Skip Navigation

This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Volff, J.-N.
Right arrow Articles by Schartl, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Volff, J.-N.
Right arrow Articles by Schartl, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Biology and Evolution 18:266-270 (2001)
© 2001 Society for Molecular Biology and Evolution


LETTER

Ty3/Gypsy Retrotransposon Fossils in Mammalian Genomes: Did They Evolve into New Cellular Functions?

Jean-Nicolas Volff, Cornelia Körting and Manfred Schartl

Physiologische Chemie I, Biozentrum, University of Würzburg, Würzburg, Germany

Long-terminal-repeat (LTR) retrotransposons from the Ty3/Gypsy superfamily have been detected in various eukaryotic taxa, including some vertebrate lineages (lampreys, bony fishes, amphibians, and reptiles; Miller et al. 1999Citation and references therein). Nevertheless, molecular and database screenings failed to detect such elements in the genome of mammals. Considering the huge amount of sequence information available on mammalian genomes and transcriptomes, this suggested that Ty3/Gypsy retrotransposons either have been lost or are present at an extremely low copy number in mammals.

By examination of public sequence databases, we identified Ty3/Gypsy-like sequences in mammals. The human protein KIAA1051, obtained from a brain cDNA library (Kikuno et al. 1999Citation ), shows significant similarities to the Gag structural core protein of some Ty3/Gypsy retrotransposons from the Ty3 family, including Sushi from the pufferfish Fugu rubripes (Poulter and Butler 1998Citation ) (42.5% similarities, expected value E = 10-24) and Skippy (Anaya and Roncero 1995Citation ), Maggy (Farman et al. 1996Citation ), and Cft1 (Curtis and Oliver 1996Citation ) from different fungi (fig. 1 ). In particular, the C-terminal putative nucleic acid–binding site CX2CX4HX4C is conserved. No significant similarity to other families of Ty3/Gypsy retrotransposons and retroviruses was found. Two additional human proteins, the brain protein KIAA1318 (accession number BAA92556; Nagase et al. 2000Citation ) and the putative nuclear protein LDOC1 (Nagasaki et al. 1999Citation ), also showed significant similarities to the KIAA1051 and Sushi Gag(-like) proteins, but outside of the nucleic acid–binding domain.



View larger version (100K):
[in this window]
[in a new window]
 
Fig. 1.—Comparison of the mammalian Ty3/Gypsy-like sequences with retrotransposons from the Ty3 family. The Gag potential nucleic acid–binding site and the Pol first and second conserved RT domains (Xiong and Eickbush 1990Citation ) are underlined; the Pol protease active site is overlined. Identical residues are shown in black, and conservative substitutions are shown in gray (drawn using MacBoxshade). Conserved residues in reverse transcriptase (RT) domains 3 and 4 (Xiong and Eickbush 1990Citation ) are indicated either with an asterisk (residues conserved in KIAA1051, TRT1, and MyEF-3*) or with an arrow (residues absent from KIAA1051, TRT1, and MyEF-3*). Accession numbers: MyEF-3 (Mus musculus)—pir: JE0163 (the MyEF-3 cDNA sequence used in other analysis is absent from databases and was directly transcribed from Steplewski et al. [1998Citation ]); KIAA1051 (Homo sapiens)—AB028974; Sushi (Fugu rubripes)—Gag: AAC33525, Pol: AAC33526; Maggy (Magnaporthe grisea)—Gag: AAA33419, Pol: AAA33420; Skippy (Fusarium oxysporum)—Gag: S60178, Pol: S60179; Cft1 (Cladosporium fulvum)—Gag: S23569, Pol: AAF21678; KIAA1051 and TRT1 (Mustela vison) Pol-like sequences are conceptual translations of nucleotide sequences AB028974 and U00594, respectively. Three frameshifts (two in the RT domain and one in the C-terminal domain) were introduced into U00594 to optimize alignment of the Pol-like sequence. MyEF-3* Gag and Pol sequences are conceptual translations of the Mus musculus genomic sequence AF302691 (2.3 kb in length). This sequence was obtained by PCR using primers My-F1 (gagaagttcgatggcaaccc), My-F2 (ttcatggaaaagagcaccag), and My-F3 (gaggtgcccgcatgcgcctg), which are derived from the published MyEF-3 gag-like sequence (Steplewski et al. 1998Citation ), combined with primers My-R1 (tggggcactggaggctggcggt) and My-R2 (ccaggtgatgacaacaggtaca), which are derived from rat ESTs showing sequence similarity to the 3' end of the KIAA1051 pol-like gene. The MyEF-3* nucleotide sequence obtained ends directly after the region encoding the less-conserved RT domains 3 and 4. Sequence analysis was performed using the GCG Wisconsin package, version 10.0 (Genetics Computer Group, Madison, Wis.)

