Molecular Biology and Evolution 18:542-550 (2001)
© 2001 Society for Molecular Biology and Evolution
ARTICLE |
Two Cyp19 (P450 Aromatase) Genes on Duplicated Zebrafish Chromosomes Are Expressed in Ovary or Brain
*Institute of Molecular Biology, Academia Sinica, Nankang, Taipei, Taiwan, Republic of China;
Institut National de la Recherche Agronomique, Station SCRIBE, Campus de Beaulieu, Rennes, France;
Institute of Neuroscience, University of Oregon
| Abstract |
|---|
|
|
|---|
Cytochrome P450 aromatase (Cyp19) is an enzyme catalyzing the synthesis of estrogens, thereby controlling various physiological functions of estrogens. We isolated two cyp19 cDNAs, termed cyp19a and cyp19b, respectively, from zebrafish. These genes are located in linkage groups 18 and 25, respectively. Detailed gene mapping indicated that zebrafish linkage groups 18 and 25 may have arisen from the same ancestral chromosome by a chromosome duplication event. Cyp19a is expressed mainly in the follicular cells lining the vitellogenic oocytes in the ovary during vitellogenesis. Cyp19b is expressed abundantly in the brain, at the hypothalamus and ventral telencephalon, extending to the olfactory bulbs. The expression of duplicated cyp19 genes at two different tissues highlights the evolutionary significance of maintaining two active genes on duplicated zebrafish chromosomes for specific functions in the ovary and the brain.
| Introduction |
|---|
|
|
|---|
Cytochrome P450 aromatase (P450aro, CYP19) is a member of the cytochrome P450 superfamily. The CYP19 gene encodes an enzyme controlling the synthesis of estrogens and has been identified in many different animal phyla. In vertebrates, CYP19 expression occurs in the gonads and the brain (Simpson et al. 1994
The human CYP19 gene contains 10 exons (Means et al. 1989
). Human CYP19 transcripts from different tissues have different first exons due to tissue-specific utilization of promoters located upstream of the first exon (Mendelson, Evans, and Simpson 1987
; Simpson et al. 1993
). Despite differences in the 5' untranslated regions of the CYP19 transcript, CYP19 proteins from different tissues have the same sequence, because the first exon is noncoding.
Mice and humans have a single active Cyp19 gene, located on murine chromosome 9 and human chromosome 15, respectively (Chen et al. 1988
; Youngblood, Nesbitt, and Payne 1989
). Pigs have three active Cyp19 genes, clustered on chromosome 1q1617, a region homologous to human chromosome 15 (Choi et al. 1997
). Cattle have one active and one transcribed-but-nonfunctional Cyp19 gene arranged in tandem on bovine chromosome 10q26 (Brunner et al. 1998
). The presence of mammalian Cyp19 genes on homologous chromosomes but in different copy numbers indicates that these Cyp19 gene duplication and selective inactivation events occurred after mammalian speciation.
The functions of P450 aromatase from nonmammalian vertebrates have received wide attention. In fish, cyp19 is expressed in vitellogenic follicles during oogenesis, consistent with the function of estrogen in fish ovarian development (Tanaka et al. 1995
; Fukada et al. 1996
; Chang et al. 1997
). Goldfish have at least two forms of cyp19, one expressed in ovaries and the other found in the brain (Tchoudakova and Callard 1998
).
In the brain, aromatization of androgens into estrogens is an essential step in regulating a variety of physiological and behavioral processes. In vitro assays have demonstrated the presence of aromatase activity in many regions of the brain from rats (Roselli 1985
), birds, and fish (Gelinas and Callard 1997
).
The zebrafish (Danio rerio) has become increasingly popular as a system with which to investigate vertebrate genetics and development because of the many advantages it confers, such as its small size, rapid development, and short ovarian cycles. We report here the isolation of two zebrafish cyp19 cDNAs, termed cyp19a and cyp19b. The cyp19a gene is located in linkage group 18 and expressed predominantly in the ovary. The cyp19b gene is located in linkage group 25 and expressed strictly in the brain. The presence of two cyp19 genes in zebrafish may have functional and evolutionary significance.
| Materials and Methods |
|---|
|
|
|---|
Plasmid Construction
The procedure for cloning zebrafish cyp19a and cyp19b cDNAs was described elsewhere (Chiang et al. 2001
RT-PCR
Zebrafish (D. rerio) were maintained at 28.5°C as described (Westerfield 1995
). Total RNA was isolated from zebrafish tissues and RT-PCR was performed according to established procedures at 30 cycles of 94°C for 40 s, 55°C for 1 min, and 72°C for 1 min (Hwang et al. 1997
; Lee et al. 1998
). The cyp19a primers (5'-ATGGTGAGGAAACTCTCATC-3' and 5'-ACTTTCTTCTGCCAGGTGTC-3') and the cyp19b primers (5'-AGAGCAATAATTACACAGGG-3' and 5'-CTGTTGCGAAGTCCATTTCA-3') amplified cDNA fragments between nucleotides 336 and 731 and between nucleotides 392 and 907, respectively. The actin primers (Hwang et al. 1997
) amplified a 340-bp fragment as a control for RNA amounts in each tissue sample. PCR products were analyzed on 1.2% agarose gels, followed by hybridization with cyp19a or cyp19b probes to confirm their identities.
