Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (39)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lukens, L.
Right arrow Articles by Doebley, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lukens, L.
Right arrow Articles by Doebley, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Biology and Evolution 18:627-638 (2001)
© 2001 Society for Molecular Biology and Evolution


ARTICLE

Molecular Evolution of the teosinte branched Gene Among Maize and Related Grasses

Lewis Lukens1, and John Doebley2,

Department of Plant Biology, University of Minnesota at Minneapolis St. Paul


    Abstract
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 
Several authors have proposed that changes in a small number of regulatory genes may be sufficient for the evolution of novel morphologies. Recent analyses have indicated that teosinte branched1 (tb1), a putative bHLH transcription factor, played such a role during the morphological evolution of maize from its wild ancestor, teosinte. To address whether or not tb1 played a similar role during the evolution of the Andropogoneae, the tribe to which maize belongs, and to examine the rate and pattern of tb1 evolution within this tribe, we analyzed tb1-like sequences from 23 members of the Andropogoneae and five other grasses. Our analysis revealed that the TB1 protein evolves slowly within three conserved domains but rapidly outside these domains. The nonconserved regions of the gene are characterized by both a high nonsynonymous substitution rate and frequent indels. The ratio of nonsynonymous substitutions per nonsynonymous site (dN) to synonymous substitutions per synonymous site (dS) was not significantly greater than 1.0, providing no evidence for positive selection. However, the dN/dS ratio varied significantly among lineages and was high compared with those of other plant nuclear genes. Variation in the dN/dS ratio among the Andropogoneae could be explained by unequal levels of purifying selection among lineages. Consistent with this interpretation, the rate of nonsynonymous substitution differed along several lineages, while the synonymous substitution rate did not differ significantly. Finally, using tb1, we examined phylogenetic relationships within the Andropogoneae. The phylogeny suggests that the tribe underwent a rapid radiation during its early history and that the monoecious Andropogoneae are polyphyletic.


    Introduction
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 
Molecular genetic analyses have demonstrated that transcription factors often act as switches between discrete developmental programs, encouraging the view that novel morphologies may arise from changes in this class of genes (Goodrich, Carpenter, and Coen 1992Citation ; Carroll 1994Citation ; Doebley and Lukens 1998Citation ). Differences in the expression patterns of transcription factors may alter the timing and location of developmental events and thereby generate morphological variation. Indeed, changes in the level and localization of transcription factor mRNA have been correlated with phenotypic differences within and between species (Doebley, Stec, and Hubbard 1997Citation ; Stern 1998Citation ; Cubas, Vincent, and Coen 1999Citation ). The analysis of DNA sequence variation provides another means of investigating the contribution of transcription factors to morphological evolution. For example, naturally occurring alleles of the MADS box transcription factor, cauliflower, possess an excess of intraspecific nonsynonymous substitutions, and this variation is associated with effects on floral morphology (Purugganan and Suddith 1998Citation ). Analyses of coding sequence variation can also provide evidence for past episodes of positive selection (e.g., Sutton and Wilkinson 1997Citation ) and variation in the rate of sequence evolution (e.g., Yang and Nielsen 1998Citation ).

The teosinte branched1 (tb1) gene belongs to the TCP gene family whose members encode putative basic helix-loop-helix DNA-binding proteins that appear to play a role in organ growth. In rice, two members of the TCP family, PCF1 and PCF2, have been shown to act as DNA-binding proteins and to participate in cell cycle regulation (Kosugi and Ohashi 1997Citation ). Another TCP gene is cycloidea of the snapdragon, which is required for the formation of a bilaterally symmetrical flower (Luo et al. 1996Citation ). A naturally occurring hypermethylated allele of cycloidea cosegregates with a radially symmetric floral phenotype in Linaria, a relative of the snapdragon (Cubas, Vincent, and Coen 1999Citation ). tb1 itself corresponds to a quantitative trait locus that distinguishes maize from its wild ancestor teosinte in plant architecture, and the maize allele of tb1 shows evidence of having undergone a selective sweep during maize domestication (Wang et al. 1999Citation ). Maize plants introgressed with the teosinte allele of tb1 have long side branches like teosinte (Doebley, Stec, and Gustus 1995Citation ; Lukens and Doebley 1999Citation ).

The involvement of TCP gene family members in the morphological evolution of two distantly related flowering plants (maize and Linaria) suggests that these genes may have frequently contributed to morphological evolution. To investigate this possibility, we chose to analyze the evolution of tb1-like genes among members of the grass tribe Andropogoneae. This tribe includes maize and a variety of other grasses, such as sorghum and sugarcane. The morphology of the tribe is remarkably diverse, most notably in floral and inflorescence characteristics (Clayton 1987Citation ). The tribe likely originated within the past 30 Myr and underwent a rapid radiation (Mason-Gamer, Weil, and Kellogg 1998Citation ; Spangler et al. 1999Citation ). If tb1 was involved in the morphological diversification of the tribe, the pattern of sequence evolution in tb1 may contain evidence for past episodes of positive selection.

To examine whether the pattern of DNA sequence variation in tb1-like genes is consistent with a history of past positive selection, we analyzed 27 tb1-like genes from within the tribe Andropogoneae and the subfamily to which it belongs, Panicoideae. We also compared these genes with an additional tb1-like sequence from rice (Oryza sativa), a more distantly related grass. We addressed several questions. How variable is tb1 among these grasses both overall and within specific regions of the gene? Does either the tb1 gene overall or any specific region within it possess the signature of positive selection as measured by an excess of nonsynonymous substitutions per nonsynonymous site (dN) relative to synonymous substitutions per synonymous site (dS)? Does the dN/dS ratio vary among lineages, suggesting lineage-specific episodes of positive selection? Has tb1 evolved in a clocklike fashion at both synonymous and nonsynonymous sites as expected for a strictly neutral gene? In general, our analyses suggest that although some parts of the coding region have evolved rapidly relative to others, the pattern of evolution is consistent with models that do not invoke positive selection. Similarly, although the dN/dS ratio varies among lineages, our analyses suggest that this is more likely a function of relaxed constraint within some lineages than a function of positive selection.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 
Plant Material
tb1-like sequences were isolated from members of the tribe Andropogoneae of the subfamily Panicoideae of the grass family, Poaceae (table 1 ). The taxa were selected for broad representation of the Andropogoneae, with the inclusion of rice and several nonandropogonoid members of the panicoid subfamily as outgroups.


View this table:
[in this window]
[in a new window]
 
Table 1 Names and Origins of Analyzed Taxa, Including Collection Numbers

 
Nucleic Acid Isolation, Southern Transfer, and Membrane Hybridization
Genomic DNA extractions, restriction digestions, electrophoresis, and Southern hybridizations were performed as previously described (Doebley and Stec 1993Citation ) except that membranes were washed under less stringent conditions following hybridization with a radiolabeled probe. Membranes were washed three times for 30 min at 65°C in 0.5 x SSC and 0.2% SDS. Cloned restriction fragments of tb1 (H3.4 or NH0.8) from maize were used as probes (Doebley, Stec, and Hubbard 1997Citation ).

