Molecular Biology and Evolution 18:2225-2239 (2001)
© 2001 Society for Molecular Biology and Evolution
Evolutionary Relationships and Biogeography of Biomphalaria (Gastropoda: Planorbidae) with Implications Regarding Its Role as Host of the Human Bloodfluke, Schistosoma mansoni
Department of Biology, University of New Mexico, Albuquerque;
Departmento de Malacologia, Instituto Oswaldo Cruz, Rio de Janeiro, Brazil;
Laboratoire de Biologie Marine et Malacologie, Centre de Biologie Tropicale, EPHE, Perpignan, France;
Servicio Autónomo Instituto de Altos Estudios en Salud Pública "Dr. Arnoldo Gabaldón," Ministerio de Salud y Desarrollo Social, Maracay, Venezuela;
Department of Microbiology, University of Ghana Medical School, Korle-Bu, Accra, Ghana;
Tropical Medicine Research Institute, National Centre For Research, Khartoum, Sudan;
Centro de Pesquisas Aggeu Magalhães, FIOCRUZ, Cidade Universitária, Recife, Pernambuco, Brazil;
IRD, Antananarivo, Madagascar;
Facultad de Ciencias Médicas, Universidad Nacional de Asuncíon, Asuncíon, Paraguay;
Centro de Pesquisas René Rachou, FIOCRUZ, Belo Horizonte, Minas Gerais, Brazil;
Universidad Nacional Pedro Henríquez Ureña, Santo Domingo, Dominican Republic;
Department of Biology, University of Puerto Rico, Rio Piedras Campus, San Juan;
Laboratorio de Malacologia, Instituto Pedro Kouri, Ciudad de La Habana, Cuba;
Departamento de Parasitologia, Bilharzia Lab, Facultad de Ciencias de la Salud, Universidad de Carabobo, Valencia, Venezuela;
Lab. Parasitologia, Instituto Butantan, Sao Paulo, Brazil;
Department of Medical Entomology and Parasitology, Vector Control Division, Ministry of Health, Kampala, Uganda;
Department of Zoology, University of Ghana, Legon, Ghana;
National Institute for Medical Research, Mwanza, Tanzania;
Faculty of Science, General Biology Laboratory, University of Yaoundé, Cameroun;
Laboratoire de Biologie Générale, Département de Biologie et Physiologie Animales, Faculté des Sciences, Université Yaoundé I, Cameroun;
CNRST/IRSS, Ouagadougou, Burkina Faso;
Department of Animal Biology, Faculty of Sciences, Cheikh Anta Diop University, Dakar, Senegal;
Laboratorio de Moluscos Vectores, PECET, Universidad de Antioquia, Medellín, Colombia;
Centre for Biotechnology Research and Development, Kenya Medical Research Institute, Nairobi, Kenya
| Abstract |
|---|
|
|
|---|
The wide geographic distribution of Schistosoma mansoni, a digenetic trematode and parasite of humans, is determined by the occurrence of its intermediate hosts, freshwater snails of the genus Biomphalaria (Preston 1910). We present phylogenetic analyses of 23 species of Biomphalaria, 16 Neotropical and seven African, including the most important schistosome hosts, using partial mitochondrial ribosomal 16S and complete nuclear ribosomal ITS1 and ITS2 nucleotide sequences. A dramatically better resolution was obtained by combining the data sets as opposed to analyzing each separately, indicating that there is additive congruent signal in each data set. Neotropical species are basal, and all African species are derived, suggesting an American origin for the genus. We confirm that a proto-Biomphalaria glabrata gave rise to all African species through a trans-Atlantic colonization of Africa. In addition, genetic distances among African species are smaller compared with those among Neotropical species, indicating a more recent origin. There are two species-rich clades, one African with B. glabrata as its base, and the other Neotropical. Within the African clade, a wide-ranging tropical savannah species, B. pfeifferi, and a Nilotic species complex, have both colonized Rift Valley lakes and produced endemic lacustrine forms. Within the Neotropical clade, two newly acquired natural hosts for S. mansoni (B. straminea and B. tenagophila) are not the closest relatives of each other, suggesting two separate acquisition events. Basal to these two species-rich clades are several Neotropical lineages with large genetic distances between them, indicating multiple lineages within the genus. Interesting patterns occur regarding schistosome susceptibility: (1) the most susceptible hosts belong to a single clade, comprising B. glabrata and the African species, (2) several susceptible Neotropical species are sister groups to apparently refractory species, and (3) some basal lineages are susceptible. These patterns suggest the existence of both inherent susceptibility and resistance, but also underscore the ability of S. mansoni to adapt to and acquire previously unsusceptible species as hosts. Biomphalaria schrammi appears to be distantly related to other Biomphalaria as well as to Helisoma, and may represent a separate or intermediate lineage.
