict evolutionary potential. Biochemical information might be equally or more effective at predicting novel activities. Does a trace level of a desired novel activity predict that the activity can be enhanced by one or several mutations? In at least one case it does: the double-mutant Class IV Ebg ß-galactosidase does not permit growth on lactobionic acid, but it does have a low level of activity that is detectable in vitro with purified enzyme (Hall 1981
). That activity is enhanced as the result of a third mutation, and the resulting triple mutant strains can grow on lactobionate as a sole carbon and energy source (Hall 1978
). The problem is that neither the wild type nor either of the two single-mutation classes of Ebg enzyme has any detectable lactobionase activity in vitro, and biochemical measurement would not have predicted the evolution of that novel activity from the wild-type gene. Finally, might protein structural data assist us in predicting which proteins might evolve new functions and which residues might be most likely to evolve?
In this paper, I report the development of a model system for predicting potential of an organism based on knowledge of its current genome and its current biochemical activities. The intent is to compare the sequence information and limited protein structural information with biochemical information to determine (1) if they consistently make the same predictions, and (2) if they do not, which kind of information most accurately predicts evolutionary outcomes.
Escherichia coli metabolizes lactose via the lacY-encoded permease that transports lactose into the cell against a concentration gradient, and the lacZ-encoded ß-galactosidase that hydrolyzes lactose to its component simple sugars, glucose and galactose (fig. 1A ). That is not only the lactose metabolism pathway in E. coli, it is by far the commonest pathway in microorganisms. Some Gram-positive organisms metabolize lactose by a different pathway, the Lac-PTS/phospho-ß-galactosidase pathway, in which a phosphoenolpyruvate-dependent lactose transport system phosphorylates lactose, and the resulting lactose-6-phosphate is hydrolyzed by a phospho-ß-galactosidase (fig. 1B ).
|
Escherichia coli K12 has neither Lac-PTS transport nor phospho-ß-galactosidase genes, but there is good reason to believe that E. coli has the potential to evolve those functions. The only Gram-negative bacterial species known to have a Lac-PTS/phospho-ß-galactosidase pathway is Klebsiella (Hall 1979
This paper predicts which genes in E. coli K12 have the potential to evolve Lac-PTS transport and phospho-ß-galactosidase functions.
| Materials and Methods |
|---|
|
|
|---|
Phylogenetic Analysis
Alignment
Protein sequences were aligned using the multiple-alignment program ClustalX (Thompson et al. 1997
Bayesian Inference of Phylogenies
Phylogenies were constructed by the Bayesian method (Rannala and Yang 1996
; Mau and Newton 1997
; Mau, Newton, and Larget 1999
) as implemented by the program MrBayes (Huelsenbeck 2000)
. MrBayes is available from http://brahms.biology.rochester.edu/software.html. The Bayesian method seeks the most likely trees given the data (the alignment) and the evolutionary model. The posterior probabilities of the phylogeny, branch lengths, and substitution parameters cannot be calculated directly; however, they can be approximated by a Markov Chain Monte Caro process by sampling trees from the posterior probability distribution. A variant of MCMC called "Metropolis-coupled Markov chain Monte Carlo" (MCMCMC) runs several chains, some of which are heated. A heated Markov chain has the posterior probability of a tree raised to some power i. Heated Markov chains can more easily cross deep likelihood valleys. The effect of heating is to fill in valleys and lower peaks; hence, a heated Markov chain can better explore the parameter space. Using the MCMCMC algorithm, a swap of the states between two chains is attempted at each step. If the swap is accepted, then the states for the two chains are exchanged. If a swap occurs between a heated chain and the cold chain, the cold chain might cross a large valley that it would normally cross with only a very small probability.
Trees are saved every N generations as specified by the user. At the end of the run, a consensus tree with branch lengths is calculated from the saved trees. As the chains run, the ln likelihoods of the trees converge on a stable value. Only trees saved well after ln likelihood has converged are used to calculate the consensus tree.
One of the advantages of Bayesian inference of phylogeny is that the results are easy to interpret. For example, the sum of the posterior probabilities of all trees will sum to 1. Moreover, the posterior probability of any single clade is simply the sum of the posterior probabilities of all trees that contain that clade. The consensus tree calculated by MrBayes does not include the posterior probabilities of the clades; thus, the entire set of trees was imported into PAUP* (Swofford 2000
), and the same trees used by MrBayes to calculate a consensus were used to calculate a 50% majority rule consensus in PAUP* (Swofford 2000
). The resulting tree shows the posterior probabilities of the clades.
The consensus trees calculated by MrBayes were imported into PAUP* for the purposes of displaying and printing the tree.
Structural Analysis
Structures of the AscB, BglA, and BglB proteins were modeled by the SWISS_MODEL program (Guex and Peitsch 1997
; Peitsch et al. 1997
; Guex, Diemand, and Peitsch 1999
; Schwede et al. 2000
) as part of the 3DCrunch project that modeled all of the proteins in the SwissProt database as of May 1998. For details of the project, see http://www.expasy.ch/swissmod/SM_3DCrunch.html. For each of the proteins, the only crystal structures for which there was meaningful structural homology were those of the Lactococcus lactis phospho-ß-galactosidase (Wiesmann et al. 1995
).
The Swiss-Pdb Viewer program (Guex and Peitsch 1997
) was used to view the aligned structures.
E. coli Strains
Details of the strain constructions are available from the author upon request.