Phylogenetic Analysis
DNA sequence alignment and homology analysis were performed using the GCG sequence analysis program (GCG, Madison, Wis.). Phylogenetic relationships of aromatase genes were derived by aligning sequences by CLUSTAL X (http://www-igbmc.u-strasbg.fr/BioInfo/ClustalX/Top.html). Zebrafish aromatase amino acid sequences were compared against GenBank sequences using blastp, and then the matching sequences were imported into CLUSTAL X. Sequences were trimmed until they were unambiguously alignable, and trees were generated by the neighbor-joining method using NJplot (http://pbil.univ-lyon1.fr/software/njplot.html) (Saitou and Nei 1987
; Perriere and Gouy 1996
). A P450 gene from Drosophila melanogaster served as an outgroup to root the tree. As a measure of the statistical validity of each node in the phylogenetic analysis, we utilized the bootstrapping method (Efron and Gong 1983
; Felsenstein 1985
; Swofford et al. 1996
). Bootstrapping involves resampling the sequence data with replacement to create a series of samples with the same size as the original data and constructing new phylogenetic trees. The alignment is available on request.
Gene Mapping
For single-strand conformation polymorphism (SSCP) analysis, genomic DNA from C32 and SJD parental strains was amplified using primers specific to the sequence of the 3' untranslated region of the cyp19a and cyp19b genes. Primers for cyp19a (GCGTGCAGCTTATCCTCAGA and CAATAAAAAAGGTTACAGAAATTAAGTCAC) amplified a 228-bp fragment (nucleotides 15301757). Primers for cyp19b (ATTATTCGCCCTCCTGTCATTTT and AGCCACCTGTATACTTTCCCTCAA) amplified a 474-bp fragment (nucleotides 17432216). The SSCPs were genotyped on DNA from 96 F2 progeny from the cross that had previously been genotyped for over 800 PCR-based markers (Goff et al. 1992
; Postlethwait et al. 1994, 1998
; Johnson et al. 1996
; Knapik et al. 1996, 1998
). Additional loci were previously mapped (Gates et al. 1999
; Geisler et al. 1999
; Hukriede et al. 1999
) (http://zfish.wustl.edu/, http://www.map.tuebingen.mpg.de/,http://mgchd1.nichd.nih.gov:8000/zfrh/current.html). The strain distribution patterns were analyzed using MapManager (http://mcbio.med.buffalo.edu/mapmgr.html), and maps were constructed with MapMaker (Lander et al. 1987
).
Conserved Syntenies
The sequences of zebrafish loci, including SSLPs (Knapik et al. 1996, 1998
) (http://zebrafish.mgh.harvard.edu/mapping/ssr_map_index.html), expressed sequence tags available in GenBank, and cloned genes were compared with the sequences of human and mouse genes in GenBank using the blastx algorithm (http://www.ncbi.nlm.nih.gov/blast/blast.cgi). The map locations of human and mouse genes with very high similarities were found in On Line Mendelian Inheritance in Man (http://www.ncbi.nlm.nih.gov/Omim/searchomim.html), GeneMap'99 (http://www.ncbi.nlm.nih.gov/genemap/), LocusLink (http://www.ncbi.nlm.nih.gov/genome/guide/), and Mouse Genome databases (http://www.informatics.jax.org/searches/marker_form.shtml). Human/mouse comparative mapping was accomplished at http://www.ncbi.nlm.nih.gov/Homology/.
In Situ Hybridization
In situ hybridization was performed according to previously described protocols with some modifications (Westerfield 1995
). Tissues were removed from zebrafish under a dissecting microscope and fixed in 4% paraformaldehyde at 4°C overnight. Following successive proteinase K and acetic anhydride treatment, hybridization was carried out with digoxigenin-labeled antisense or sense RNA probes (100 ng/200 µl solution) at 65°C overnight. Tissues were then washed and residual probes removed by RNase A digestion. The hybridization signal was detected after incubation with anti-digoxigenin- alkaline phosphatase Fab fragments (Boehringer Mannheim), followed by color reaction as previously described (Hu et al. 1999
). For more precise signal localization, some hybridized samples were embedded in CRYOMATRIX (Shandon, Pittsburgh, Pa.), followed by cryosection. Cryosections were mounted on slides and observed under a microscope.
| Results |
|---|
|
|
|---|
Characterization of Zebrafish Cyp19a and Cyp19b
We isolated from a zebrafish cDNA library two different forms of cyp19 cDNAs, termed cyp19a and cyp19b, encoding proteins of 517 and 511 amino acids, respectively. Two other zebrafish cyp19a and cyp19b sequences had previously been deposited in GenBank. One sequence (accession number AF004521) differs from our cyp19a sequence (accession number AF183906) by 15 bases, presumably due to sequencing or PCR errors. These differences led to conservative changes of four amino acids and a premature termination resulting in the loss of eight amino acids at the C- terminus of cyp19a in the sequence of accession AF004521. The other sequence in GenBank (accession number AF120031) is a partial sequence. It differs from our cyp19b (accession number AF183908) in the overlapped region by three bases, resulting in a change of one amino acid.