| Introduction |
|---|
|
|
|---|
Freshwater pulmonate snails of the genus Biomphalaria are best known for their role as intermediate hosts of the widely distributed parasite of humans, the digenetic trematode Schistosoma mansoni. This parasite, one of the causal agents of intestinal schistosomiasis, infects about 83 million people (Crompton 1999
The geographic distribution of S. mansoni is closely tied to that of susceptible species of Biomphalaria which support the development of the asexually reproducing sporocyst stages of this parasite. Although S. mansoni is the best studied of all platyhelminths (Snyder et al. 2001
), relatively little is known about the evolution of its obligatory intermediate hosts (Morgan et al. 2001
). There are 34 described species of Biomphalaria, of which about 18 are known to be or presumed to be (i.e., implicated in cases of natural transmission) capable of supporting the complete larval development of S. mansoni, nine are known to be refractory (all in the Neotropics), and seven have not been tested (Malek 1985
; Brown 1994
). We apply the term, susceptible, to species which have been found to be compatible with at least one strain of S. mansoni, but we make note of the degree of susceptibility where appropriate. Of the susceptible species, four (Biomphalaria glabrata in the Neotropics, and B. pfeifferi, B. alexandrina, and B. sudanica in Africa, Madagascar, and the Middle East) play the most significant role in transmission to humans in nature. Additionally, three African Biomphalaria, B. choanomphala, B. camerunensis and B. stanleyi, and two Neotropical species, B. straminea and B. tenagophila, play lesser but important roles in particular foci (Paraense and Corrêa 1987, 1989
; Greer et al. 1990
; Brown 1994
).
Biomphalaria is also of interest in its own right because of its peculiar geographic distribution and the questions this has raised about its origin and diversification. The genus is confined to the tropics and subtropics, with 22 species occurring in the Americas and 12 species found in Africa, Madagascar and the Middle East. One species, B. straminea, has been introduced relatively recently from South America into Hong Kong (Meier-Brook 1974
). Fossil forms described as Biomphalaria are known from the tropical Eocene and Oligocene of North America and Europe and perhaps Asia (Taylor 1988
; Pierce 1993
).
The origin of Biomphalaria was originally considered to be in Gondwanaland as much as 100 MYA (Pilsbry 1911
; Davis 1980, 1992
), with the present-day distribution on both sides of the Atlantic attributed to the subsequent separation of Africa and South America. If this hypothesis is correct, deep divisions should separate the South American and African representatives as the continents have been separated for more than 70 Myr (Cox 2000)
. It has also been suggested that S. mansoni was present prior to the split of the continents, thus accounting for its current presence in both South America and Africa (Davis 1980, 1992
).
An alternative hypothesis based on allozyme data was forwarded, suggesting that Biomphalaria arose in South America after the continents split, and its presence in Africa is a consequence of a relatively recent west-to-east trans-Atlantic dispersal event in the past 2.34.5 Myr (Woodruff and Mulvey 1997
). Transoceanic dispersal for a freshwater organism like Biomphalaria may have occurred in the feathers of aquatic birds or on vegetation rafted across the ocean (Woodruff and Mulvey 1997
). Successful colonization would have been facilitated by the fact that Biomphalaria is hermaphroditic and capable of self-fertilization.
Further support for this hypothesis was recently provided by the DNA sequence data of Campbell et al. (2000)
. Moreover, their analyses gave strong support that the sister group of African species is the Neotropical B. glabrata, a relationship also noted by the allozyme-based study of Bandoni, Mulvey, and Loker (1995)
. This relationship is of interest because it is likely to have had profound consequences with respect to colonization of the Neotropics by S. mansoni.