PEP14: celR1::IS2
(bgl-pho) rpsL ara-14 leuB6
lacZ4680 lacY his-208 metA160 galK2 dTn10cam::ebgA5100 ebgR+L5322 dTn10kan::bglA. Constitutive for celABCDF operon expression; other ß-glucoside transport and hydrolysis genes are either silent, disrupted, or deleted.
PEP24: celR1::IS2
celBCDF
(bgl-pho) rpsL ara-14 leuB6
lacZ4680 lacY his-208 metA160 galK2 dTn10cam::ebgA5100 ebgR+L5322 dTn10kan::bglA1000. All ß-glucoside transport and hydrolysis genes are either silent, disrupted, or deleted.
PEP25: celR1::IS2
celBCDF bglR::IS1 bglG33 rpsL ara-14 leuB6
lacZ4680 lacY his-208 metA160 galK2 dTn10cam::ebgA5100 ebgR+L5322 dTn10kan::bglA1000. Constitutive for bglGFB operon expression; other ß-glucoside transport and hydrolysis genes are either silent, disrupted, or deleted.
PEP33: celR1::IS2
celBCDF
(bgl-pho) rpsL ara-14 leuB6
lacZ4680 lacY his-208 metA160 galK2 dTn10cam::ebgA5100 ebgR+L5322 ArbT+ Constitutive for bglA and ArbT expression; other ß-glucoside transport and hydrolysis genes are either silent, disrupted, or deleted.
PEP54: ascG1::IS186 + 2 unknown mutations celR1::IS2
celBCDF
(bgl-pho) rpsL ara-14 leuB6
lacZ4680 lacY his-208 metA160 galK2 dTn10cam::ebgA5100 ebgR+L5322 dTn10kan::bglA1000. Constitutive for ascGFB operon expression; other ß-glucoside transport and hydrolysis genes are either silent, disrupted, or deleted.
PEP27: celR1::IS2 bglR::IS1 bglG33 rpsL ara-14 leuB6
lacZ4680 lacY his-208 metA160 galK2 dTn10cam::ebgA5100 ebgR+L5322 dTn10kan::bglA. Constitutive for celABCDF operon and bglGFB operon expression; other ß-glucoside transport and hydrolysis genes are either silent, disrupted, or deleted.
PEP36: celR1::IS2 F
(bgl-pho) rpsL ara-14 leuB6
lacZ4680 lacY his-208 metA160 galK2 dTn10cam::ebgA5100 ebgR+L5322 ArbT+. Constitutive for celABCDF, bglA, and ArbT expression; other ß-glucoside transport and hydrolysis genes are either silent, disrupted, or deleted.
PEP37: ascG1::IS186 + 2 unknown mutations celR1::IS2
celBCDF
(bgl-pho) rpsL ara-14 leuB6
lacZ4680 lacY his-208 metA160 galK2 dTn10cam::ebgA5100 ebgR+L5322 ArbT+. Constitutive for ascGFB, bglA, and ArbT expression; other ß-glucoside transport and hydrolysis genes are either silent, disrupted, or deleted.
PEP38: celR1::IS2
celBCDF bglR::IS1 bglG33 rpsL ara-14 leuB6
lacZ4680 lacY his-208 metA160 galK2 dTn10cam::ebgA5100 ebgR+L5322 ArbT+. Constitutive for bglGFB, bglA, and ArbT expression; other ß-glucoside transport and hydrolysis genes are either silent, disrupted, or deleted
PEP56: ascG1::IS186 + 2 unknown mutations celR1::IS2
(bgl-pho) rpsL ara-14 leuB6
lacZ4680 lacY his-208 metA160 galK2 dTn10cam::ebgA5100 ebgR+L5322 dTn10kan::bglA1000. Constitutive for ascGFB operon and celABCDF operon expression; other ß-glucoside transport and hydrolysis genes are either silent, disrupted, or deleted.
PEP57: ascG1::IS186 + 2 unknown mutations celR1::IS2
celBCDF bglR::IS1 bglG33 rpsL ara-14 leuB6
lacZ4680 lacY his-208 metA160 galK2 dTn10cam::ebgA5100 ebgR+L5322 dTn10kan::bglA1000. Constitutive for ascGFB operon and bglGFB operon expression; other ß-glucoside transport and hydrolysis genes are either silent, disrupted, or deleted.
DH5-
E: phi80dlacZ
M15
(lacZYA-argF)U169 endA1 recA1 hsdR17(r-m+) deoR thi-1 phoA supE44
- gyrA96 relA1 gal-.
Growth Media
Minimal media consisted of 423 mg sodium citrate, 100 mg MgSO4.7H2O, 1 g (NH4)2SO4, 540 µg FeCl3, 1 mg thiamine, 3 g KH2PO4, 7 g K2HPO4, 100 mg of each required amino acid, and a carbon source. Carbon sources were as indicated in the text. Solid media included 15 g/liter purified agar (Sigma). L broth consisted of LB broth (Miller 1972
) plus 1 g/liter glucose.