There is an overall 60% sequence identity between zebrafish Cyp19a and Cyp19b, indicating that they are only distantly related. Sequence alignment shows clustered sequence identities along the entire length of the proteins, showing that they belong to the same protein family (fig. 1
). Cyp19's from all species contain five conserved regions, namely, the amino-terminal transmembrane domain (I), the substrate-binding loop (II), the distal
-helix (III), the steroid-binding domain (IV), and the heme-binding region (V) (Chen and Zhou 1992
). The distal helix I (region II) and the proximal heme- binding helix L (region V) are the two most conserved regions. These two helices together form the heme-binding pocket allowing electron transport to take place (Chen and Zhou 1992
).
|
To understand the tissue distribution of cyp19 gene expression, RNA was extracted from various adult zebrafish tissues for RT-PCR analysis using either cyp19a- or cyp19b-specific primers, followed by hybridization with gene-specific probes (fig. 2 ). The cyp19a gene was expressed abundantly in the ovary and moderately in the testis, intestine, and brain. We found that cyp19b was expressed only in the brain. To check that the primers were indeed gene-specific, we used cyp19a and cyp19b plasmids in control experiments. The amplification of actin transcripts in these experiments indicated that the quality of RNA preparation from each tissue was similar. While cyp19a distribution in the ovary and brain is similar to the distribution observed for mammalian CYP19, the presence of a strong cyp19b expression in the brain is unique for zebrafish and goldfish (Tchoudakova and Callard 1998
|
Gene Phylogenies
To study the evolution of Cyp19 genes, we conducted a phylogenetic analysis (fig. 3 ). A P450 gene from D. melanogaster served as an outgroup to root the tree. The results showed that the vertebrate Cyp19 gene branched as expected from the known evolutionary relationships of the species. All fish Cyp19 genes clustered together on the same branch, suggesting that they were all orthologs of the single mammalian Cyp19 gene. The fish branch, however, bifurcated into two subbranches with a high bootstrap value (944/1,000). One of these branches contained the brain form of Cyp19, while the other branch contained ovarian Cyp19.
|
This phylogenetic tree provides evidence that there was a Cyp19 gene duplication in the teleost lineage after its divergence from the tetrapod lineage. In zebrafish and tilapia, there are two forms of Cyp19. The ovarian forms are more closely related to each other than they are to the brain form of the same species. This suggests that there was a gene duplication event before the divergence of the Ostariophysi (including Cypriniform fish, such as zebrafish) and the Acanthopterygii (including the Perciform fish, such as tilapia) (Nelson 1994
Comparative Mapping
Scoring polymorphisms in our MOP haploid mapping panel, we mapped zebrafish cyp19a and cyp19b to the proximal portion of the lower arm of LG18 and the upper arm of LG25, respectively (fig. 4
). The human aromatase gene CYP19 is located on chromosome 15 (cytogenetic location 15q21.1 and physical location 15_165.55 cR). After integrating these data with existing gene maps (Johnson et al. 1996
; Postlethwait et al. 1998
; Gates et al. 1999
; Geisler et al. 1999
; Hukriede et al. 1999
) (http://zfish.wustl.edu/), we found that on LG18, marker Z10264 is highly similar (10-10, blastx) to human fibrillin1 (FBN1), located at 15q21.1 along with CYP19. On the radiation hybrid map, marker Z10264 is similarly physically very close to CYP19 (15_167.92cR vs. 15_165.55cR). Zebrafish cyp19a is also syntenic with expressed sequence tag (EST) fa08a06, which is highly similar to human glycine amidinotransferase (GATM). All three loci are tightly linked in Hsa15q21.1.
|
Likewise, on LG25, cyp19b is syntenic with ESTs fb37h03 and fb61a08, which show very high similarity to ubiquitous mitochondrial creatine kinase (CKMT1) and very long-chain fatty-acid-Coenzyme A ligase-1 (FACVL1), respectively, on human chromosome Hsa15. Similarly, on LG25, mariposa (Moens et al. 1996
|
Expression of cyp19a in the Ovary and cyp19b in the Brain
To examine cyp19a and cyp19b expression in more detail, we performed whole-mount in situ hybridization with various zebrafish tissues. Neither cyp19a nor cyp19b transcripts were detected by in situ hybridization in the testis, heart, or liver (data not shown). The cyp19a signal was detected mainly in the vitellogenic follicles of the adult ovary (fig. 6A ). It was not present in the previtellogenic follicles (fig. 6A ). This finding shows that the cyp19a expression level varies during follicular development, in agreement with previous studies of cyp19 expression in rainbow trout, tilapia, and medaka (Tanaka et al. 1992
|
To determine the regional and cellular expression of cyp19a, the ovary was further sectioned for histological study. Cells at the outer edges of vitellogenic follicles surrounding the zona pellucida expressed cyp19a (fig. 6B and C ), suggesting that these follicular cells were theca/granulosa layers. There was no signal in the ovarian tissues when the sense riboprobe was used (data not shown), indicating that the hybridization signal detected was specific for the cyp19a transcript.