Library Construction
Phage libraries for rice, sorghum, Zea diploperennis, and Tripsacum cundinamarce were constructed from size-selected genomic DNA fragments. Genomic DNAs were digested with EcoRI, HindIII, or SstI, and Southern blot analyses were performed. These blots revealed only one strongly hybridizing band for each of these species when hybridized with the radiolabeled maize tb1 probe (see Results). Based on these results, the genomic DNAs were digested again and electrophoresed (0.8% 1 x TAE low-melting-point agarose gel), and fragments the size of the tb1-hybridizing band were excised from the gel. The selected DNA fragments were purified from the agarose plug by agarase digestion (Boehringer) followed by nucleic acid precipitation. The size-selected genomic DNA fragments were cloned into Lambda ZapII or Lambda DashII vectors (Stratagene).

Between 150,000 and 1,600,000 plaques were screened from each library using the plaque lift procedure as described by Sambrook, Fritsch, and Maniatis (1989)Citation . Probes and hybridization conditions were identical to those described above for Southern blotting. Areas of the plate that contained plaques which strongly hybridized to the probe were excised, and the selected phage population was screened two additional times, until a plaque containing a single phage genotype was obtained. For Lambda DashII, lambda DNA was harvested and the insert was subcloned into pBluescript using standard plating, harvesting, and subcloning techniques (Sambrook, Fritsch, and Maniatis 1989Citation ). For Lambda ZapII, autoexcision was used to isolate plasmids containing the cloned insert as per the manufacturer's instructions (Stratagene).

Primers, PCR, and Subcloning
PCR with oligonucleotide primers was used to amplify tb1-like genes from genomic DNA of taxa within the tribes Andropogoneae, Arundinelleae, and Paniceae. Primer names and sequences were JD96 (TCCCATCAGTAAAGCACATG), JD73 (GCTCTTGGCAGTAGTAGTTGC), and JD75 (GTATCCTCCTCCTCCGTTGC). JD96 was the forward primer and was used with either JD75 or JD73 as the reverse primer. Amplification was achieved using {approx}50 ng genomic DNA as template with the following components: 50 µl PCR Supermix (BRL Life Technologies), 10 pmol of each primer, and 5 µl DMSO. Reactions were heated to 95°C for 1 min prior to cycling. Cycling parameters consisted of 36 cycles at 95°C for 1 min, between 42°C and 51°C for 1 min, and 75°C for 3 min. After the cycles were complete, samples were incubated at 75°C for 10 min and cooled to 4°C. PCR reaction products were electrophoresed on agarose gels, and PCR products that were of the expected size (approximately 1,100 bp) were cloned using the TA or TOPO-TA cloning kits (Invitrogen). Ligation, transformation, and colony selection were carried out according to the manufacturer's instructions, and plasmids were purified from Escherichia coli using Qiaprep columns (Qiagen).

DNA Sequencing and Alignment
The coding and complementary strands of all plasmid inserts were sequenced using an ABI 373A automated DNA sequencing machine, with the exception of the nucleotide sequence of Zea mays tb1, which was previously reported (Doebley, Stec, and Hubbard 1997Citation ). Sequence data were edited with Sequencher 3.0 (Gene Codes Corp.), and sequences were aligned by eye using Se-Al, Sequence Alignment Editor, version 1.1 (Rimbaut 1996Citation ). Sequences have been deposited in GenBank (accession numbers AF322117AF322143).

Phylogenetic and Evolutionary Analyses
Phylogenetic analyses were performed using both the maximum-likelihood and the parsimony methods of PAUP*, version 4.0 (Swofford 1999Citation ). For maximum- likelihood analyses, unless stated otherwise, the gamma shape parameter alpha was 0.5, base frequencies were determined empirically from the sequence, and the transition : transversion ratio was set at the default value of 2.0. To find all shortest trees and to identify multiple tree islands, 100 heuristic maximum-parsimony searches were done with tree bisection-reconnection (TBR) branch swapping and random order of taxon addition. Bootstrap support for nodes was estimated using the parsimony criterion with 1,000 bootstrap replicates. Different tree topologies were compared using the Templeton (1983)Citation test and the Kishino-Hasegawa test (Kishino and Hasegawa 1989Citation ).

We used a sliding-window analysis in the WINA computer program to examine the ratio of nonsynonymous to synonymous substitution rates along the tb1- like sequences (Nei and Gojobori 1986Citation ; Ina et al. 1994Citation ). The ratio of the number of nonsynonymous substitutions per nonsynonymous site to the number of synonymous substitutions per synonymous site corrected for multiple hits (dN/dS) was estimated between two sequences for 60-bp windows at 3-bp intervals. Gaps were ignored in this analysis. MEGA was used to calculate pairwise dS and dN values for the sequence overall (Kumar, Tamura, and Nei 1993Citation ). Six of the 27 panicoid grasses were excluded from both the MEGA and the WINA analyses, since they differed by <=0.020 nt per site from another sequence and thus contributed little additional information to the analysis.

The Macintosh version of PAML (Yang 1998Citation ) was used to compare strictly neutral and positive selection models of coding sequence evolution. In the strictly neutral model, the coding sequences were constrained to have evolved with dN/dS ratios of 0.0 (nonsynonymous substitutions do not occur) or 1.0 (nonsynonymous substitutions occur at the same rate per nonsynonymous site as synonymous substitutions per synonymous site). These values reflect the strictly neutral expectation that almost all nonsynonymous mutations are either deleterious or neutral (Kimura 1983Citation ). In the positive-selection model, two dN/dS values were constrained to be 1.0 or 0.0, as above, but a third dN/dS statistic was inferred from the data and could take on any value. If the predicted third dN/dS ratio was significantly greater than 1.0, nonsynonymous changes were inferred to occur more frequently than synonymous substitutions at some codons, and there was evidence for positive selection. The difference between a strictly neutral model (dN/dS = 1.0 or 0.0) and a positive-selection model may be determined with a likelihood ratio test (Nielsen and Yang 1998Citation ).

PAML was also used to test the strictly neutral prediction that for a given gene phylogeny, the dN/dS ratio would be the same for all lineages. The likelihoods of two models were again compared. In the first model, a single dN/dS ratio is estimated and constrained to fit all lineages. In the second model, dN/dS statistics were estimated for every lineage. A likelihood ratio test was used to determine whether one of these two models explained the data better than the other (Yang and Nielsen 1998Citation ).

For both the coding and the lineage analyses, a total of 19 sequences were analyzed using PAML. With the exception of Arundinella, sequences from taxa not classified within the Andropogoneae (Panicum, Danthoniopsis, and Pennisetum) and Andropogoneae sequences that were very similar to other sequences (Zea diploperennis, Capillipedium parviflorum, Chionachne koenigii, Sorghum australiense, and Sorghum bicolor from Ethiopia) were excluded from the analysis. The transition : transversion ratio and the nucleotide frequencies at each codon position were estimated from the data. The maximum-likelihood tree generated by PAUP (see below) was used in all PAML analyses.