 
LTR retrotransposons possess a pol open reading frame, which generally partially overlaps the gag gene and encodes the enzymatic machinery for replication. Ribosomal frameshift leads to production of a Gag-Pol polyprotein. The KIAA1051 cDNA (6.2 kb in length) also contains a partial pol-like sequence (1.5 kb in length), which overlaps the gag-like sequence (1 kb in length) over approximately 250 bp. Its conceptual translation product displays protease and truncated reverse transcriptase (RT) regions, including well-conserved first and second of the seven RT domains (according to Xiong and Eickbush 1990Citation ) and shows the highest similarity to the Pol polyprotein of Sushi (119/272 = 43.7% similarity; E = 2 x 10-22) (fig. 1 ). The C-terminal end displays a much lower degree of conservation with RT domains 3 and 4 (fig. 1 ). No additional similarity with other retrotransposon sequences and no other long open reading frame could be identified in the KIAA1051 cDNA. Hence, the KIAA1051 sequence displays the characteristics of a truncated LTR retrotransposon and is certainly not capable of autonomous retrotransposition.

The KIAA1051 gene has been mapped to human chromosome 7 (Kikuno et al. 1999Citation ). Despite the large amount of human genomic sequences present in public databases (more than 80% estimated coverage with working draft sequences at the time of the analysis), nucleotide database searching using the gag/pol-like sequence as a query identified the KIAA1051 gene only in the human low-pass sequence sampling clone RP11-648L18 (R. H. Waterston; accession number AC069292, htgs database). Other sequences from this clone (e.g., the epsilon sarcoglycan gene) have been already mapped to chromosome 7 like the KIAA1051 gene. This confirmed the location of the KIAA1051 gene and suggested that this retrotransposon-like sequence was not reiterated (or at an extremely low level) in the human genome. Analysis of the database genomic sequences, as well as our PCR analysis (data not shown), showed an absence of introns in the KIAA1051 gene, consistent with its retrotransposon origin (not shown). Database searching identified KIAA1051 ESTs from numerous different human organs and tissues. Their high level of identity to the KIAA1051 sequence was compatible with the presence of a unique transcribed gene.

MyEF-3, a putative mouse homolog of KIAA1051 isolated from a brain expression library (Steplewski et al. 1998Citation ), displays 69% similarity (E = 2 x 10-62) to the KIAA1051 Gag-like protein. The potential nucleic acid–binding site is conserved (fig. 1 ). Because the published MyEF-3 cDNA was too short to detect a pol-like sequence, we amplified by PCR a MyEF-3-like sequence from mouse genomic DNA (accession number AF302691; see legend of fig. 1 ). One unique sequence, called MyEF-3*, was reproducibly obtained using different primer combinations and mouse genomic DNA sources. MyEF-3* shows more than 98% nucleotide identity to the published MyEF-3 cDNA sequence. Two frameshifts are present in the published MyEF-3 gag-like sequence compared with KIAA1051 and MyEF-3*: a 2-nt deletion, followed approximately 150 nt downstream by a 1-nt deletion, restoring the original reading frame. This did not introduce any stop codon in MyEF-3 but generated a ~50-aa central region with a much lower degree of similarity to MyEF-3* and KIAA1051 (from PLGYCQ to DQTSAP in MyEF-3; fig. 1 ). Apart from this region of lower similarity, the Gag-like sequences of MyEF-3 and MyEF-3* are absolutely identical (fig. 1 ). MyEF-3* also contains a partial pol-like sequence (fig. 1 ), which is identical to the unique related mouse EST present in public databases (accession number AW209996). Compared with KIAA1051, the protease-encoding region of MyEF-3* is separated from the partial RT-encoding region by an ~600-nt insertion very rich in oligonucleotide repeats and introducing stop codons into the partial pol open reading frame (this insertion was removed for protein sequence analysis). RT-PCR analysis showed that the whole gag/partial pol MyEF-3* sequence amplified from genomic DNA was transcribed in mouse brain and that the 600-nt insertion was not spliced out (data not shown).