RT-PCR analysis showed cyp19b expression only in zebrafish brain (fig. 2 ). In situ hybridization revealed that the distribution of cyp19b transcript was mainly in the hypothalamus and ventral telencephalon, extending to the olfactory bulb (fig. 7B ). No signal was detected in the brain hybridized with a sense cyp19b probe (fig. 7A ).
|
From RT-PCR analysis, cyp19a expression was also detected in zebrafish brain, although less abundantly than the cyp19b transcript. Hybridization of the brain with antisense cyp19a riboprobe confirmed a lower expression of the gene, which, like that of cyp19b, is mainly concentrated in the hypothalamic area (data not shown). These results show that the cyp19b transcript is the major aromatase transcript in zebrafish brain.
| Discussion |
|---|
|
|
|---|
In this report, we describe the characterization of two zebrafish cyp19 genes. These two genes are located on different chromosomes and encode proteins of about 60% sequence identity. Our phylogenetic analysis indicated that these two genes are orthologous to each other, arising through an ancient gene duplication event. Was that event a tandem gene duplication involving only cyp19, or did it involve duplication of a large chromosome region or an entire chromosome? This question is important, because if a large chromosome region was involved, all of the regulatory regions would be present in duplicate just after the event, whereas if there were a tandem duplication, the regulatory sequences may or may not have been duplicated. If the two cyp19 genes map very near each other, then this would provide support for a tandem duplication, but if the two genes map on different chromosomes with evidence of chromosome duplication, then the tandem duplication hypothesis would be less likely.
A chromosome duplication event may have occurred in all ray-finned fish, accounting for the presence of duplicated genes in zebrafish. One example is the arrangement of the HOX-clusters, which are present as duplicated copies for each of the four HOX-bearing chromosomes in mammals (Amores et al. 1998
; Postlethwait et al. 1998
). It is, however, also possible that there was a tandem duplication of the original cyp19 gene and that a translocation event broke the duplication-bearing chromosome in two between the two cyp19 duplicates. We favor the chromosome duplication hypothesis over the translocation hypothesis because other parts of LG18 and LG25 also contain genes orthologous to syntenic regions of genes on human chromosomes 11, 19, 22, and a small part of 7 (our unpublished data). LG18 and LG25 appear to be duplicated chromosome copies.
The zebrafish cyp19a gene is expressed mainly in the follicular cells during vitellogenesis (fig. 6
). It is absent in the previtellogenic follicles. This observation is consistent with the increase in P450 aromatase activity and production of 17ß-estradiol in follicles during vitellogenesis and the rapid decline before final oocyte maturation in various fishes (Young, Kagawa, and Nagahama 1983
; Kanamori, Adachi, and Nagahama 1988
; Sakai et al. 1988
; Tanaka et al. 1995
; Chang et al. 1997
). Therefore, the function of cyp19a could be the participation of vitellogenesis in ovarian follicular development.
The strong expression of cyp19b in zebrafish brain is mainly in the hypothalamus and sensory control tissues, such as the ventral telencephalon and olfactory bulbs (fig. 7
). The production of estrogens in these brain regions has been correlated with neuroendocrine functions, sexual behavior, and sexual differentiation during the development of the central nervous system (Naftolin, Ryan, and Petro 1972
; Honda et al. 1998
; Hutchison et al. 1999
; Kellogg and Lundin 1999
; Steckelbroeck et al. 1999
; Zwain and Yen 1999
). The presence of large amounts of cyp19b in zebrafish brain suggests a special function for locally produced estrogens. With such a large amount of cyp19b produced, the zebrafish may be a good model with which to study the function of estrogen in the brain.
The distinct expression profiles of cyp19a and cyp19b suggest differences in their physiological functions. We present a hypothesis for the evolution of the chromosomal segment containing Cyp19 (fig. 5
). In the last common ancestor of zebrafish and mammals, the Cyp19 gene was expressed strongly in the ovary and weakly in the brain under the control of separate tissue- specific regulatory elements. This supposition was supported by the analysis of the human CYP19 promoter. The ovary uses a proximal promoter regulated by cAMP, and the brain and adipose tissues use other promoters regulated by cytokines (Simpson et al. 1997
). There was apparently genome duplication after the divergence of ray-finned and lobe-finned fishes (Amores et al. 1998
; Postlethwait et al. 1998
). Usually after gene duplication, one gene will be inactivated if there is no evolutionary pressure to keep the function of both genes (Bailey, Poulter, and Stockwell 1978
; Takahata and Maruyama 1979
; Li 1980
). In the zebrafish, however, both Cyp19a and Cyp19b retain enzymatic activities (our unpublished data), indicating that there has been evolutionary pressure for the preservation of functions in both genes. According to the duplication-degeneration-complementation model (Force et al. 1999
), the function of both duplicate genes will be retained if gene duplication is followed by reciprocal degeneration of essential tissue-specific regulatory elements. Thus, the brain form of Cyp19 would be unable to compensate for loss of function of ovarian Cyp19. Females lacking the ovarian expression of Cyp19 would probably be sterile, as has been shown for humans and mice (Shozu et al. 1991
; Fisher et al. 1998
). Similarly, the lack of cyp19b expression in the brain might have a yet unknown deleterious effect on zebrafish. This brain function might be uncovered by a mutation in the brain-specific cyb19b gene in zebrafish.