The scenario proposed by Campbell et al. (2000)
is that an ancestral Neotropical Biomphalaria, similar to B. glabrata, colonized Africa. Its descendants then spread throughout the continent and acquired a schistosome that became S. mansoni as we know it today. The modern presence of S. mansoni in the Neotropics is generally considered to be a consequence of the slave trade, on the basis of allozyme (Fletcher, LoVerde, and Woodruff 1981
) and nuclear and mitochondrial ribosomal sequence data (Desprès, Imbert-Establet, and Monnerot 1993
) which show very little differentiation between South American and African isolates.
Whereas the phylogenetic understanding of the genus has progressed considerably from both allozyme-based studies (Bandoni, Mulvey, and Loker 1995
; Woodruff and Mulvey 1997
) and DNA sequencebased studies (Campbell et al. 2000
; Vidigal et al. 2000
), the taxonomic coverage of the 34 species in the genus has not been extensive. The allozyme studies examined only 12 species in total, many of them from laboratory stocks. Seven species were included in the study of Campbell et al. (2000)
. Vidigal et al. (2000)
examined 10 Neotropical species. A more complete analysis is necessary to determine if previously unsampled South American species have unexpected affinities with the African clade or if some of the rarer African species are relictual forms with close affinities to South American species other than B. glabrata. More complete taxon sampling can be crucial for phylogenetic accuracy (Hillis 1996
), even at the species level, where the omission of taxa can lead to different phylogenies (Omland, Lanyon, and Fritz 1999
).
A better understanding of the phylogenetic relationships among species of Biomphalaria would be helpful in several contexts. Accordingly, the purpose of this study is to use a broader representation of Biomphalaria species to (1) investigate relationships between the Neotropical and African species and further test the hypotheses of Woodruff and Mulvey (1997)
and Campbell et al. (2000)
. This analysis will help to clarify where Biomphalaria originated and how it has diversified on two different continents; (2) ascertain relationships among the Biomphalaria species within continents; and (3) better understand how the phylogeography of these snails has influenced the history, the present distribution and abundance, and the possible future spread in the Neotropics of an important human parasite, S. mansoni. To this end, we obtained sequence data from 16 Neotropical and seven African species and, where possible, from multiple populations of each species, providing the largest sample of Biomphalaria species thus far investigated in any phylogenetic study. Our analysis includes all of the important hosts for S. mansoni and wide-ranging species, as well as some of the species which are restricted in range and difficult to obtain.
| Materials and Methods |
|---|
|
|
|---|
Genomic DNA was extracted from 23 Biomphalaria species and from Helisoma trivolvis, primarily using a modification of a cetyl-trimethylammonium bromidebased, mollusc-specific method (Winnepenninckx, Backeljau, and De Wachter 1993
|
Three regions were amplified by PCR from each taxon: mitochondrial rDNA 16S, and nuclear rDNA ITS1 and ITS2 (only ITS2 could be amplified for B. andecola). Primers used to amplify a 416- to 433-nt fragment of Biomphalaria mtDNA 16S (451 nt for H. trivolvis) were 16Sar and 16Sbr (5' CGCCTGTTTATCAAAAACAT 3', 5' CCGGTCTGAACTCAGATCACGT 3'; Palumbi 1996
Sequences were aligned in CLUSTAL X (version 1.81; Thompson et al. 1997
) and adjusted by eye. Unalignable regions were excluded from phylogenetic analyses (PopGen alignment, GenBank; 16S: sites 236264; ITS1: 195303, 415437, 552576; ITS2: 11531195, 12601318, 15571609, 16151648). Sequences for partial 18S and 28S, and complete 5.8S ribosomal units were identical for all taxa (except for one case, discussed later) and were consequently removed from phylogenetic analyses, leaving a total of 1,399 sites in the combined data set.
Congruence of the 16S, ITS1, and ITS2 data sets was evaluated with the incongruence length difference (ILD) test, implemented in PAUP* (Swofford 1998) as the homogeneity partition test, using 1,000 replicates and other options as for maximum parsimony (MP) previously. Invariable sites were removed before the test (Cunningham 1997
).