The program Codrates was used to detect both synonymous and nonsynonymous substitution rate variation along different lineages (Muse and Gaut 1994Citation ). Codrates examines substitution rates in trees with three taxa in which two sequences have diverged more recently than the third or outgroup sequence. The likelihoods of two models were compared. In the first model, the lineages from the most recent common ancestor to the two related taxa were constrained to have the same substitution rate. In the second model, these lineages could have different substitution rates. A likelihood ratio test was used to test which of these models best explained the data. As in the PAML analysis, Arundinella and 18 representative sequences from within the Andropogoneae were included.


    Results
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 
Cloning of tb1-like Sequences
As a first step, we wished to establish whether tb1 existed as a multigene family or as a single-copy gene in the grasses. Southern blot analysis of genomic DNAs from nine members of the grass family using a tb1 probe revealed one strongly hybridizing fragment in most grasses, and no grass had more than three clearly hybridizing fragments (fig. 1 ). This result suggests that lambda cloning would likely yield orthologous sequences, especially since our size-selected libraries targeted the most intensely hybridizing fragments for those species with more than one fragment. Similarly, PCR-based isolation of tb1-like sequences would be unlikely to yield a complex mixture of paralogous sequences given the low copy number of tb1 among the grasses. Nevertheless, given the dynamic nature of plant genomes, orthology cannot be assured on the basis of these data.



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 1.—Southern blot of genomic DNAs from several taxa restricted with HindIII and hybridized with a radiolabeled 32P maize genomic tb1 clone (NH0.8). The blot shows that tb1 often hybridizes strongly to only one genomic fragment size. The letters above the lanes refer to the following taxa: A—Oryza sativa (rice); B—Saccharum officinarum (sugarcane); C—Coix aquatica Roxb.; D—Coix lacryma- jobi; E—Sorghum bicolor ssp. bicolor; F—Sorghum bicolor ssp. arundinaceum (Desv.) de Wet & Harlan; G—Tripsacum dactyloides (L.) L.; H—Zea luxurians (Durieu and Ascherson) R. Bird; and I—Zea mays ssp. mays.

 
The sequence for the maize allele of tb1 had been reported previously (Doebley, Stec, and Hubbard 1997Citation ). tb1-like sequences were isolated from an additional 27 members of the tribes Oryzeae, Andropogoneae, Arundinelleae, and Paniceae (table 1 ). tb1-like genes were first cloned from O. sativa (rice), S. bicolor, Z. diploperennis, and Tripsacum cundinarmarce using lambda libraries. The clones from all four taxa contained a tb1- like open reading frame. PCR primers were designed based on regions of high nucleotide similarity among these aligned sequences, and these primers were used to isolate tb1-like sequences from 23 additional taxa. Amplification reactions yielded a single product of the expected size in all cases. The lengths of tb1-like sequences varied between 1,023 and 1,167 bp, with a mean length of 1,066 bp. Excluding rice and six other sequences (see Materials and Methods), the remaining 21 sequences have a mean identity of 92.8% at the nucleotide level with a range of 84.2%–97.8% identity (table 2 ).


View this table:
[in this window]
[in a new window]
 
Table 2 Mean Identities and dN/dS Ratios for tb1-like Genes

 
Despite the high similarity among tb1-like sequences, the alignment among all panicoid grasses revealed a remarkably variable structure with numerous indels. We identified a total of 91 indels between 3 and 24 nt in length. Most of these were microsatellite-like repeats of a codon such as (GCC)N. Among all sequences, five regions had a high level of variation in the number of microsatellite-like repeats. Residues 49–53 and 116–120 had 2–5 and 1–9 alanine repeats, respectively (fig. 2 ). Residues 211–213 had 1–6 repeats of glycine; residues 304–305 had 1–7 repeats of histidine; and residues 306– 309 had 2–7 repeats of serine. Despite the large number of indels, not one indel altered the frame of the coding sequence.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 2.—Majority-rule consensus of the predicted tb1 amino acid sequences of 27 panicoid grasses. Identical amino acids are in black boxes. Sites which share >90% identity are in gray boxes. Residues that are shared by fewer than 50% of all taxa are underlined, and amino acids that are similar in charge or hydrophobicity are represented in bold. The novel SP domain (see text) and the previously identified TCP and R domains are identified

 
Structure of tb1-like Genes
Sequence alignments identified three domains that are highly conserved and lack indels (fig. 2 ). One of these domains, the TCP domain, is predicted to form a noncanonical basic helix-loop-helix (bHLH) structure and was previously used to define the TCP gene family to which tb1 belongs (Cubas et al. 1999Citation ). Among the panicoid grasses, the basic region of the TCP domain (residues 121–140) which includes a putative nuclear localization signal is more highly conserved than the HLH region (residues 146–179). The second conserved domain, the R domain, also contains several basic arginine and lysine residues that are shared among all panicoids (fig. 2 ). This domain was previously identified in both monocots and dicots (Cubas et al. 1999Citation ). We identified a third conserved domain among the grasses which had significant (E < 0.001) similarity only to tb1 sequences in a BLAST 2.1 search of GenBank. This domain was not identified in other members of the TCP family (Cubas et al. 1999Citation ). This novel domain lies close to the amino terminus of the predicted protein and contains a large number of irregularly spaced proline and serine residues. Like the TCP and R domains, this domain can be readily aligned at the amino acid level between the panicoid grasses and rice (fig. 3 ), indicating its conservation across the grasses. We have termed this novel domain the SP domain because of the high frequency of these two amino acids.



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 3.—Alignment of the tb1 predicted amino acid sequences for maize and rice. The SP, TCP, and R domains are identified. Identical amino acids are shaded, and amino acids of similar charges or hydrophobicities are shown in bold

 
tb1 Phylogeny
We used likelihood and parsimony methods to construct the tb1 gene phylogeny. To reduce inappropriate comparisons among nonhomologous nucleotide positions, regions of the gene that could not be unambiguously aligned were removed. The final data set had a total of 1,122 bp of aligned coding sequence including gaps. Of the 1,122 bp, 430 sites were variable and 211 were phylogenetically informative. Maximum-parsimony analysis resulted in three equally parsimonious trees on a single island of length 723 (consistency index [CI] = 0.76, retention index [RI] = 0.66). Heuristic searches using maximum-likelihood criteria described above generated one tree (ln L = -5,595) for each of 10 independent replicates with random input order of the taxa (fig. 4 ). More complex models with transition/transversion (ts/tv) frequencies estimated from the data (estimated ts/tv = 1.05) and with rate variation estimated among nucleotide sites (estimated gamma shape parameter alpha = 0.67) resulted in the same topology.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4.—Maximum-likelihood phylogeny of tb1-like sequences. Branch lengths >0.005 substitutions per site are indicated above each branch. Bootstrap values are shown below a node if the node is present in more than 50% of the bootstrap replicate analyses. Sorghum bicolorU refers to the Ugandan isolate of S. bicolor. Sorghum bicolorE refers to the Ethiopian isolate

 
Parsimony and maximum-likelihood analyses produced different topologies; however, the areas of disagreement lacked statistical support. For example, in all parsimony trees, sequences from the genus Sorghum were polyphyletic, whereas Sorghum was monophyletic in the maximum-likelihood analysis. However, the maximum-likelihood phylogeny required only three more steps (726 vs. 723) than does the maximum parsimony tree, a difference that was not statistically significant (Templeton test; P = 0.48). Similarly, the most parsimonious phylogenies had a log likelihood of -5,600 which was not significantly different from the maximum-likelihood tree (ln L = -5,595) in a comparison using the Kishino-Hasegawa test (P = 0.76). The parsimony- and maximum-likelihood–generated trees were not significantly different despite different topologies because of weak support for internal nodes. All inferred phylogenies had short, internal branches with low bootstrap support.