In the lobe-finned lineage, the single Cyp19 gene apparently retained regulatory elements for Cyp19 expression in the ovary and brain. The chromosome segment shown in figure 5
apparently remained intact in the human lineage and became part of Hsa15, but in the mouse lineage it was separated by translocations so that portions of this segment are on three mouse chromosomes (Mmu), Mmu9, Mmu2, and Mmu7 (fig. 5
). It is known that the rodent lineage has suffered substantially more chromosome translocations and other rearrangements than the human lineage (O'Brien et al. 1999
). After the divergence of mammals, the Cyp19 gene in cattle and pigs probably underwent additional tandem duplication, resulting in two Cyp19 genes clustered on bovine chromosome 10 and three Cyp19 genes on swine chromosome 1 (Choi et al. 1997
; Brunner et al. 1998
).
In summary, we have characterized two zebrafish Cyp19 genes, located on duplicated chromosomal segments. The cyp19a gene is expressed mainly in the ovary. The cyp19b gene is expressed only in the brain. The retention of two active cyp19 genes on duplicated zebrafish chromosomes demonstrates the importance of these genes in the two different tissues during evolution.
| Acknowledgements |
|---|
|
|
|---|
We thank Ching-Fong Chang, Sheng-Ping Hwang, Jye-I Wang, and Jao-Lun Chen for discussion and help in setting up the system; Graham Corley-Smith for helping with primer design; and Mary Wyatt for reading the manuscript. This work was supported by grants NSC88- 2611-B-001-008-B24 and NSC87-2311-B-001-032-B24 from the National Science Council and by Academia Sinica, Republic of China, NIH grant R01RR10715, and NSF grant IBN-9728587.
| Footnotes |
|---|
David Irwin, Reviewing Editor
1 Keywords: zebrafish
gene duplication
cyp19
P450 aromatase
phylogeny
steroid ![]()
2 Address for correspondence and reprints: Bon-chu Chung, Institute of Molecular Biology, 48, Academia Sinica, Nankang, Taipei, Taiwan, 115, Republic of China. mbchung{at}sinica.edu.tw ![]()
| literature cited |
|---|
|
|
|---|
Amores, A., A. Force, Y.-L. Yan et al. (13 co-authors). 1998. Zebrafish hox clusters and vertebrate genome evolution. Science 282:17111714
Bailey, G. S., R. T. Poulter, and P. A. Stockwell. 1978. Gene duplication in tetraploid fish: model for gene silencing at unlinked duplicated loci. Proc. Natl. Acad. Sci. USA 75: 55755579
Brunner, R. M., T. Goldammer, R. Fuerbass, J. Vanselow, and M. Schwerin. 1998. Genomic organization of the bovine aromatase encoding gene and a homologous pseudogene as revealed by DNA fiber FISH. Cytogenet. Cell Genet. 82:3740[Web of Science][Medline]
Chang, X. T., T. Kobayashi, H. Kajiura, M. Nakamura, and Y. Nagahama. 1997. Isolation and characterization of the cDNA encoding the tilapia (Oreochromis niloticus) cytochrome P450 aromatase (P450arom): changes in P450arom mRNA, protein and enzyme activity in ovarian follicles during oogenesis. J. Mol. Endocrinol. 18:5766
Chen, S., and D. Zhou. 1992. Functional domains of aromatase cytochrome P450 inferred from comparative analyses of amino acid sequences and substantiated by site-directed mutagenesis. J. Biol. Chem. 267:2258722594
Chen, S. A., M. J. Besman, R. S. Sparkes, S. Zollman, I. Klisak, T. Mohandas, P. F. Hall, and J. E. Shively. 1988. Human aromatase: cDNA cloning, Southern blot analysis, and assignment. DNA 7:2738
Chiang, E. F.-L., Y.-L. Yan, S.-K. Tong, P.-H. Hsiao, Y. Guiguen, J. Postlethwait, and B.-c. Chung. 2001. Characterization of duplicated zebrafish cyp19 genes. J. Exp. Zool. (in press)
Choi, I., D. L. Troyer, D. L. Cornwell, K. R. Kirby Dobbels, W. R. Collante, and F. A. Simmen. 1997. Closely related genes encode developmental and tissue isoforms of porcine cytochrome P450 aromatase. DNA Cell Biol. 16: 769777
Efron, B., and G. Gong. 1983. A leisurely look at the bootstrap, the jacknife, and cross-validation. Am. Stat. 37:36 48
Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783791
Fisher, C. R., K. H. Graves, A. F. Parlow, and E. R. Simpson. 1998. Characterization of mice deficient in aromatase (ArKO) because of targeted disruption of the cyp19 gene. Proc. Natl. Acad. Sci. USA 95:69656970
Force, A., M. Lynch, F. B. Pickett, A. Amores, Y. L. Yan, and J. Postlethwait. 1999. Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151: 15311545