PTS Transport Assays
Phosphoenolpyruvate-dependent transport of lactose and ß-glucoside sugars was measured by a modification of the Imai and Hall (1981)
method. Briefly, cells growing exponentially in glucose minimal medium were concentrated to an A600 of 10 in TP buffer (50 mM Tris-HCl [pH 7.6], 10 mM MgCl2) and were permeabilized by adding 10 µl of 40% (v/v) toluene in ethanol to 1.0 ml of concentrated cells and vortexing thrice for 3 s with a 3-s pause between vortexing cycles. Permeablized cells were stored on ice and were assayed within 10 min. Freshly prepared assay cocktail was maintained at 30°C until used. One hundred microliters of permeabilized cells was added to 4.4 ml of assay cocktail, and 900-µl aliquots were distributed to four cuvettes maintained at 30°C in the temperature-controlled chamber of a Pharmacia Biotech Ultrospec 2000 UV-Vis spectrophotometer. Assays were initiated by adding 100 µl of 40 mM sugar to three of the cuvettes and mixing well. The fourth cuvette, which received 100 µl of buffer, served as a control. Each reaction thus contained 20µl cells, 100 µM NADH, 0.4 U lactate dehydrogenase, 1.0 mM phosphoenolpyruvate, and 4.0 mM of either sugar or buffer. The sugar-dependent release of pyruvate was monitored as the decrease in A338 resulting from the oxidation of NADH to NAD+. The reaction rate was determined by subtracting the
A338 of the control cuvette from the mean
A338 of the experimental cuvettes. Units are expressed as nanomoles of sugar transported per minute.
Phospho-ß-Glycosidase Assays
Phospho-ß-glucosidase activity and phospho-ß-galactosidase were assayed, respectively, on p-nitrophenyl-ß-glucoside-6-PO4 (PNPGluP) or o-nitrophenyl-ß-galactoside-6-PO4 (Sigma) (OPNGalP), in 50 mM Tris-HCl, 10 mM MgCl2 (pH 7.5) buffer at 30°C by continuously monitoring the
A420 in a Pharmacia Biotech Ultrospec 2000 UV-Vis spectrophotometer. Protein concentrations were determined by the Bradford (1976)
assay.
Molecular Methods
The bglA and ascB genes were cloned into the expression vector pPROEX-HTa (Gibco). Expression of the cloned gene results in a protein with a 6x histidine tag separated from the mature peptide by a seven-amino-acid spacer. Sequences of bglA and ascB were taken from the complete sequence of the genome of E. coli K12 (GenBank accession number U00096) (Blattner et al. 1997
). The host for the expression of the cloned genes was PEP24, a strain in which all phospho-ß-glucosidase genes are either deleted or silent and in which no phospho-ß-glucosidase activity is detectable (Thompson et al. 1999
).
The bglA and ascB genes were amplified with the FailSafe (Epicentre) polymerase system, which has a lower error rate than Taq polymerase.
The bglA gene was amplified using primer 1 (ATCTGGAGCCCATGGTAGTGAAAAA), which has an NcoI site at the ATG start of the bglA coding region, and primer 2 (GGAGCTCGTATTGCATCCGGTACTTCATCGAC), which has a SacI site (boldface) at the 5' end of the primer. The resulting amplicon and the vector were each digested with restriction endonumcleases NcoI and SacI, the digests were purified with Qiagen PCR purification columns according to the manufacturer's instructions, and the purified fragments were ligated and transformed into strain PEP24 by electroporation. The inserts in several plasmids were sequenced, and one whose sequence was identical to the published sequence of bglA was retained and the plasmid was designated pBglA.
The ascB gene was amplified using primer 3 (AACTAGTCGACCGTCGCCAAAGAAGTA), which has a SpeI site at the 5' end, and primer 4 (GGAGCTCCCGCATCCGGCACTGTTAC), which has a SacI site at the 5' end. The amplicon was digested with SpeI and SacI and ligated into similarly digested pBluscriptKS+ (Stratagene) to construct plasmid pAscBlu. The ATG start codon of ascB in pAscBlu was converted to an NcoI site by site-directed metagenesis using the Transformer kit (Clonetech) according to the manufacturer's instructions to create pAscBluM. The NcoI/SacI fragment was excised from pAscBluM and ligated into NcoI/SacI-digested pPROExHTa to create plasmid pAscBNco. Because creation of the NcoI site had changed Ser2 to an Ala, site-directed mutagenesis was used to restore Ser2. Sequencing of the ascB coding region revealed that the various manipulations had resulted in a Ser394Gly substitution, so site-directed mutagenesis was used to restore the correct sequence at that point. The sequence of ascB coding region of the final product, pAscB, was confirmed by DNA sequencing. pAscB was transformed into strain PEP24.
Purification of BglA and AscB Proteins
Strain PEP24/pBglA was grown at 37°C to mid-log phase (A600 = 0.5) in 500 ml L broth containing 100 µl/ml ampicillin, at which point isopropyl-ß-d-thiogalactopyranoside (IPTG) was added to a final concentration of 0.6 mM to induce expression of bglA. After 3 h, the cells were harvested and resuspended in 20 ml B-PER protein extraction reagent (Pierce Biochemical), and the suspension was agitated at room temperature for 15 min. The lysate was centrifuged for 15 min at 18,000 x g at 4°C, and the supernate was recovered and maintained at 4°C overnight. Ten milliliters of the supernate was applied to an Ni-NTA affinity resin column (Gibco) (1 ml bed volume) at 4°C. The column was washed at 4°C according to the manufacturer's instructions, and the bound protein was eluted at 4°C in 3 x 0.5-ml fractions in a buffer consisting of 2 mM Tris-HCl (pH 8.5), 100 mM KCl, 2 mM ß-mercaptoethanol, 10% (v/v) glycerol, and 100 mM imidazole.