Despite the poor resolution of the internal branches, several clades were well supported. The monophyly of the Andropogoneae was supported with 85% bootstrap support. Tripsacum and Zea formed a clade with 100% bootstrap support, as did Chionachne and Coelorachis, S. australiense and Sorghum matarakense, the two S. bicolor sequences, and Bothriochloa and Capillipedium. There was somewhat weaker support for the following groups: (1) a Chionachne/Coelorachis and Zea/Tripsacum clade (71%), (2) an Andropogon/Heteropogon clade (85%), and (3) a Sorghum nitidum/S. bicolor clade (74%).

The relationship of Coix to other Andropogoneae has been a question of some interest among grass systematists (Kellogg and Birchler 1993Citation ; Spangler et al. 1999Citation ). Coix, which is monoecious, has been placed with the other monoecious Andropogoneae (Zea, Tripsacum, and Chionachne) in a separate tribe (Maydeae) distinct from the Andropogoneae (Watson and Dallwitz 1992Citation ). In our phylogeny, Coix was sister to Ischaemum and well separated from the other monoecious taxa. Thus, our tb1-like data did not support a placement of Coix with the other monoecious species in the Maydeae. Indeed, trees in which the monoecious genera (including Coix) were forced to be monophyletic were 25 steps longer and statistically worse (Kishino-Hasegawa—P < 0.0001; Templeton—P < 0.0001) than the most parsimonious tree.

Testing for Positive Selection
Regulatory loci have been hypothesized to evolve quickly and acquire novel functions in their variable domains as a result of positive selection, while their conserved domains maintain basic functions such as DNA binding (Purugganan and Wessler 1994Citation ; Purugganan 1998Citation ). To detect the signature of such positive selection in tb1, a sliding-window analysis of mean pairwise dN/ dS ratios was performed. Different regions of tb1 exhibited greatly different substitution patterns, with the lowest ratios in the SP domain, the 5' region of the TCP domain, and the R domain (fig. 5 ). The overall lowest mean dN/dS value was in the SP domain with an inferred ratio for nucleotides 1–60 of 4.13 x 10-4. In contrast, the highest mean dN/dS ratios were observed in the regions immediately 5' (1.24) and 3' of the TCP domain (0.994).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5.—Sliding-window analysis of the estimated ratio of the nonsynonymous substitution rate (dN) to the synonymous substitution rate (dS) along the tb1 coding sequence. The mean dN/dS ratio for all pairwise sequence comparisons at each window is depicted as a square on the graph. The dN/dS estimate was computed for windows of 60 nt with 3-nt intervals between each pair of windows. Conserved domains are indicated below the graph

 
A dN/dS value that is significantly greater than 1.0 is considered strong evidence for positive selection. Using the method of Nielsen and Yang (1998)Citation to examine the entire tb1 sequence, we tested for evidence of positive selection for nonsynonymous substitutions at some codons while allowing other codons to be invariant or neutral. This analysis placed codons into one of three categories: (1) fully neutral (dN/dS = 1); (2) invariant (dN/dS = 0); or (3) slightly deleterious, those with nonsynonymous substitutions occurring less frequently (per site) than synonymous substitutions (dN/dS = 0.18). This analysis provided no evidence of codons with dN/dS ratios greater than 1.0 and suggested that there was not a subset of codons within tb1 under positive selection. To bias our analysis of positive selection toward quickly evolving regions, we next analyzed only the most variable region (amino acids 83–119) of tb1. For some codons of this region, the nonsynonymous substitution rate per nonsynonymous site exceeded the synonymous substitution rate per synonymous site. Codons in this analysis were classified as either fully neutral (dN/dS = 1), deleterious (dN/dS = 0), or potentially under positive selection, with nonsynonymous substitutions occurring more frequently per nonsynonymous site than synonymous substitutions per synonymous site (dN/dS = 4.18). However, the log likelihood of this positive selection model (ln L = -402.7) did not significantly differ from the log likelihood of the simpler, strictly neutral model in which the dN/dS ratio was constrained to be either 1.0 or 0.0 (ln L = -404.8; P < 0.12).

We wished to test whether dN/dS varied among lineages as expected if selection intensities on tb1 differed in some lineages relative to others. For the 21 species examined in the sliding-window analysis, the mean pairwise dN/dS ratio was 0.39 (table 2 ). However, some species appear to deviate greatly from this mean. Capillipedium parviflorum and Ischaemum afrum had high dN/ dS ratios relative to the overall mean, while Coix lacryma-jobi and Panicum virgatum had lower ratios than other species (table 2 ). The significance of lineage-specific heterogeneity in dN/dS was tested by comparing the likelihood of a model in which dN/dS was held constant among all lineages with that of a model in which this ratio was allowed to vary among lineages (Yang and Nielsen 1998Citation ). The likelihood of these two models differed significantly (P < 0.016) with the model allowing the ratio to vary among lineages (ln L = -3,797) being favored over the model in which the ratio was constrained (ln L = -3,824). Although dN/dS ratios varied across lineages from 0 to 0.989 (with 4 of 35 lineages having no predicted synonymous substitutions), the estimated ratio of dN/dS for each lineage was still less than 1.0. Thus, the data were consistent with variation in the degree of selective constraint, and there is no need to invoke positive selection.