Fukada, S., M. Tanaka, M. Matsuyama, D. Kobayashi, and Y. Nagahama. 1996. Isolation, characterization, and expression of cDNAs encoding the medaka (Oryzias latipes) ovarian follicle cytochrome P450 aromatase. Mol. Reprod. Dev. 45:285290[Web of Science][Medline]
Gates, M. A., L. Kim, E. S. Egan, T. Cardozo, N. H. I. Sirotki, S. T. Dougan, D. Lashkari, R. Abagyan, A. F. Schier, and W. S. Talbot. 1999. A genetic linkage map for zebrafish: comparative analysis and localization of genes and expressed sequences. Genome Res. 9:334347
Geisler, R., G. J. Rauch, H. Baier et al. (25 co-authors). 1999. A radiation hybrid map of the zebrafish genome. Nat. Genet. 23:8689[Web of Science][Medline]
Gelinas, D., and G. V. Callard. 1997. Immunolocalization of aromatase- and androgen receptor-positive neurons in the goldfish brain. Gen. Comp. Endocrinol. 106:155168[Web of Science][Medline]
Goff, D. J., K. Galvin, H. Katz, M. Westerfield, E. Lander, and C. J. Tabin. 1992. Identification of polymorphic simple sequence repeats in the genome of the zebrafish. Genomics 14:200202
Honda, S., N. Harada, S. Ito, Y. Takagi, and S. Maeda. 1998. Disruption of sexual behavior in male aromatase-deficient mice lacking exons 1 and 2 of the cyp19 gene. Biochem. Biophys. Res. Commun. 252:445449[Web of Science][Medline]
Hu, M.-C., Y.-Y. Huang, N.-C. Hsu, H. Li, and B.-C. Chung. 1999. Tissue-specific, hormonal and developmental regulation of CYP11A1/LacZ expression in transgenic mice leads to adrenocortical zone characterization. Endocrinology 140:56095618
Hukriede, N. A., L. Joly, M. Tsang et al. (17 co-authors). 1999. Radiation hybrid mapping of the zebrafish genome. Proc. Natl. Acad. Sci. USA 96:97459750
Hutchison, J. B., A. Wozniak, C. Beyer, M. Karolczak, and R. E. Hutchison. 1999. Steroid metabolising enzymes in the determination of brain gender. J. Steroid Biochem. Mol. Biol. 69:8596[Web of Science][Medline]
Hwang, S. P. L., M. F. Tsou, Y. C. Lin, and C. H. Liu. 1997. The zebrafish BMP4 gene: sequence analysis and expression pattern during embryonic development. DNA Cell Biol. 16:10031011[Web of Science][Medline]
Johnson, S. L., M. A. Gates, M. Johnson, W. S. Talbot, S. Horne, K. Baik, S. Rude, J. R. Wong, and J. H. Postlethwait. 1996. Centromere-linkage analysis and the consolidation of the zebrafish genetic map. Genetics 142:1277 1288
Kanamori, A., S. Adachi, and Y. Nagahama. 1988. Developmental changes in steroidogenic responses of ovarian follicles of amago salmon (Oncorhynchus rhodurus) to chum salmon gonadotropin during oogenesis. Gen. Comp. Endocrinol. 72:1324[Web of Science][Medline]
Kellogg, C. K., and A. Lundin. 1999. Brain androgen-inducible aromatase is critical for adolescent organization of environment-specific social interaction in male rats. Horm. Behav. 35:155162[Medline]
Knapik, E. W., A. Goodman, O. S. Atkinson et al. (20 co- authors). 1996. A reference cross DNA panel for zebrafish (Danio rerio) anchored with simple sequence length polymorphisms. Development 123:451460
Knapik, E. W., A. Goodman, M. Ekker, M. Chevrette, J. Delgado, S. Neuhauss, N. Shimoda, W. Driever, M. C. Fishman, and H. J. Jacob. 1998. A microsatellite genetic linkage map for zebrafish (Danio rerio). Nat. Genet. 18: 338343
Lander, E. S., P. Green, J. Abrahamson, A. Barlow, M. J. Daly, S. E. Lincoln, and L. Newburg. 1987. MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1:174181
Lee, H.-H., H.-T. Chao, Y.-J. Lee, S.-G. Shu, M.-C. Chao, J.-M. Kuo, and B.-c. Chung. 1998. Identification of four novel mutations in the CYP21 gene in congenital adrenal hyperplasia in the Chinese. Hum. Genet. 103:304310[Web of Science][Medline]
Li, W. H. 1980. Rate of gene silencing at duplicate loci: a theoretical study and interpretation of data from tetraploid fishes. Genetics 95:237258
Means, G. D., M. S. Mahendroo, C. J. Corbin, J. M. Mathis, F. E. Powell, C. R. Mendelson, and E. R. Simpson. 1989. Structural analysis of the gene encoding human aromatase cytochrome P-450, the enzyme responsible for estrogen biosynthesis. J. Biol. Chem. 264:1938519391
Mendelson, C. R., C. T. Evans, and E. R. Simpson. 1987. Regulation of aromatase in estrogen-producing cells. J. Steroid Biochem. 27:753757[Web of Science][Medline]
Moens, C. B., Y. L. Yan, B. Appel, A. G. Force, and C. B. Kimmel. 1996. Valentino: a zebrafish gene required for normal hindbrain segmentation. Development 122:39813990