Activities of the eluate fractions were assayed on 1 mM PNPGluP. The specific activities of the three fractions were similar, so the fractions were combined and digested with rTEV protease (Gibco), an enzyme that is specific for the sequence leu-tyr-phe-gln-gly, which precedes the N-terminal met of BglA expressed from pBglA. The resulting product includes a single glycene preceding that methionine.
The digest was purified over an Ni-NTA column. Both the his tag-spacer arm and the rTEV protease are bound to the column, while the digested BglA protein passes through freely. Fractions of 0.5 ml were collected as the digest was applied to the column and the column was washed. The specific activities of the fractions were similar (1.02.37 nmol/min/mg), but only the fraction with the highest specific activity was retained for further analysis.
Strain PEP24/pAscB was grown, and the AscB protein was purified and characterized in a manner virtually identical to that used for the BglA protein.
The purified proteins were subjected to SDS acrylamide gel electrophoresis. After staining with Sypro Orange (Molecular Probes), the gels were photographed with an electronic camera and the public domain program NIH Image (developed at the U.S. National Institutes of Health and available on the Internet at http://rsb.info.nih.gov/nih-image/) was used to scan the image and to calculate the purity of the major band. The mobilities of those major bands were consistent with the molecular weights of the proteins as estimated from the amino acid sequences.
Chemostat Competition Experiments
Competitions were carried out between ß-glucoside-positive strains that expressed pairs of ß-glucoside utilization operons and the ß-glucoside null strain PEP24.
Monocultures of the two strains were grown overnight at 30°C in minimal medium containing 0.1 g/liter glucose, a concentration that limits growth to about 108 cells/ml. Equal volumes of the two cultures were mixed, and the mixed cultures were used to fill the growth chambers of 30-ml chemostats that were maintained at 30°C. One chemostat was connected to a reservoir containing minimal medium with 0.1 g/liter glucose, and the other to a reservoir containing minimal medium with 0.1 g/liter glucose and 0.5 g/liter lactose. Media from the reservoirs was pumped into the growth chambers at 10 ml/h and was mixed well by bubbling sterile air into the growth chamber. Overflow from the growth chamber was collected sterilely. Samples were collected from the overflow at the beginning and end of each day, and the total overflow volumes between samples were recorded. Samples were suitably diluted and were plated onto 1 g/liter glucose minimal medium to estimate the total number of cells per milliliter and onto 1 g/liter arbutin minimal medium to estimate the number of ß-glucoside-positive cells per milliliter. The number of arbutin-negative (PEP24) cells per milliliter was estimated by subtraction. Each experiment was run for 5 days, about 170180 generations. The selection coefficient for the ß-glucoside-positive strain, s, was estimated from a least-squares fit of the natural log of the ratio of the ß-glucoside-positive to the ß-glucoside-null strain versus generation, where a generation is defined as one growth chamber volume of medium collected from the overflow. Fitness of the ß-glucoside-positive strain is defined as 1 + s.
| Results |
|---|
|
|
|---|
Phylogenetic Analyses
Phospho-ß-Galactosidases
Phospho-ß-galactosidases have been studied experimentally in Lactococcus lactis, Staphylococcus aureus, Streptococcus mutans, Lactobacillus caseii (Witt, Frank, and Hengstenberg 1993
The bglA gene encodes a constitutively expressed enzyme, phospho-ß-glucosidase A (Prasad, Young, and Schaefler 1973
) that is specific for hydrolysis of phosphorylated arbutin.
The bglB gene is part of the cryptic bglGFB operon and encodes phospho-ß-glucosidase B, which hydrolyzes phosphorylated arbutin and salicin (Prasad and Schaefler 1974
; Mahadeven, Reynolds, and Wright 1987
; Schnetz, Toloczyki, and Rak 1987
; Schnetz and Rak 1988
). The bgl operon is maintained in a silent state by silencer elements that are located both upstream and downstream of the promoter and the CAP binding site (Schnetz 1995
). The operon can be activated by mutations that disrupt those flanking silencer element sequences. The most common disruptions involve insertions of IS1 or IS5 into that 223-bp region (Schnetz and Rak 1988
), but rare IS2, IS10, or TN1000 insertional activation and activation by deletion of portions of the sequence upstream of the CAP binding site have also been reported (Schnetz 1995
; Schnetz and Rak 1992
). The bgl operon can also be activated by either of two base substitutions in the CAP binding site (Schnetz and Rak 1992
).
The ascB gene is part of the cryptic ascGFB operon and encodes a phospho-ß-glucosidase that hydrolyzes phosphorylated arbutin, salicin, and cellobiose (Hall and Xu 1992
). The asc operon is activated by insertion of IS186 into ascG at a single site near the 3' end of that gene (Hall and Xu 1992
).
Sequences of each of the three E. coli phospho-ß-glucosidase proteins were used to search the nonredundant protein database at NCBI using the BLASTP program. The 22 most similar sequences (table 1 ) were aligned with BglA, BglB, and AscB as described in Materials and Methods. The resulting DNA alignment was used to construct a phylogenetic tree (fig. 2 ) by Bayesian analysis using the program MrBayes as described in Materials and Methods. The evolutionary model was the General Time Reversible model, and among-site variation in evolutionary rate was estimated separately for first, second, and third positions of sites within codons. Four chains, with a "temperature" of 0.2 for the heated chains, were run for 496,500 generations, sampling trees every 100 generations. The ln likelihood of the trees had converged on a constant value by generation 10,000, i.e., after saving 100 trees. The consensus tree was calculated from the final 4,200 trees visited, well after convergence had occurred.
|
|
Among the E. coli phospho-ß-glucosidases, the closest relative of a known phospho-ß-galactosidase, phospho-ß-galactosidase 1 of Lactobacillus gasseri, is BglA (fig. 2 ).