Rate Variation Between Lineages
To identify specific lineages for which either synonymous or nonsynonymous substitution rates were significantly accelerated or decelerated, the program Codrates was used (Muse and Gaut 1994Citation ). Substitution rate heterogeneity for nonsynonymous sites was far more prevalent than that for synonymous sites (fig. 6 ). Nonsynonymous substitution rates on lineages leading to Zea, Capillipedium, and Ischaemum appeared to be strongly accelerated. In contrast, S. bicolor and S. nitidum had slower rates of nonsynonymous substitution relative to other taxa. In this analysis, variation in the synonymous substitution rate was rare, and only Z. mays had significant synonymous substitution rate variation for 2 of 17 comparisons. For all comparisons, Arundinella hirta was used as the outgroup. Using different outgroups to compare rate variation, we found that the overall pattern of rate variation was maintained but that the significance of rate heterogeneity for individual comparisons often changed (data not shown). The fact that synonymous substitution rates did not differ greatly and that nonsynonymous rate variation was common suggests that tb1-like genes may be under different levels of functional constraint in different lineages.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 6.—Results of 306 relative-rate tests for synonymous and nonsynonymous substitutions. The upper triangle shows the results of nonsynonymous substitution rate tests, and the lower triangle shows the results of synonymous substitution rate tests. Entries in the figure refer to those pairwise comparisons in which rate equality was rejected. The name of the sequence which was inferred to have evolved more quickly in each pairwise comparison is given as the first letter of the genus name and the first two letters of the species name. The Ugandan Sorghum bicolor sequence was used. Arundinella hirta was used as the outgroup sequence. One asterisk indicates rejection of rate equality at the 0.05 level; two asterisks indicate rejection at the 0.01 level

 

    Discussion
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 
tb1 in the Grasses
tb1 belongs to the TCP family of putative transcriptional regulators. In both monocots and dicots, the TCP genes form a multigene family that includes two distinct groups: the tb1-cyc–like genes and the pcf-like genes. One concern in evolutionary analysis of genes belonging to such a multigene family is that one cannot be certain of the orthology of sequences. This can be a particular problem when performing PCR with conserved primers that may amplify nonorthologous gene family members. Two lines of evidence suggest that this is not an overriding problem with the tb1-like sequences that we isolated. First, Southern blot analysis of grass genomic DNAs usually revealed only a single strongly hybridizing restriction fragment and no more than three hybridizing fragments (fig. 1 ). Second, the tb1-like gene phylogeny for the Andropogoneae was similar in several respects to phylogenies reported in previous studies of this tribe of grasses (Kellogg and Birchler 1993Citation ; Spangler et al. 1999Citation ). Nevertheless, strict orthology cannot be assured.

Structural Domains of tb1
The TCP gene family was named after its three founding members: tb1, cyc, and pcf (Cubas et al. 1999Citation ). These genes share the TCP domain, which forms a putative basic helix-loop-helix structure. The TCP domain of the rice PCF transcription factor has been demonstrated to function in DNA binding (Kosugi and Ohashi 1997Citation ). The basic region of the domain contains a putative bipartite nuclear localization signal. Additionally, some TCP family members, including tb1 and cyc, share a second domain, termed the R domain, which has no known function but is predicted to form a hydrophilic alpha helix (Cubas et al. 1999Citation ).

We identified within the tb1-like genes among the grasses a third conserved region that we have named the SP domain. This new domain is near the amino terminus of the protein and is 29 amino acids in length. These 29 amino acids include five serine, five proline, and three glutamine residues. Eukaryotic transcription factors often have distinct activation domains that are characterized by multiple serine/threonine, proline, or glutamine residues (Seipel, Georgiev, and Schaffner 1992Citation ; Coustry, Maity, and de Crombrugghe 1995Citation ; Dörfler and Busslinger 1996Citation ). Thus, it is possible that the conserved SP region represents an activation domain. Functional analyses are necessary to test this putative function. For example, the fusion of the SP sequence with a DNA- binding domain such as the GAL4 DNA binding-domain from yeast should induce transcription of a reporter gene (such as ß-galactosidase) flanked by the GAL4 upstream activating sequence.

The conservative nature of the TCP, R, and SP domains is apparent from several lines of evidence. First, comparison of the rice and maize proteins identified these three domains as highly conserved (fig. 3 ). Second, among the Andropogoneae, these same three domains stood out as conserved relative to the rest of the protein (fig. 2 ). Third, the sliding-window analysis showed that these three domains had the lowest dN/dS ratios (fig. 5 ). While each of these three domains is conserved relative to the rest of the protein, the HLH region of the TCP domain is somewhat less conserved than the basic region (figs. 2 and 5 ). The HLH region is likely involved in protein-protein interactions (Cubas et al. 1999Citation ), and heterogeneity within this region may indicate that tb1 has acquired novel binding partners within different lineages. Such a pattern of substitution is similar to that found among homeobox proteins for which domains involved in protein : protein interaction are less conserved than DNA-binding domains (Sharkey, Graba, and Scott 1997Citation ).

Outside of their conserved domains, our tb1 sequences have evolved unusually rapidly. tb1 sequences had a greater number of indels and a higher dN/dS ratio relative to other plant genes (Wolfe, Sharp, and Li 1989Citation ; Purugganan 1998Citation ). The mean dN/dS ratio was 0.39 for all pairwise comparisons of tb1. In contrast, six genes compared between maize and wheat or barley had an average rate ratio of 0.08 (Wolfe, Sharp, and Li 1989Citation ). The dN/dS ratio for tb1 was also higher than that of the duplicated adh1 and adh2 genes. Within the grasses, the maximum dN/dS value of the adh phylogeny was 0.36 for a single branch (Gaut et al. 1999Citation ). An additional level of structural heterogeneity among tb1 sequences is caused by indels which are present even between taxa that have very few nucleotide differences. The Z. mays and S. bicolor sequences, for example, share 93.9% nucleotide identity but differ by 12 indels. It has been suggested that indels are important for creating novel variation within the gamete recognition protein bindin (Metz and Palumbi 1996Citation ).

The tb1-like Gene Phylogeny
The rapid evolution of tb1 gives these sequences utility in testing phylogenetic hypotheses for the closely related taxa within the Andropogoneae. Although the tribe contains cosmopolitan genera such as Heteropogon and Andropogon, as well as crop plants such as maize, sorghum, and sugarcane, the relationships among taxa within the tribe have been difficult to determine. Early taxonomic studies and more recent analyses have suggested that the Andropogoneae underwent a rapid radiation (Celarier 1956Citation ; Spangler et al. 1999Citation ). Our phylogeny for tb1 was consistent with this hypothesis, since most internal branches at the base of the Andropogoneae were short (fig. 4 ).

Several clades within the tb1 phylogeny had reasonable bootstrap support and were consistent with morphological or previous phylogenetic analyses. The monophyly of the Andropogoneae with the Arundinelleae as its sister tribe agreed with several previous studies (Kellogg and Birchler 1993Citation ; Spangler et al. 1999Citation ). Tripsacum appears to be sister to Zea, as recognized over 60 years ago (Mangelsdorf and Reeves 1939Citation ). Coelorachis and Chionachne are sister to the Zea/Tripsacum clade, which seems reasonable given that Coelorachis has been proposed to be an intermediate between the monoecious Andropogoneae and other members of the tribe (Reeves and Mangelsdorf 1935Citation ). The monophyly of the Australian species S. matarakense and S. australiense and the close relationship between Bothriochloa and Capillipedium have also been reported elsewhere (de Wet and Harlan 1969Citation ; Sun et al. 1994Citation ; Spangler et al. 1999Citation ).

Two traditional taxonomic groups were not well supported by our data, and their monophyly has been previously challenged by other authors. First, our data argue strongly against the monophyly of the Maydeae (Chionachne, Coix, Tripsacum, and Zea). This conclusion is consistent with the ribosomal gene phylogeny of Buckler and Holtsford (1996)Citation . Accordingly, we suggest that this tribal designation be dropped from usage and its members recognized simply as belonging to the Andropogoneae, as previously proposed by Clayton (1987)Citation . Second, although Sorghum appears to be monophyletic in our maximum-likelihood tree, our data did not provide statistical support for the monophyly of Sorghum. Thus, our data do not argue against the growing body of evidence suggesting that Sorghum is polyphyletic (Duvall and Doebley 1990Citation ; Sun et al. 1994Citation ; Spangler et al. 1999Citation ).