The KIAA1051 pol-like nucleotide sequence is 89% identical to the TRT1 (partial) cDNA sequence from mink lung epithelial cells, whose RNA level is decreased after transforming growth factor ß treatment (Ralph, McClelland, and Welsh 1993Citation ). This sequence was too short to detect any gag-like gene. Related ESTs were also detected in rats and bovines (not shown), suggesting, in contrast to earlier reports, that a Ty3/Gypsy-like sequence is widely distributed and even transcribed in mammals.

The phylogeny of the Ty3/Gypsy superfamily is difficult to establish using individual enzymatic domains (Malik and Eickbush 1999Citation ). Accordingly, analysis of RT domains 1 and 2 did not allow us to determine the phylogenetic position of mammalian Pol-like sequences (data not shown). Extension of the region of analysis about 50 amino acids upstream of RT domain 1 placed the mammalian sequences into a group of Sushi/Maggy-related elements within the Ty3 family (fig. 2 ), supporting the database analysis results. Analysis of sequences from the protease active site to RT domain 2 supported the same conclusion (not shown) but was not taken into consideration because of the high level of sequence variability and ambiguous alignments. The low level of conservation between Gag sequences within the Ty3/Gypsy superfamily (including presence or absence of CX2CX4HX4C domains, depending on the element) allowed only the comparison of closely related Gag sequences. This analysis suggested a close relationship of KIAA1051 and MyEF-3 sequences to the Sushi Gag protein from the fish F. rubripes (fig. 2 ).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2.—Phylogenetic position of mammalian Gypsy-like sequences within the Ty3 retrotransposon family. Pol phylogeny was obtained using sequences from about 50 residues upstream of reverse transcriptase (RT) domain 1 to the C-terminal end of RT domain 2 (e.g., from VYTPVD to IQNQYP for KIAA1051; see fig. 1 ). Trees were generated by the neighbor-joining distance algorithm (Saitou and Nei 1987Citation ; bootstrap analysis, 1,000 replicates) using PAUP* (D. Swofford, Smithsonian Institution). Elements that do not belong to the Ty3 family (Mdg1, Ted, and Gypsy) were chosen as the outgroup for the Pol phylogenetic tree according to Malik and Eickbush (1999)Citation . Accession numbers: Grasshopper (Magnaporthe grisea)—Gag: M77661, Pol: M77662; Tf2 (Schizosaccharomyces pombe)—Pol: CAB64236; Ty3 (Saccharomyces cerevisiae)—Gag: AAA98434, Pol: AAA98435; Skipper (Dictyostelium discoideum)—Pol: T14598; Mdg1 (Drosophila melanogaster)—Pol: S70430; Ted (Trichoplusia ni)—Pol: B36329; Gypsy (Drosophila virilis)—Pol: S26840. The origins of other sequences are given in the legend of figure 1 .

 
MyEF-3 and KIAA1051 have similar expression patterns, including a strong expression in the brain (Steplewski et al. 1998Citation ; Kikuno et al. 1999Citation ). Interestingly, the MyEF-3 protein was identified through its binding to an important regulatory sequence in the promoter of the myelin basic protein (MBP), the major component of the myelin sheath of the central nervous system (Steplewski et al. 1998Citation ). MyEF-3 expression is developmentally regulated during brain maturation similar to MBP and has been thought to be involved in the cell type– and stage-specific expression of the myelin gene (Steplewski et al. 1998Citation ). Furthermore, Steplewski et al. (1998)Citation mentioned that ectopic expression of MyEF-3 in oligodendrocytic cells leads to a modest increase in transcription of an MBP reporter construct containing the MyEF-3–binding site.

If the binding of MyEF-3 in the promoter of the MBP is of significance for the expression of the myelin gene, as suggested by Steplewski et al. (1998)Citation , our analysis would propose a very unusual hypothesis: a Ty3/Gypsy-related retrotransposon would have evolved into a regulatory DNA-binding protein in mammals. It has already been suggested that important cellular functions like the RAG1/RAG2 recombinase (Agrawal, Eastman, and Schatz 1998Citation ; Hiom, Melek, and Gellert 1998Citation ) and the RT telomerase (Eickbush 1997Citation ) might have evolved from transposable elements. More recently, a retroviral envelope-like protein called syncytin has been implicated in human placental morphogenesis (Mi et al. 2000Citation ). While retroviral envelope proteins and syncytin probably have similar molecular functions (promotion of cell fusion; Mi et al. 2000Citation ), MyEF-3 might represent a case of a genome parasite protein having evolved into an extremely divergent host molecular function.