Naftolin, F., K. J. Ryan, and Z. Petro. 1972. Aromatization of androstenedione by the anterior hypothalamus of adult male and female rats. Endocrinology 90:295298
Nelson, J. S. 1994. Fishes of the world. John Wiley, New York
O'Brien, S. J., M. Menotti Raymond, W. J. Murphy, W. G. Nash, J. Wienberg, R. Stanyon, N. G. Copeland, N. A. Jenkins, J. E. Womack, and J. A. Marshall Graves. 1999. The promise of comparative genomics in mammals [in process citation]. Science 286:458481
Odenthal, J., and C. Nusslein Volhard. 1998. Fork head domain genes in zebrafish. Dev. Genes Evol. 208:245258[Web of Science][Medline]
Ohno, S., U. Wolf, and N. B. Atkin. 1968. Evolution from fish to mammals by gene duplication. Hereditas 59:169 187
Perriere, G., and M. Gouy. 1996. WWW-Query: an on-line retrieval system for biological sequence banks. Biochimie 78:364369
Postlethwait, J. H., S. L. Johnson, C. N. Midson et al. (15 co-authors). 1994. A genetic linkage map for the zebrafish. Science 264:699703
Postlethwait, J. H., Y. L. Yan, M. A. Gates et al. (25 co- authors). 1998. Vertebrate genome evolution and the zebrafish gene map. Nat. Genet. 18:345349[Web of Science][Medline]
Risinger, C., and D. Larhammar. 1993. Multiple loci for synapse protein SNAP-25 in the tetraploid goldfish. Proc. Natl. Acad. Sci. USA 90:1059810602
Roselli, C. E. 1985. Distribution and regulation of aromatase activity in the rat hypothalamus and limbic system. Endocrinology 117:24712477
Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406425[Abstract]
Sakai, N., T. Iwamatsu, K. Yamauchi, N. Suzuki, and Y. Nagahama. 1988. Influence of follicular development on steroid production in the medaka (Oryzias latipes) ovarian follicle in response to exogenous substrates. Gen. Comp. Endocrinol. 71:516523[Web of Science][Medline]
Shimoda, N., E. W. Knapik, J. Ziniti, C. Sim, E. Yamada, S. Kaplan, D. Jackson, F. de Sauvage, H. Jacob, and M. C. Fishman. 1999. Zebrafish genetic map with 2000 microsatellite markers. Genomics 58:219232
Shozu, M., K. Akasofu, T. Harada, and Y. Kubota. 1991. A new cause of female pseudohermaphroditism: placental aromatase deficiency. J. Clin. Endocrinol. Metab. 72:560 566
Simpson, E. R., M. S. Mahendroo, G. D. Means, M. W. Kilgore, C. J. Corbin, and C. R. Mendelson. 1993. Tissue-specific promoters regulate aromatase cytochrome P450 expression. J. Steroid Biochem. Mol. Biol. 44:321330[Web of Science][Medline]
Simpson, E. R., M. S. Mahendroo, G. D. Means et al. (12 co-authors). 1994. Aromatase cytochrome P450, the enzyme responsible for estrogen biosynthesis. Endocrinol. Rev. 15:342355
Simpson, E. R., M. D. Michael, V. R. Agarwal, M. M. Hinshelwood, S. E. Bulun, and Y. Zhao. 1997. Expression of the CYP19 (aromatase) gene: an unusual case of alternative promoter usage. FASEB J. 11:2936[Abstract]
Steckelbroeck, S., D. D. Heidrich, B. Stoffel Wagner, V. H. Hans, J. Schramm, F. Bidlingmaier, and D. Klingmuller. 1999. Characterization of aromatase cytochrome P450 activity in the human temporal lobe. J. Clin. Endocrinol. Metab. 84:27952801
Swofford, D. L., G. J. Olsen, P. J. Waddell, and D. M. Hillis. 1996. Phylogenetic inference. Pp. 407514 in D. M. Hillis, C. Moritz, and B. K. Mable, eds. Molecular systematics. Sinauer, Sunderland, Mass
Takahata, N., and T. Maruyama. 1979. Polymorphism and loss of duplicate gene expression: a theoretical study with application of tetraploid fish. Proc. Natl. Acad. Sci. USA 76:45214525
Tanaka, M., S. Fukada, M. Matsuyama, and Y. Nagahama. 1995. Structure and promoter analysis of the cytochrome P- 450 aromatase gene of the teleost fish, medaka (Oryzias latipes). J. Biochem. 117:719725
Tanaka, M., T. M. Telecky, S. Fukada, S. Adachi, S. Chen, and Y. Nagahama. 1992. Cloning and sequence analysis of the cDNA encoding P-450 aromatase (P450arom) from a rainbow trout (Oncorhynchus mykiss) ovary; relationship between the amount of P450arom mRNA and the production of oestradiol-17 beta in the ovary. J. Mol. Endocrinol. 8:5361
Tchoudakova, A., and G. V. Callard. 1998. Identification of multiple CYP19 genes encoding different cytochrome P450 aromatase isozymes in brain and ovary. Endocrinology 139:21792189
Westerfield, M. 1995. The zebrafish book: a guide for the laboratory use of zebrafish (Danio rerio). University of Oregon Press, Eugene