Molecular sequence data for the chloroplast gene ndhF are the only sequence data that have been published to date from a large number of taxa within the Andropogoneae. Spangler et al.'s (1999)Citation ndhF phylogenies and our tb1 phylogeny both support many of the same relationships (see above). However, several specific areas of difference are noteworthy. In the ndhF phylogeny, the position of Coelorachis was unresolved; while in the tb1 phylogeny, Coelorachis was strongly supported as the sister genus to Chionachne. Second, Elionurus was weakly supported as sister to the Tripsacum/Zea clade in the in the ndhF phylogeny, but Elionurus was not sister to these taxa in the tb1 phylogeny. Finally, Coix was sister to the Cymbopogon/Heteropogon/Andropogon clade in the ndhF phylogeny, but its position was unresolved in the tb1 phylogeny.

No Evidence for Positive Selection
tb1 is a putative transcription factor, and genes of this class have been identified as potential key players in the evolution of new adaptations (Shubin, Tabin, and Carroll 1997Citation ; Doebley and Lukens 1998Citation ). The role of tb1 in the evolution of maize (Wang et al. 1999Citation ) and the role of a cyc-like gene in the evolution of Linaria floral morphology (Cubas, Vincent, and Coen 1999Citation ) adds support to this general thesis and specifically identifies TCP genes as potential players in evolution and thus targets of positive Darwinian selection. In this regard, changes in tb1 gene function over time may occur in several ways, two of which we consider here. First, evolution of tb1 could involve changes in gene regulation, giving rise to new levels or spatial/temporal patterns of expression. Second, tb1 evolution could involve changes in protein function such that the TB1 protein would interact with new protein partners or recognize new target sequences. We sought to test the latter of these possibilities by searching for evidence of past positive selection on the tb1 protein among the andropogonoid grasses.

First, we looked for the signature of positive selection among different codons of tb1 using the method of Nielsen and Yang (1998)Citation . For tb1 overall, dN/dS was 0.39, which is far below the value of 1.0 expected for an unconstrained protein and even further below values such as 3.0 or greater seen in cases of clear positive selection (e.g., Hughes, Ota, and Nei 1990Citation ; Swanson and Vacquier 1995Citation ; Bishop, Dean, and Mitchell-Olds 2000Citation ). We further tested whether different codons within the gene had variable dN/dS rate ratios. This analysis indicated that the pattern of evolution within the gene was consistent with a nearly neutral model (Ohta 1992Citation ), with no evidence for positive selection. Finally, to bias our analysis in favor of finding evidence for positive selection, the Nielsen and Yang method was applied to the most variable region of the gene (5' of the TCP domain). Here again, we could not reject the null hypothesis that codons within tb1 were evolving in a neutral fashion among the Andropogoneae.

We performed a second set of analyses to test for lineage-specific positive selection using the method of Yang and Nielsen (1998)Citation . This involved comparing one model under which dN/dS was allowed to vary among lineages with a second model under which dN/dS was uniform across the phylogeny. In this analysis, there was evidence for variation in dN/dS among lineages, violating the expectations of the strictly neutral theory, but the largest value for any lineage was 0.99, which is within the range of values expected for proteins evolving in a nearly neutral fashion.

Both our lineage and our codon tests for positive selection failed to detect any deviation from nearly neutral expectations. We consider two possible interpretations of these results. First, positive selection has indeed occurred, but our test simply lacked sufficient power to detect it. This interpretation cannot be excluded. Second, the TB1 protein has not experienced significant positive selection during the history of these grasses. If the latter is the case, this need not imply that the gene has not been affected by positive selection. Selection could act on 5' regulatory sequences or other features that change the pattern/level of tb1 expression. Indeed, in both of the two cases in which tb1-like genes have been implicated in the evolution of new morphologies, changes in gene expression were implicated (Cubas, Vincent, and Coen 1999Citation ; Wang et al. 1999Citation ).

Rate Heterogeneity Among Lineages
We wished to test whether tb1 had evolved in a clocklike fashion along different lineages within the Andropogoneae, as expected under strict neutrality. Among the 153 tests of synonymous rate variation, only two were significant at the 5% level. One would expect more than seven significant tests by chance alone; thus, these results indicate that the synonymous rate does not vary among these grasses. Among the 153 tests for nonsynonymous rate variation, 30 were significant at either the 1% or the 5% level, indicating that there is extensive variation in the nonsynonymous rate. Examination of these tests shows that three lineages including C. parviflorum, I. afrum, and Z. mays have accelerated rates, while S. bicolor and S. nitidum have slower nonsynonymous substitution rates. It is of interest that substitution rate heterogeneity was detected for both synonymous and nonsynonymous sites in Z. mays. This result concurs with an earlier analysis of Adh1, for which Zea has an accelerated substitution rate relative to other grasses (Gaut and Clegg 1993Citation ).

What is the cause of the extensive variation in nonsynonymous rates among lineages? The tests of positive selection discussed above were all negative, and thus there is no evidence that this rate variation resulted from past episodes of positive selection. Excluding positive selection, there are at least two other possible explanations. First, there may have been a relaxation of constraint along some lineages, especially outside of the three conserved domains. Second, in small populations, nonsynonymous substitution rates may be accelerated due to the fixation of slightly deleterious alleles under random genetic drift (Ohta 1992, 1993Citation ). Unfortunately, the history of these grasses is too poorly known to make credible estimates of whether some have had historically smaller population sizes than others. One could test the hypothesis that population size has influenced the nucleotide substitution rate along these lineages, since such population size variation should alter the rates for all genes within a lineage in a similar way (Muse and Gaut 1997Citation ).


    Acknowledgements
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 
We thank Dr. Russ Spangler for kindly providing the ndhF data for analysis, Dr. Elizabeth Kellogg and members of the Doebley lab for providing genomic DNA samples, and Drs. Brandon Gaut, Elizabeth Kellogg, Georgiana May, and Michael Purugganan and two anonymous reviewers for comments on the manuscript. This work was supported by an NSF doctoral dissertation fellowship and EPA STAR fellowship to L.L. and an NSF grant to J.D.