If incongruent, some authors advocate that data sets should be analyzed separately (Miyamoto and Fitch 1995
), whereas others maintain that they should be combined (Barrett, Donoghue, and Sober 1991
). An alternative viewpoint is that this decision depends on the degree of incongruence (Bull et al. 1993
; de Queiroz, Donoghue, and Kim 1995
). If data sets are weakly incongruent, combining data should disperse noise and increase signal, thus increasing phylogenetic accuracy (de Queiroz, Donoghue, and Kim 1995
), and should in the process uncover the common underlying signal of the data partitions. Although the strongest partition could swamp other partitions (Bull et al. 1993
), this should be less likely in a three-partition analysis. One way to distinguish between true phylogenetic conflict and tree reconstruction artifact is that the latter is suggested by lack of statistical support such as bootstrapping for conflicting topologies (Sullivan 1996
; Baldauf et al. 2000
). We adopted this approach, completing phylogenetic analyses, including bootstrapping, on the three data sets individually, on each pairwise combination (16S + ITS1, 16S + ITS2, and ITS1 + ITS2), and on the three data sets combined.
All phylogenetic analyses were performed using PAUP* 4.0b4 and 4.0b8 for Windows (Swofford 1998
), and trees were visualized in TreeView (Page 1996
). Unweighted MP, minimum evolution (ME), and maximum likelihood (ML) analyses were performed on individual and combined data sets using the heuristic search option, random sequence addition (not allowed for ME), MULPARS on, MAXTREES set to 2,500, and tree-bisectionreconnection branch swapping. Unless otherwise noted, parsimony analyses were completed treating gaps as missing data. In order to see if including gap information had any impact on tree topology or support, two additional parsimony analyses were completed: (1) setting the gapmode option to newstate, and (2) constructing an additional data matrix by coding gap information according to the simple method of Simmons and Ochoterena (2000)
. Minimum evolution analyses used logdet measures of distance. ML analyses utilized the HKY85 model (Hasegawa, Kishino, and Yano 1985
) with rate heterogeneity (HKY85 + I +
; Yang 1994
), chosen by testing models of substitution through likelihood ratio tests (Huelsenbeck and Crandall 1997
), with parameters estimated separately in heuristic searches (simple addition sequence) conducted under each of the models. Four rate categories, as well as the shape parameter
, were estimated in ML trees using the discrete model to approximate the gamma distribution (Yang 1994
). Ten heuristic search repetitions were used for MP and ME, and one repetition for ML. Nodal support was assessed by bootstrap analysis (Felsenstein 1985
), with 1,000 replicates performed for MP and ME analyses and 100 performed for ML.
Likelihood-ratio tests (Felsenstein 1988
) were also used to test that the data collected were consistent with a constant rate Poisson-distributed process of substitution (molecular clock). The ML phylogeny was estimated using the HKY85 + I +
model, and then repeated while constraining the estimate to fit the molecular clock model. These estimates were used to calculate the likelihood-ratiotest statistic
= 2[ln(L0) - ln(L1)], with (n - 1) df (n is the number of taxa in the tree).
We chose as an outgroup H. trivolvis, which like Biomphalaria is a member of the family Planorbidae, and we found most parts of the H. trivolvis sequences to be alignable to Biomphalaria sequences. A close relationship between Helisoma and Biomphalaria is suggested by the histocompatibility studies of Sullivan et al. (1995)
. Additionally, ongoing phylogenetic studies in our laboratory of relationships within the Planorbidae indicate that Helisoma and Biomphalaria are the closest relatives of each other (unpublished data).
| Results |
|---|
|
|
|---|
Sequence Characterization and Pairwise Distances
Within Biomphalaria, there was considerable variation in the length of fragments for all three regions studied, indicating the common occurrence of indels. Sequences of mtDNA 16S had the lowest amount of length variation, with a range of 416433 nt. ITS1 sequences had an extreme amount of length variation, with a range of 548778 nt. The shortest ITS1 lengths were both B. peregrina isolates, which lack large portions of sequence, indicating probable deletion events. One of these deletions was large, approximately 170 nt. Excluding B. peregrina, the length range for ITS1 sequences was substantially smaller, 719778 nt. ITS2 sequences ranged from 403 to 509 nt, but if B. helophila (509 nt) and B. schrammi (462 nt) are excluded, the range is much smaller (403438 nt). Sequence lengths for the outgroup H. trivolvis were 451, 751, and 469 nt for 16S, ITS1, and ITS2, respectively. Species with the larger length differences (B. peregrina, ITS1; B. helophila, and B. schrammi, ITS2) also had substantial numbers of base differences compared with the rest of the Biomphalaria species. Pairwise distances confirm this and show these species to be not only diverged from other Biomphalaria, but also from each other (table 2 ). Additionally, as mentioned earlier, complete 5.8S sequences were identical for almost all Biomphalaria and H. trivolvis, except for B. schrammi which possessed 2 nt differences.