PTS Enzyme II-lac
Each of the known PTS Enzyme II-lactose protein sequences was used to search the E. coli K12 genome by the BLASTP program. Only one protein, EnzymeII-cellobiose, encoded by the cryptic celB gene, showed significant homology (P < 10-3) to any of the Enzyme II-lactose proteins. The E. coli CelB protein sequence was used to search the NCBI nonredundant protein sequence data base. Eleven proteins, including all of the known Enzyme II-lactose proteins, that are significantly similar to CelB (P < 10-4) were identified. The DNA sequences encoding those proteins and the E. coli CelB protein were aligned as described in Materials and Methods. The aligned sequences were used to construct a Bayesian phylogenetic tree (fig. 3
) exactly as for the phospho-ß-glycosidases above.
|
Structural Analysis
Each of the proteins AscB, BglA, and BglB were submitted to the 3Dcrunch project (Peitsch et al. 1997
The majorities of the three E. coli proteins (residues 58454 out of 479 amino acids of BglA, 57437 out of 470 for BglB, and 56471 out of 474 for AscB) were structurally alignable with the phospho-ß-galactosidase structures and were used to construct the model structures. Swiss-Pdb Viewer (Guex and Peitsch 1997
) was used to visualize the superimposed models of the four proteins.
Figure 4
shows the active-site residues of the L. lactis phospho-ß-galactosidase including hydrogen bonding with galactose-6-phosphate (Wiesmann et al. 1995
). All but two of those residues are identical in the three E. coli phospho-ß-glucosidases, the exceptions being Asn297, which is Ser in all three phospho-ß-glucosidases, and Trp429, which is Ala in BglB and AscB, but Phe in BglA. Weisman et al. (1995) point out that these exchanges suggest that the binding patterns of the phospho-ß-glucosidases for glucoside substrates is likely to be quite different from that of the phospho-ß-galactosidase for the galactoside substrate because, "Presumably, the 6-phospho-glucosides with their equatorial O4-atom show nothing equivalent to the intrinsic hydrogen bond between the axial O4-atom and the phosphate in Gal-6-P." The similarity between Trp429 of the phospho-ß-galactosidase and the Phe433 of the BglA phospho-ß-glucosidase suggests that BglA might be able to evolve phospho-ß-galactosidase by substitution of Asn for Ser315, which is homologous to Asn297 of the L. lactis phospho-ß-galactosidase, while BglB and AscB would require two substitutions to fully superimpose the active-site residues.
|
Biochemical Analyses
PTS Transport Activities
In addition to the cryptic cel operon, which includes the celABC genes for PTS-mediated transport of cellobiose (Kricker and Hall 1987
bglFGB
celBCDF strains (unpublished results) and are able to utilize arbutin because of the constitutively expressed bglA gene. Inactivation of bglA by insertion of a transposon renders arbT+ strains phenotypically arbutin-negative. The strains listed in table 2 express the indicated genes constitutively, and all other PTS ß-glucoside genes are either deleted or silent (see Materials and Methods), and all strains are lactose-negative. Cultures grown in glucose minimal medium were assayed for sugar transport as described in Materials and Methods. Because the glucose transport system is expressed constitutively, glucose transport served as an internal control for day-to-day variation in PTS activity. Activities relative to glucose are probably better measures of effective transport rates than are the absolute measurements.
|
The bglF-encoded protein was not previously known to transport cellobiose, and indeed strain PEP25, which grows well on both arbutin and salicin, is cellobiose negative. The observation that strain PEP25 transports cellobiose at about the same rate that it does salicin is consistent with the notion that the bglB-encoded phospho-ß-glucosidase, part of the same operon as bglF, is inactive toward cellobiose-6-phosphate. The observation that strain PEP25 transports lactose at 7% of the rate at which it transports glucose is surprising and is, to the best of my knowledge, the first evidence for transport of a ß-galactoside sugar by the bglF-encoded protein.
The relative rates at which the celABC-encoded PTS system transports glucose, cellobiose, arbutin, and salicin in strain PEP14 is consistent with earlier observations (Kricker and Hall 1987
), but this is the first evidence for lactose transport by that system. The celABC system transports lactose fairly efficiently, at 24% of the glucose transport rate. The lactose transport rate by the celABC system is as high as the salicin transport rate by the bglF system, which allows good growth on salicin. The lactose-negative phenotype of strain PEP14 cannot, therefore, be attributed to a low lactose transport rate and must result from the failure of the celF-encoded phospho-ß-glucosidase to hydrolyze lactose-phosphate at a rate sufficient for growth. Neither ArbT nor AscF transports lactose at a detectable rate.