    Footnotes
 
Elizabeth Kellogg, Reviewing Editor

1 Department of Agronomy, University of Wisconsin–Madison Back

2 Department of Genetics, University of Wisconsin–Madison Back

1 Keywords: Zea mays, maize Andropogoneae transcription factor teosinte branched, selection Back

2 Address for correspondence and reprints: John Doebley, Department of Genetics, University of Wisconsin, Madison, Wisconsin 53706. jdoebley{at}facstaff.wisc.edu Back


    literature cited
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 

    Bishop, J. G., A. M. Dean, and T. Mitchell-Olds. 2000. Rapid evolution in plant chitinases: molecular targets of selection in plant-pathogen coevolution. Proc. Natl. Acad. Sci. USA 97:5322–5327

    Buckler, E. S., and T. P. Holtsford. 1996. Zea systematics: ribosomal ITS evidence. Mol. Biol. Evol. 13:612–622[Abstract]

    Carroll, S. B. 1994. Developmental regulatory mechanisms in the evolution of insect diversity. Dev. Suppl. 21:7–223

    Celarier, R. 1956. Cytotaxonomy of the Andropogoneae. I. subtribes Dimeriinae and Saccharinae. Cytologia 21:272– 291

    Clayton, W. D. 1987. Andropogoneae. Pp. 307–309 in T. Soderstrom, K. Hilu, C. Campbell, and M. Barkworth, eds. Grass systematics and evolution. Smithsonian Institution Press, Washington, D.C

    Coustry, F., S. Maity, and B. de Crombrugghe. 1995. Studies on transcription activation by the multimeric CCAT- binding factor CBF*. J. Biol. Chem. 270:468–475[Abstract/Free Full Text]

    Cubas, P., N. Lauter, J. Doebley, and E. Coen. 1999. The TCP domain: a motif found in proteins regulating plant growth and development. Plant J. 18:215–222[Web of Science][Medline]

    Cubas, P., C. Vincent, and E. Coen. 1999. An epigenetic mutation responsible for natural variation in floral symmetry. Nature 401:157–161

    de Wet, J. M. J., and J. R. Harlan. 1969. Apomixis, polyploidy, and speciation in Dicanthium. Evolution 24:270– 277

    Doebley, J., and L. Lukens. 1998. Transcriptional regulators and the evolution of plant form. Plant Cell 10:1075–1082

    Doebley, J., and A. Stec. 1993. Inheritance of the morphological differences between maize and teosinte: comparison of the results of two F2 populations. Genetics 134:559–570

    Doebley, J., A. Stec, and C. Gustus. 1995. teosinte branched1 and the origin of maize: evidence for epistasis and the evolution of dominance. Genetics 141:333–346

    Doebley, J., A. Stec, and L. Hubbard. 1997. The evolution of apical dominance in maize. Nature 386:485–488

    Dörfler, P., and M. Busslinger. 1996. C-terminal activating and inhibitory domains determine the transactivation potential of BSAP (Pax-5), Pax-2, and Pax-8. EMBO J. 15:1971– 1982[Web of Science][Medline]

    Duvall, M., and J. Doebley. 1990. Restriction site variation in the chloroplast genome of Sorghum (Poaceae). Syst. Bot. 15:472–480

    Gaut, B. S., and M. T. Clegg. 1993. Nucleotide polymorphism in the Adh1 locus of pearl millet (Pennisetum glaucum) (Poaceae). Genetics 135:1091–1097

    Gaut, B. S., A. S. Peek, B. Morton, and M. Clegg. 1999. Patterns of genetic diversification within the Adh gene family in the grasses (Poaceae). Mol. Biol. Evol. 16:1086–1097[Abstract]

    Goodrich, J., R. Carpenter, and E. Coen. 1992. A common gene regulates pigmentation pattern in diverse plant species. Cell 68:955–964

    Hughes, A., T. Ota, and M. Nei. 1990. Positive Darwinian selection promotes charge profile diversity in the antigen- binding cleft of class I major histocompatibility complex molecules. Mol. Biol. Evol. 7:515–524[Abstract]

    Ina, Y., M. Mizokami, K. Ohba, and T. Gojobori. 1994. Reduction of synonymous substitutions in the core protein gene of hepatitis C virus. J. Mol. Evol. 38:50–56[Web of Science][Medline]

    Kellogg, E., and J. Birchler. 1993. Linking phylogeny and genetics: Zea mays as a tool for phylogenetic studies. Syst. Biol. 42:415–439

    Kimura, M. 1983. The neutral theory of molecular evolution. Cambridge University Press, Cambridge, England

    Kishino, H., and M. Hasegawa. 1989. Evaluation of the maximum likelihood estimate of evolutionary tree topologies from DNA sequence data, and the branching order in Hominoidea. J. Mol. Evol. 29:170–179[Web of Science][Medline]

    Kosugi, S., and Y. Ohashi. 1997. PCF1 and PCF2 specifically bind to cis elements in the rice proliferating cell nuclear antigen gene. Plant Cell 9:1607–1619

    Kumar, S., K. Tamura, and M. Nei. 1993. MEGA: molecular evolutionary genetics analysis. Version 1.0. Pennsylvania State University, University Park

    Lukens, L., and J. Doebley. 1999. Epistatic and environmental interactions for quantitative trait loci involved in maize evolution. Genet. Res. 74:291–302

    Luo, D., R. Carpenter, C. Vincent, L. Copsey, and E. Coen. 1996. Origin of floral asymmetry in Antirrhinum. Nature 383:794–799

    Mangelsdorf, P. C., and R. G. Reeves. 1939. The origin of maize. Proc. Natl. Acad. Sci. USA 24:303–312

    Mason-Gamer, R., C. Weil, and E. A. Kellogg. 1998. Granule bound starch synthase: structure, function, and phylogenetic utility. Mol. Biol. Evol. 15:1658–1673[Abstract]

    Metz, E., and S. Palumbi. 1996. Positive selection and sequence rearrangements generate extensive polymorphism in the gamete recognition protein bindin. Mol. Biol. Evol. 13: 397–406

    Muse, S., and B. Gaut. 1994. A likelihood approach for comparing synonymous and nonsynonymous nucleotide substitution rates, with application to the chloroplast genome. Mol. Biol. Evol. 11:715–724[Abstract]

    ———. 1997. Comparing patterns of nucleotide substitution rates among chloroplast loci using the relative ratio test. Genetics 146:393–399

    Nei, M., and T. Gojobori. 1986. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 3:418–426[Abstract]

    Nielsen, R., and Z. Yang. 1998. Likelihood models for detecting positively selected amino acid sites and applications to the HIV-1 envelope gene. Genetics 148:929–936

    Ohta, T. 1992. The nearly neutral theory of molecular evolution. Annu. Rev. Ecol. Syst. 23:263–286[Web of Science]

    ———. 1993. Amino acid substitution at the Adh locus of Drosophila is facilitated by small population size. Proc. Natl. Acad. Sci. USA 90:4548–4551

    Purugganan, M. 1998. The molecular evolution of development. BioEssays 20:700–711

    Purugganan, M., and J. Suddith. 1998. Molecular population genetics of the Arabidopsis cauliflower regulatory gene: nonneutral evolution and naturally occurring variation in floral homeotic function. Proc. Natl. Acad. Sci. USA 95: 8130–8134

    Purugganan, M., and S. Wessler. 1994. Molecular evolution of the plant R regulatory gene family. Genetics 138:849– 854

    Reeves, R. G., and P. C. Mangelsdorf. 1935. Chromosome numbers in relatives of Zea mays L. Am. Nat. 69:633–635