The rate of substitutions between KIAA1051 and MyEF-3 gag-like genes is fivefold higher at synonymous sites than at nonsynonymous sites, and even 13.8-fold higher in the 130-nt region surrounding the nucleic-acid-binding-domain–encoding sequence. The rate of substitutions between KIAA1051 and MyEF-3 pol-like genes is 3.8-fold higher at synonymous sites. Such values are suggestive of maintenance of the functionality of the gag and (partial) pol genes during evolution. This might be related to retrotranspositional activity of the KIAA1051-related retrotransposons after separation of the mouse lineage from the human/mink lineage approximately 110 MYA (Kumar and Hedges 1998Citation ).

On the other hand, KIAA1051, TRT1, and MyEF-3* show a much lower degree of conservation with other Sushi-related retrotransposons downstream of RT domains 1 and 2, including the absence of the same extremely conserved residues in domains 3 and 4 (indicated with arrows in fig. 1 according to Xiong and Eickbush [1990Citation ]). The degree of similarity within this region is relatively high between the three mammalian elements. Hence, this suggests that the loss of conserved RT residues occurred in a common ancestral retrotransposon before separation of the mouse lineage from the human/mink lineage. We cannot exclude the possibility that the ability to retrotranspose might have been conserved even with these mutations. Nevertheless, some of the lost residues are extremely conserved in all autonomous retroelements (Xiong and Eickbush 1990Citation ), strongly suggesting that they are necessary for retrotransposition. Therefore, a defective retrotransposon might have been present for at least 100 Myr in the genome of mammals without retrotransposing. Despite its inactivity, this retrotransposon-related element was not lost, its Gag- and protease-encoding sequences did not suffer any disrupting mutation, and its gene product was even selected for its functionality. This suggests that a retrotransposon-like protein has undertaken a new selected function independent of retrotransposition and uncovers a fascinating aspect of genome ecology in living organisms.

Footnotes

Pierre Capy, Reviewing Editor

1 Keywords: KIAA1051 MyEF-3 TRT1 Sushi, Gag Pol, phylogeny Back

2 Address for correspondence and reprints: Jean-Nicolas Volff, Physiological Chemistry I, Biocenter, University of Würzburg, Am Hubland, D-97074 Würzburg, Germany. E-mail: volff{at}biozentrum.uni-wuerzburg.de Back

literature cited

    Agrawal, A., Q. M. Eastman, and D. G. Schatz. 1998. Transposition mediated by RAG1 and RAG2 and its implications for the evolution of the immune system. Nature 394:744–751.

    Anaya, N., and M. I. Roncero. 1995. Skippy, a retrotransposon from the fungal plant pathogen Fusarium oxysporum. Mol. Gen. Genet. 249:637–647.

    Curtis, M. D., and R. P. Oliver. 1996. Gypsy-class retrotransposon sequences in organisms related to the leaf mould fungus Cladosporium fulvum. Microbiol. Res. 151:113–119.

    Eickbush, T. H. 1997. Telomerase and retrotransposons: which came first? Science 277:911–912.

    Farman, M. L., Y. Tosa, N. Nitta, and S. A. Leong. 1996. MAGGY, a retrotransposon in the genome of the rice blast fungus Magnaporthe grisea. Mol. Gen. Genet. 251:665–674.

    Hiom, K., M. Melek, and M. Gellert. 1998. DNA transposition by the RAG1 and RAG2 proteins: a possible source of oncogenic translocations. Cell 94:463–470.

    Kikuno, R., T. Nagase, K. Ishikawa, M. Hirosawa, N. Miyajima, A. Tanaka, H. Kotani, N. Nomura, and O. Ohara. 1999. Prediction of the coding sequences of unidentified human genes. XIV. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res. 6:197–205.

    Kumar, S., and S. B. Hedges. 1998. A molecular timescale for vertebrate evolution. Nature 392:917–920.