Phospho-ß-Glucosidase Activities
The BglA and AscB proteins were expressed and purified as described in Materials and Methods. BglA was estimated to be 98% pure and AscB to be 85% pure by SDS acrylamide gel electrophoresis. The purified proteins were assayed for phospho-ß-glucosidase and phospho-ß-galactosidase activities as described in Materials and Methods (table 3
). The Michaelis-Menton kinetic parameters Km and Kcat were determined in duplicate trials at 2x increasing concentrations from 0.015625 mM to 1.0 mM PNPGluP and were estimated as previously described (Hall 1976
) (table 3 ). Activities toward the galactoside substrate ONPGalP were determined at 2.0 mM substrate (table 3
). Activities were too low to permit determining the Km toward ONPGalP.
|
All three of the Family 1 phospho-ß-glucosidases exhibit phospho-ß-galactosidase activity, but the range of that activity relative to phospho-ß-glucosidase activity is enormous. At 2 mM ONPGalP, BglB enzyme is 20% as active toward the galactoside as the glucoside substrate, while the AscB protein is only 2.9 x 10-3 as active and the BglA protein is only 2.1 x 10-4 as active a phospho-ß-galactosidase as a phospho-ß-glucosidase.
The Family 1 phospho-ß-galactosidases of S. aureus, L. lactis, and L. casei exhibit only 14- to 22-fold preferences for the phospho-ß-galactoside relative to the phospho-ß-glucoside substrates (Witt, Frank, and Hengstenberg 1993
). Likewise, phospho-ß-galactosidase I and phospho-ß-galactosidase II of L. gasseri (Saito et al. 1998
) hydrolyze the phospho-ß-galactoside and phospho-ß-glucoside substrates at similar rates (T. Saito, personal communication). In contrast, two of the three cryptic Family 1 phospho-ß-glucosidases are highly specific with 4.8 x 104fold (BglA) and 322-fold (AscB) preferences for the phospho-ß-glucoside over the phospho-ß-galactoside substrate.
Competition Experiments
Because the natural substrates arbutin, salicin, cellobiose, and lactose are not commercially available in the phosphorylated form, it is necessary to assay phospho-ß-glucosidase and phospho-ß-galactosidase activities using the analogs p-nitrophenyl-ß-d-glucopyranoside and o-nitrophenyl-ß-d-galactopyranoside. Nitrophenyl substrates are often hydrolyzed more efficiently than corresponding natural sugars; thus, inferences of lactose-phosphate hydrolysis rates from ONPGalP hydrolysis rates are not as strong as one might like. Thus, the observation that BglB enzyme hydrolyzes ONPGalP about 20% as well as it does PNPGluP and that BglF transports lactose at more than half of the rate at which it transports salicin does not necessarily mean that constitutive expression of the bglGFB operon is likely to permit utilization of lactose by the PTS pathway. Indeed, all of the strains in table 2
are completely lactose-negative; i.e., they are unable to form colonies on lactose minimal plates.
On the other hand, lactose utilization might require a PTS transport system encoded by one operon in conjunction with a phospho-ß-galactosidase encoded by another operon. To determine whether any combination of ß-glucoside transport genes and phospho-ß-glucosidase genes would permit lactose utilization, strains constitutively expressing the six possible pairs of operons were constructed (see Materials and Methods). For this purpose, the arbT-encoded transport system and the bglA-encoded phospho-ß-glucosidase were considered an "operon," although there is no evidence that they are so organized. All six combinations were lactose negative; thus, none of the operons under consideration, singly or in pairs, allow utilization of lactose as a sole carbon and energy source.
Although none of the combinations permit utilization of lactose as a sole carbon and energy source, one or more combinations might allow sufficient cometabolism of lactose to provide a selective advantage when other carbon sources are limiting. To test that possibility, strains expressing pairs of ß-glucoside utilization operons were competed with strain PEP24, which is null for all four operons, in glucose-limited chemostats and in glucose-limited chemostats with excess lactose (Materials and Methods). The relative fitnesses of the ß-glucoside-positive strains were estimated from the change in the ratio of ß-glucoside-positive to ßglucoside-null cells per generation.
Table 4 shows the relative fitnesses of each ß-glucoside-positive strain in the presence and absence of lactose based on two independent paired chemostat experiments. Paired t-tests showed that in no case did lactose confer a significant fitness advantage upon a ß-glucoside-positive strain. Thus, despite the fact that that celABC system permits PTS-mediated transport of lactose at 24% of the glucose transport rate (table 2 ), none of the phospho-ß-glucosidases hydrolyze the lactose phosphate at a rate that provides any growth advantage. While these experiments do not help predict which genes might have more potential for evolving a lactose PTS/phospho-ß-galactosidase system, they do confirm that any potential is strictly that, a future potential, and not a present capability.
|
| Discussion |
|---|
|
|
|---|
On the basis of phylogenetic distance from a known phospho-ß-galactosidase, bglA is the E. coli gene most likely to evolve phospho-ß-galactosidase activity, followed in descending order by ascB and bglB; i.e., bglA > ascB > bglB.
On the basis of structural homology with the L. lactis phospho-ß-galactosidase active-site residues, bglA is the E. coli gene most likely to evolve phospho-ß-galactosidase activity, and that activity is predicted to arise via substitution of an asparagine for the serine at position 315 of the BglA protein.
On the basis of biochemical activity, the E. coli gene most likely to evolve phospho-ß-galactosidase activity is bglB. The order bglB >> ascB > bglA >>> celF is the opposite of the order predicted by phylogenetic considerations.
Both phylogenetic and biochemical considerations predict that the celABC genes are the most likely to evolve into a lactose-PTS transport system.
With the predictions in hand, we can now begin to test those predictions by experimental evolution of lactose utilization using each of the four strains that expresses a single ß-glucoside utilization operon, each of the six strains that express a pair of operons, and the null strain, which expresses none of the operons. Both in vivo selection of spontaneous Lac+ mutants and in vitro evolution of the individual transport and phospho-ß-glucosidase genes will be used to test the predictions.