    Rimbaut, A. 1996. Se-AL v1.d1: Sequence alignment program. Oxford University, Oxford, England

    Sambrook, J., E. M. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York

    Seipel, K., O. Georgiev, and W. Schaffner. 1992. Different activation domains stimulate transcription from remote (‘enhancer’) and proximal (‘promoter’) positions. EMBO J. 11:4961–4968[Web of Science][Medline]

    Sharkey, M., Y. Graba, and M. Scott. 1997. Hox genes in evolution: protein surfaces and paralog groups. Trends Genet. 14:125–165

    Shubin, N., C. Tabin, and S. Carroll. 1997. Fossils, genes and the evolution of animal limbs. Nature 388:639–648

    Spangler, R., B. Zaitchik, E. Russo, and E. Kellogg. 1999. Andropogoneae evolution and generic limits in Sorghum (Poaceae) using ndhF sequences. Syst. Bot. 24:267–281

    Stern, D. 1998. A role of ultrabithorax in morphological differences between Drosophila species. Nature 396:463–466

    Sun, Y., D. Z. Skinner, G. H. Lang, and S. H. Hulbert. 1994. Phylogenetic analysis of Sorghum and related taxa using transcribed spacers of nuclear ribosomal DNA. Theor. Appl. Genet. 89:26–32

    Sutton, K., and M. Wilkinson. 1997. Rapid evolution of a homeodomain: evidence for positive selection. J. Mol. Evol. 45:579–588[Web of Science][Medline]

    Swanson, W. J., and V. Vacquier. 1995. Extraordinary divergence and positive Darwinian selection in a fusagenic protein coating the acrosomal process of abalone spermatozoa. Proc. Natl. Acad. Sci. USA 92:4957–4961

    Swofford, D. L. 1999. PAUP*: phylogenetic analysis using parsimony. Beta test version 4.0 b2.0. Sinauer, Sunderland, Mass

    Templeton, A. R. 1983. Phylogenetic inference from restriction endonuclease cleavage sites with particular reference to the evolution of humans and the apes. Evolution 37:221– 244

    Wang, R. L., A. Stec, J. Hey, L. Lukens, and J. Doebley. 1999. The limits of selection during maize domestication. Nature 398:236–239

    Watson, L., and M. Dallwitz. 1992. Grass genera of the world. C.A.B. International, Wallingford, England

    Wolfe, K., P. Sharp, and W. Li. 1989. Rates of synonymous substitutions in plant nuclear genes. Mol. Biol. Evol. 29: 208–211

    Yang, Z. 1998. Phylogenetic analysis by maximum likelihood (PAML). Version 1.4. University of California, Berkeley

    Yang, Z., and R. Nielsen. 1998. Synonymous and nonsynonymous rate variation in nuclear genes of mammals. J. Mol. Evol. 46:409–418[Web of Science][Medline]

Accepted for publication December 20, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Biol EvolHome page
M. A. Chapman, J. H. Leebens-Mack, and J. M. Burke
Positive Selection and Expression Divergence Following Gene Duplication in the Sunflower CYCLOIDEA Gene Family
Mol. Biol. Evol., July 1, 2008; 25(7): 1260 - 1273.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
M. A. Streisfeld and M. D. Rausher
Relaxed Constraint and Evolutionary Rate Variation between Basic Helix-Loop-Helix Floral Anthocyanin Regulators in Ipomoea
Mol. Biol. Evol., December 1, 2007; 24(12): 2816 - 2826.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
S. A. Finlayson
Arabidopsis TEOSINTE BRANCHED1-LIKE 1 Regulates Axillary Bud Outgrowth and is Homologous to Monocot TEOSINTE BRANCHED1
Plant Cell Physiol., May 1, 2007; 48(5): 667 - 677.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. G. Howarth and M. J. Donoghue
Phylogenetic analysis of the "ECE" (CYC/TB1) clade reveals duplications predating the core eudicots
PNAS, June 13, 2006; 103(24): 9101 - 9106.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
T. H. Kebrom, B. L. Burson, and S. A. Finlayson
Phytochrome B Represses Teosinte Branched1 Expression and Induces Sorghum Axillary Bud Outgrowth in Response to Light Signals
Plant Physiology, March 1, 2006; 140(3): 1109 - 1117.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
K. Bomblies and J. F. Doebley
Molecular Evolution of FLORICAULA/LEAFY Orthologs in the Andropogoneae (Poaceae)
Mol. Biol. Evol., April 1, 2005; 22(4): 1082 - 1094.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
E. A. Kellogg and J. L. Bennetzen
The evolution of nuclear genome structure in seed plants
Am. J. Botany, October 1, 2004; 91(10): 1709 - 1725.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. Saitoh, K. Onishi, I. Mikami, K. Thidar, and Y. Sano
Allelic Diversification at the C (OsC1) Locus of Wild and Cultivated Rice: Nucleotide Changes Associated With Phenotypes
Genetics, October 1, 2004; 168(2): 997 - 1007.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
L. Jia, M. T. Clegg, and T. Jiang
Evolutionary Dynamics of the DNA-Binding Domains in Putative R2R3-MYB Genes Identified from Rice Subspecies indica and japonica Genomes
Plant Physiology, February 1, 2004; 134(2): 575 - 585.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
R. H. Ree, H. L. Citerne, M. Lavin, and Q. C. B. Cronk
Heterogeneous Selection on LEGCYC Paralogs in Relation to Flower Morphology and the Phylogeny of Lupinus (Leguminosae)
Mol. Biol. Evol., February 1, 2004; 21(2): 321 - 331.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
T. Gubitz, A. Caldwell, and A. Hudson
Rapid Molecular Evolution of CYCLOIDEA-like Genes in Antirrhinum and Its Relatives
Mol. Biol. Evol., September 1, 2003; 20(9): 1537 - 1544.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
V. Haake, D. Cook, J. L. Riechmann, O. Pineda, M. F. Thomashow, and J. Z. Zhang
Transcription Factor CBF4 Is a Regulator of Drought Adaptation in Arabidopsis
Plant Physiology, October 1, 2002; 130(2): 639 - 648.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
D. L. Remington and M. D. Purugganan
GAI Homologues in the Hawaiian Silversword Alliance (Asteraceae-Madiinae): Molecular Evolution of Growth Regulators in a Rapidly Diversifying Plant Lineage
Mol. Biol. Evol., September 1, 2002; 19(9): 1563 - 1574.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
T. Dagan, Y. Talmor, and D. Graur
Ratios of Radical to Conservative Amino Acid Replacement are Affected by Mutational and Compositional Factors and May Not Be Indicative of Positive Darwinian Selection
Mol. Biol. Evol., July 1, 2002; 19(7): 1022 - 1025.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
H. C. Karakaya, Y. Tang, P. B. Cregan, and H. T. Knap
Molecular mapping of the fasciation mutation in soybean, Glycine max (Leguminosae)
Am. J. Botany, April 1, 2002; 89(4): 559 - 565.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (39)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lukens, L.
Right arrow Articles by Doebley, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lukens, L.
Right arrow Articles by Doebley, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?