|
Mean base frequencies for each of the three fragments were 34.6% A, 11.9% C, 16.8% G, and 36.7% T for 16S; 21.7% A, 26.8% C, 26.7% G, and 24.8% T for ITS1; 16% A, 28.9% C, 27.5% G, and 27.6% T for ITS2. Likelihood (HKY85 + I +
) estimates of the transition-transversion ratio were low for all three fragments (0.845, 0.855, and 1.361 for 16S, ITS1, and ITS2, respectively), but some closely related taxa, even populations of the same species, had transition/transversion ratios of less than 1.
Phylogenetic Analyses
The data matrix used in phylogenetic analyses consisted of 1,399 total characters per taxon (except B. andecola; 445 were variable, 279 were parsimony informative). An MP tree based on the combined data sets is shown in figure 1
. This tree is one of the 234 shortest trees produced (tree length = 889, consistency index = 0.67, retention index = 0.82, homoplasy index = 0.33), well supported at most nodes by bootstrap analyses, and identical in topology to the ML tree (-ln likelihood = 6,708.45204). The other 233 MP shortest trees differed little in topology, as indicated by the number of nodes that were present in >50% of the trees (numbered nodes indicated in boxes in fig. 1
). Setting gaps as a fifth state or including the coded gap matrix did not change the tree topology significantly (B. helophila and B. peregrina switched positions). Not shown is the ME tree (score = 0.6254) which differs from the MP and ML trees in only two ways: B. camerunensis is the sister group of the Nilotic species complex instead of B. pfeifferi, and the Biomphalaria sp. Cuba + B. andecola + B. prona clade switches places with the B. occidentalis + B. tenagophila clade. In general, bootstrap resampling of the three combined data sets provided strong support for individual nodes (fig. 1
). It should be noted that the position of B. peregrina was not dependent upon the ITS1 deletions. Analyses were done excluding these indel regions, with no change in the position of B. peregrina; also, this taxon's position was similar in 16S and ITS2 analyses for which there were not any large indels of this kind. A summary of bootstrap support values resulting from the analyses of the individual, pairwise combinations and all data sets combined is given in figure 2
. Combined analyses provided more resolution than single data sets, and the three data sets combined provided the maximum resolution and bootstrap support (fig. 2
).
|
|
The results of the homogeneity partition test were 16S and ITS1, P = 0.005; 16S and ITS2, P = 0.025; ITS1 and ITS2, P = 0.768; 16S, ITS1, and ITS2, P = 0.001. These results indicated substantial congruence between ITS1 and ITS2, a result that is not unexpected given that evolutionary constraints on these sequences should be similar. Both are transcribed, but not translated, and function in the formation of rRNA subunits (Schlötterer et al. 1994
The likelihood-ratio test rejected a molecular clock model for the three datasets combined, even when basal taxa with long branch lengths were removed (P < 0.01). However, a molecular clock model was not rejected when 16S and ITS2 data were tested individually (P > 0.10), regardless of whether basal taxa were removed. The ITS1 dataset rejects a molecular clock model (P < 0.01), regardless of whether basal taxa were removed.