There are three possible outcomes of the experiments. It might prove impossible to isolate Lac+ mutants, Lac+ mutants might arise from mutations in genes other than the ß-glucoside utilization genes, or they might arise from mutations in some of the predicted ß-glucoside utilization genes. The first possibility has been ruled out. Spontaneous Lac+ mutants have been isolated from strain PEP60, a strain that expresses all four of the ß-glucoside utilization genes (unpublished results). A parallel attempt to isolate Lac+ mutants from the ß-glucoside null strain PEP24 failed. While not definitive, that result makes the second possibility unlikely.
| Acknowledgements |
|---|
|
|
|---|
I am grateful to Ross LaRosa for expert technical assistance. I am deeply grateful to Jack Thompson for the gift of p-nitrophenyl-ß-glucopyranoside-6-phosphate, which is not commercially available, and to Tadao Saito for the gift of half of the world's remaining supply of commercially available o-nitrophenyl-ß-galactopyranoside-6-phosphate. I am grateful to Tony Dean for insisting that I consider structural homology as a predictor of enzyme evolution.
| Footnotes |
|---|
Antony Dean, Reviewing Editor
1 Keywords: phospho-ß-galactosidase
phospho-ß-gucosidase
PTS transport
experimental evolution
Escherichia coli ![]()
2 Address for correspondence and reprints: Barry G. Hall, Department of Biology, University of Rochester, Rochester, New York 14625-0222. E-mail: drbh{at}mail.rochester.edu ![]()
| References |
|---|
|
|
|---|
Altschul S. F., W. Gish, W. Miller, E. W. Myers, D. J. Lipman, 1990 Basic local alignment search tool J. Mol. Biol 215:403-410[ISI][Medline]
Altschul S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, D. J. Lipman, 1997 Gapped BLAST and PST-BLAST: a new generation of protein database search programs Nucleic Acids Res 25:3389-3402
Blattner F. R., G. Plunket III, C. A. Bloch, et al. (17 co-authors). 1997 The complete genome sequence of Escherichia coli K-12 Science 277:1453-1462
Bradford M. M., 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding Anal. Biochem 72:248-254[ISI][Medline]
Clarke P. H., 1984 Amidases of Pseudomonas aeruginosa. Pp. 187231 in R. P. Mortlock, ed. Microorganisms as model systems for studying evolution. Plenum Press, New York and London
Guex N., A. Diemand, M. C. Peitsch, 1999 Protein modelling for all Trends Biochem. Sci 24:364-367[ISI][Medline]
Guex N., M. C. Peitsch, 1997 SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling Electrophoresis 18:2714-2723[ISI][Medline]
Hall B. G., 1976 Experimental evolution of a new enzymatic function. Kinetic analysis of the ancestral (ebgo) and evolved (ebg+) enzymes J. Mol. Biol 107:71-84[ISI][Medline]
. 1978 Experimental evolution of a new enzymatic function: II. Evolution of multiple functions for EBG enzyme in E. coli Genetics 89:453-465
. 1979 Lactose metabolism involving phospho-ß-galactosidase in Klebsiella. J. Bacteriol 138:691-698
. 1981 Changes in the substrate specificities of an enzyme during directed evolution of new functions Biochemistry 20:4042-4049[Medline]
. 1995 Evolutionary potential of the ebgA gene Mol. Biol. Evol 12:514-517[ISI][Medline]
. 1999a. Experimental evolution of Ebg enzyme provides clues about the evolution of catalysis and to evolutionary potential FEMS Microbiol. Lett 174:1-8[ISI][Medline]
. 1999b. Toward an understanding of evolutionary potential FEMS Microbiol. Lett 178:1-6
Hall B. G., P. W. Betts, 1987 Cryptic genes for cellobiose utilization in natural isolates of Escherichia coli Genetics 115:431-439
Hall B. G., P. W. Betts, M. Kricker, 1986 Maintenance of the cellobiose utilization genes of Escherichia coli in a cryptic state Mol. Biol. Evol 3:389-402[Abstract]
Hall B. G., P. W. Betts, J. C. Wootton, 1989 DNA sequence analysis of artificially evolved ebg enzyme and ebg repressor genes Genetics 123:635-648
Hall B. G., K. Imai, C. Romano, 1982 Genetics of the lac-PTS system of Klebsiella Genet. Res 39:287-302[ISI][Medline]
Hall B. G., H. S. Malik, 1998 Determining the evolutionary potential of a gene Mol. Biol. Evol 15:514-517
Hall B. G., M. Murray, S. Osborne, M. L. Sinnott, 1983 The catalytic consequences of experimental evolution. Part III. Construction of reaction profiles for hydrolysis of lactose by ebgo, ebga, and ebgb enzymes via measurements of the enzyme-catalyzed exchange of galactose-1-18O by 13C NMR spectroscopy J. Chem. Soc. Perkin Trans II:1595-1598
Hall B. G., L. Xu, 1992 Nucleotide sequence, function, activation, and evolution of the cryptic asc operon of Escherichia coliK12 Mol. Biol. Evol 9:688-702[Abstract]
Hall B. G., S. Yokoyama, D. Calhoun, 1983 Role of cryptic genes in microbial evolution Mol. Biol. Evol 1:109-124[Abstract]
Hall G. G., 1986 Enzyme evolution Pp. 469477 in I. Moo-Young, ed. Comprehensive biotechnology. Pergammon Press, Oxford, England
Huelsenbeck J. P., 2000 MrBayes: Bayesian inferences of phylogeny Rochester, N.Y.