    Malik, H. S., and T. H. Eickbush. 1999. Molecular evolution of the integrase domain in the Ty3/Gypsy class of LTR retrotransposons. J. Virol. 73:5186–5190.[Abstract/Free Full Text]

    Mi, S., X. Lee, X. Li et al. (12 co-authors). 2000. Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis. Nature 403:785–789.

    Miller, K., C. Lynch, J. Martin, E. Herniou, and M. Tristem. 1999. Identification of multiple Gypsy LTR-retrotransposons lineages in vertebrate genomes. J. Mol. Evol. 49:358–366.[Web of Science][Medline]

    Nagasaki, K., T. Manabe, H. Hanzawa, N. Maass, T. Tsukada, and K. Yamaguchi. 1999. Identification of a novel gene, LDOC1, down-regulated in cancer cell lines. Cancer Lett. 140:227–234.[Web of Science][Medline]

    Nagase, T., R. Kikuno, K. Ishikawa, M. Hirosawa, and O. Ohara. 2000. Prediction of the coding sequences of unidentified human genes. XVI. The complete sequences of 150 new cDNA from brain which code for large proteins in vitro. DNA Res. 7:65–73.

    Poulter, R., and M. Butler. 1998. A retrotransposon family from the pufferfish (fugu) Fugu rubripes. Gene 215:241–249.

    Ralph, D., M. McClelland, and J. Welsh. 1993. RNA fingerprinting using arbitrarily primed PCR identifies differentially regulated RNAs in mink lung (My1Lu) cells growth arrested by transforming growth factor ß1. Proc. Natl. Acad. Sci. USA 90:10710–10714.

    Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406–425.[Abstract]

    Steplewski, A., B. Krynska, A. Tretiakova, S. Haas, K. Khalili, and S. Amini. 1998. MyEF-3, a developmentally controlled brain-derived nuclear protein which specifically interacts with myelin basic protein proximal regulatory sequences. Biochem. Biophys. Res. Commun. 243:295–301.[Web of Science][Medline]

    Xiong, Y., and T. H. Eickbush. 1990. Origin and evolution of retroelements based upon their reverse transcriptase sequences. EMBO J. 9:3353–3362.[Web of Science][Medline]

Accepted for publication October 4, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. B. Clark, M. Janicke, U. Gottesbuhren, T. Kleffmann, M. Legge, E. S. Poole, and W. P. Tate
Mammalian Gene PEG10 Expresses Two Reading Frames by High Efficiency 1 Frameshifting in Embryonic-associated Tissues
J. Biol. Chem., December 28, 2007; 282(52): 37359 - 37369.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Lux, C. Beil, M. Majety, S. Barron, C. J. Gallione, H.-M. Kuhn, J. N. Berg, P. Kioschis, D. A. Marchuk, and M. Hafner
Human Retroviral gag- and gag-pol-like Proteins Interact with the Transforming Growth Factor-{beta} Receptor Activin Receptor-like Kinase 1
J. Biol. Chem., March 4, 2005; 280(9): 8482 - 8493.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
B. Gorinsek, F. Gubensek, and D. Kordis
Evolutionary Genomics of Chromoviruses in Eukaryotes
Mol. Biol. Evol., May 1, 2004; 21(5): 781 - 798.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
L. Bouneau, C. Fischer, C. Ozouf-Costaz, A. Froschauer, O. Jaillon, J.-P. Coutanceau, C. Korting, J. Weissenbach, A. Bernot, and J.-N. Volff
An Active Non-LTR Retrotransposon With Tandem Structure in the Compact Genome of the Pufferfish Tetraodon nigroviridis
Genome Res., July 1, 2003; 13(7): 1686 - 1695.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
C. Neuveglise, H. Feldmann, E. Bon, C. Gaillardin, and a. S. Casaregola
Genomic Evolution of the Long Terminal Repeat Retrotransposons in Hemiascomycetous Yeasts
Genome Res., June 1, 2002; 12(6): 930 - 943.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
C. Llorens and I. Marin
A Mammalian Gene Evolved from the Integrase Domain of an LTR Retrotransposon
Mol. Biol. Evol., August 1, 2001; 18(8): 1597 - 1600.
[Full Text] [PDF]


This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Volff, J.-N.
Right arrow Articles by Schartl, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Volff, J.-N.
Right arrow Articles by Schartl, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?