Wolf, U., H. Ritter, N. B. Atkin, and S. Ohno. 1969. Polyploidization in the fish family Cyprinidae, order Cypriniformes. I. DNA-content and chromosome sets in various species of Cyprinidae. Humangenetik 7:240244
Young, G., H. Kagawa, and Y. Nagahama. 1983. Evidence for a decrease in aromatase activity in the ovarian granulosa cells of amago salmon (Oncorhynchus rhodurus) associated with final oocyte maturation. Biol. Reprod. 29:310315[Abstract]
Youngblood, G. L., M. N. Nesbitt, and A. H. Payne. 1989. The structural genes encoding P450scc and P450arom are closely linked on mouse chromosome 9. Endocrinology 125:27842786
Zwain, I. H., and S. S. Yen. 1999. Neurosteroidogenesis in astrocytes, oligodendrocytes, and neurons of cerebral cortex of rat brain. Endocrinology 140:38433852
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C.J. Corbin, T. Berger, J.J. Ford, C.E. Roselli, W. Sienkiewicz, B.C. Trainor, J.F. Roser, J.D. Vidal, N. Harada, and A.J. Conley Porcine Hypothalamic Aromatase Cytochrome P450: Isoform Characterization, Sex-Dependent Activity, Regional Expression, and Regulation by Enzyme Inhibition in Neonatal Boars Biol Reprod, August 1, 2009; 81(2): 388 - 395. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Mittelholzer, E Andersson, D Consten, T Hirai, Y Nagahama, and B Norberg 20{beta}-hydroxysteroid dehydrogenase and CYP19A1 are differentially expressed during maturation in Atlantic cod (Gadus morhua) J. Mol. Endocrinol., October 1, 2007; 39(4): 319 - 328. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Cheshenko, F. Brion, Y. Le Page, N. Hinfray, F. Pakdel, O. Kah, H. Segner, and R. I.L. Eggen Expression of Zebra Fish Aromatase cyp19a and cyp19b Genes in Response to the Ligands of Estrogen Receptor and Aryl Hydrocarbon Receptor Toxicol. Sci., April 1, 2007; 96(2): 255 - 267. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-A. Weltzien, C. Pasqualini, M.-E. Sebert, B. Vidal, N. Le Belle, O. Kah, P. Vernier, and S. Dufour Androgen-Dependent Stimulation of Brain Dopaminergic Systems in the Female European Eel (Anguilla anguilla) Endocrinology, June 1, 2006; 147(6): 2964 - 2973. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-T. Wong, S. Ijiri, and Y. Zohar Molecular Biology of Ovarian Aromatase in Sex Reversal: Complementary DNA and 5'-Flanking Region Isolation and Differential Expression of Ovarian Aromatase in the Gilthead Seabream (Sparus aurata) Biol Reprod, May 1, 2006; 74(5): 857 - 864. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Slanchev, J. Stebler, G. de la Cueva-Mendez, and E. Raz From the Cover: Development without germ cells: The role of the germ line in zebrafish sex differentiation PNAS, March 15, 2005; 102(11): 4074 - 4079. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Winkler, M. Schafer, J. Duschl, M. Schartl, and J.-N. Volff Functional Divergence of Two Zebrafish Midkine Growth Factors Following Fish-Specific Gene Duplication Genome Res., June 1, 2003; 13(6): 1067 - 1081. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Murray, E. R. Busby, T. P. Mommsen, and P. A. Wright Evolution of glutamine synthetase in vertebrates: multiple glutamine synthetase genes expressed in rainbow trout (Oncorhynchus mykiss) J. Exp. Biol., May 1, 2003; 206(9): 1511 - 1521. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Golovine, M. Schwerin, and J. Vanselow Three Different Promoters Control Expression of the Aromatase Cytochrome P450 Gene (Cyp19) in Mouse Gonads and Brain Biol Reprod, March 1, 2003; 68(3): 978 - 984. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. T. Ankley, M. D. Kahl, K. M. Jensen, M. W. Hornung, J. J. Korte, E. A. Makynen, and R. L. Leino Evaluation of the Aromatase Inhibitor Fadrozole in a Short-Term Reproduction Assay with the Fathead Minnow (Pimephales promelas) Toxicol. Sci., May 1, 2002; 67(1): 121 - 130. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Altschmied, J. Delfgaauw, B. Wilde, J. Duschl, L. Bouneau, J.-N. Volff, and M. Schartl Subfunctionalization of Duplicate mitf Genes Associated With Differential Degeneration of Alternative Exons in Fish Genetics, May 1, 2002; 161(1): 259 - 267. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Uchida, M. Yamashita, T. Kitano, and T. Iguchi Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish J. Exp. Biol., March 15, 2002; 205(6): 711 - 718. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||