Imai K., B. G. Hall, 1981 Properties of the lactose transport system in Klebsiella strain CT-1 J. Bacteriol 145:1459-1462
Kricker M., B. G. Hall, 1987 Biochemical genetics of the cryptic gene system for cellobiose utilization in Escherichia coliK12 Genetics 115:419-429
Lenski R. E., M. Travisano, 1994 Dynamics of adaptation and diversification: a 10,000-generation experiment with bacterial populations Proc. Natl. Acad. Sci. USA 91:6808-6814
Mahadeven S., A. E. Reynolds, A. Wright, 1987 Positive and negative regulation of the bgl operon of Escherichia coli. J. Bacteriol 169:2570-2578
Mau B., M. Newton, 1997 Phylogenetic inference for binary data on dendrograms using Markov chain Monte Carlo J. Comput. Graph. Stat 6:122-131
Mau B., M. Newton, B. Larget, 1999 Bayesian phylogenetic inference via Markov chain Monte Carlo methods Biometrics 55:1-12[ISI][Medline]
Miller J. H., 1972 Experiments in molecular genetics Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y
Mortlock R. P., ed. 1984 Microorganisms as model systems for studying evolution Plenum Press, New York and London
Parker L. L., B. G. Hall, 1988 A fourth E coli gene system with the potential to evolve ß-glucoside utilization. Genetics 119:485-490
. 1990 Characterization and nucleotide sequence of the cryptic cel operon of E. coli K12 Genetics 124:455-471[Abstract]
Peitsch M. C., M. R. Wilkins, L. Tonella, J. C. Sanchez, R. D. Appel, D. F. Hochstrasser, 1997 Large-scale protein modelling and integration with the SWISS-PROT and SWISS-2DPAGE databases: the example of Escherichia coli. Electrophoresis 18:498-501[ISI][Medline]
Prasad I., S. Schaefler, 1974 Regulation of the ß-glucoside system in Escherichia coli K12 J. Bacteriol 120:638-650
Prasad I., B. Young, S. Schaefler, 1973 Genetic determination of the constitutive biosynthesis of phsopho-b-glucosidase A in Escherichia coliK12 J. Bacteriol 114:909-915
Rannala B., Z. H. Yang, 1996 Probability distribution of molecular evolutionary trees: a new method of phylogenetic inference J. Mol. Evol 43:304-311[ISI][Medline]
Saito T., M. Suzuki, K. Konno, H. Kitazawa, Y. Kawai, T. Itoh, Y. Kamio, 1998 Molecular cloning and sequencing of two phospho-ß-galactosidase I and II genes of Lactobacillus gasseri JCM1031 isolated from human intestine Biosci. Biotechnol. Biochem 62:2318-2327[Medline]
Schnetz K., 1995 Silencing of Escherichia coli bgl promoter by flanking sequence elements EMBO J 14:2545-2550[ISI][Medline]
Schnetz K., B. Rak, 1988 Regulation of the bgl operon of Escherichia coli by transcriptional anti-termination EMBO J 7:3271-3277[ISI][Medline]
. 1992 IS5: a mobile enhancer of transcription in Escherichia coli. Proc. Natl. Acad. Sci. USA 89:1244-1248
Schnetz K., C. Toloczyki, B. Rak, 1987 ß-glucoside (Bgl) operon of Escherichia coli K12: nucleotide sequence, genetic organization, and possible evolutionary relationship to regulatory components of two Bacillus subtilis genes J. Bacteriol 169:2579-2590
Schwede T., A. Diemand, N. Guex, M. C. Peitsch, 2000 Protein structure computing in the genomic era Res. Microbiol 151:107-112[Medline]
Swofford D. L., 2000 PAUP*. Phylogenetic analysis using parsimony (*and other methods) Sinauer, Sunderland, Mass
Thompson J., S. B. Ruvinov, D. I. Freedberg, B. G. Hall, 1999 Cellobiose-6-phosphate hydrolase (CelF) of Escherichia coli: characterization and assignment to the unusual family 4 of glycosylhydrolases J. Bacteriol 181:7339-7345
Thompson J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, D. G. Higgins, 1997 The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 25:4876-4882
Wiesmann C., G. Beste, W. Hengstenberg, G. E. Schulz, 1995 The three-dimensional structure of the 6-phospho-beta-galactosidase from Lactococcus lactis. Structure 3:961-968[Medline]
Witt E., R. Frank, W. Hengstenberg, 1993 6-Phsopho-ß-galactosidases of Gram-positive and 6-phsopho-ß-glucosidase B of Gram-negative bacteria: comparison of structure and function by kinetic and immunological methods and mutagenesis of the lacG gene of Staphylococcus aureus. Protein Eng 6:913-920
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. Stoltzfus Mutation-Biased Adaptation in a Protein NK Model Mol. Biol. Evol., October 1, 2006; 23(10): 1852 - 1862. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Barlow and B. G. Hall Experimental Prediction of the Evolution of Cefepime Resistance From the CMY-2 AmpC {beta}-Lactamase Genetics, May 1, 2003; 164(1): 23 - 29. [Abstract] [Full Text] [PDF] |
||||
| |||||||||