| Discussion |
|---|
|
|
|---|
Data Congruence and Tree Reliability
Trees derived from the three data sets combined are probably the most reliable with respect to a number of criteria. First, a high level of similarity in topology existed between trees constructed by the three different phylogenetic methods. At most nodes, the three methods agreed, with high bootstrap support. Agreement among phylogenetic methods was lower in analyses using individual data sets or pairwise combinations (fig. 2 ). Agreement among methods was also evident prior to bootstrap completion, as the majority rule consensus MP and ME trees (not shown) were very similar in topology to each other and to the ML tree. Second, the phylogenetic signal appears to be additive. Analyses of our individual data sets show that there are a few strongly supported conflicts between them; but, in general, combining data improves phylogenetic resolution, as indicated by the improved bootstrap support for nodes (fig. 2 ). Finally, where the lack of bootstrap support by individual and pairwise combined data sets occurs, it is mostly caused by a lack of resolution rather than real phylogenetic conflict. Individual data sets in particular produced consensus bootstrap trees (not shown) with little or no resolution between species in the two species-rich clades. Rather, species and species groups from these clades formed a so-called rake topology. Thus, although the nodes supported in the combined analyses were frequently not supported by individual data sets, neither were they frequently rejected (fig. 2 ).
An increase in the ratio of phylogenetic signal to noise should occur when combining data, if the data sets share a common additive phylogenetic signal. The noise or random data is not likely to be additive. Despite some warning from ILD test results to avoid data combination, the greatest amount of phylogenetic resolution and consistency among phylogenetic methods was obtained when data were combined. Other studies have noted similar results (Baldauf et al. 2000
; Smith 2000
), even with low P values (<0.01) from ILD tests suggesting significant incongruence between data sets (Smith 2000
).
Origin and Diversification of Biomphalaria
Neotropical species are consistently basal to African species in the trees from the three combined data sets (fig. 1
) and in all other trees as well (not shown). This suggests an American origin for the genus, consistent with the oldest fossils occurring in South America (Parodiz 1969
), and with the greater amount of morphological variation in Neotropical species (Mello 1972
). Several additional lines of evidence support an American origin: (1) there are more recognized species in the Neotropics, (2) these species exhibit a greater range in overall size than the African Biomphalaria, and (3) the Neotropical species show greater diversity with respect to S. mansoni susceptibility (at least nine of the 22 species are refractory, whereas all the African species appear to be susceptible). In addition, Neotropical species exhibit much higher amounts of genetic variation than African species, indicating that the Neotropical species are older (table 2
). The existence of North American Oligocene fossils of Biomphalaria raises the possibility that the genus has a North American origin (Morgan et al. 2001
). Its close relative, Helisoma, is a predominately North American genus with few representatives in South America (Paraense 1976
). Phylogenetic study of the Planorbidae, now under way in our laboratory, may help to resolve whether Biomphalaria originated in North or South America.
Multiple Lineages Within Biomphalaria
There are two species-rich groups in the genus, one Neotropical and the other consisting of B. glabrata plus all the African species. Basal to these are four other Neotropical lineages (B. obstructa + Biomphalaria sp. + B. temascalensis, B. helophila, B. peregrina, and B. schrammi) which are not the closest relatives of each other (fig. 1
). The placement of these basal lineages does not appear to be the result of long-branch attraction. These lineages were never clustered together, and all three phylogenetic methods placed them similarly in the tree. Also, analyses were performed with these basal lineages individually removed, with no effects on the topology of the tree (not shown).
The four lineages mentioned above appear to be genetically distant from other Biomphalaria (table 2
and fig. 1
). Biomphalaria schrammi is almost as distantly related from other Biomphalaria as H. trivolvis. This species is also morphologically distinct from other species in the genus (Paraense and Deslandes 1956
) and is not susceptible to S. mansoni (Paraense, Fauran, and Courmes 1964
). A similar phylogenetic position for B. schrammi is observed by Vidigal et al. (2000)
who suggest that B. schrammi is intermediate between H. trivolvis and other Biomphalaria. We note that the genetic distance between B. schrammi and H. trivolvis is approximately the same as that between B. schrammi and other Biomphalaria (table 2
). This suggests that B. schrammi is no more related to Helisoma than to Biomphalaria; it might represent a third distinct genus-level lineage. Our finding that B. schrammi differs by 2 nt in its 5.8S sequence from all other Biomphalaria and from H. trivolvis supports this hypothesis.
The nextmost-basal branches on the tree lead to B. helophila and B. peregrina, which are also somewhat distantly related to other Biomphalaria (table 2
and fig. 2
). Interestingly, although the amount of data is small, both these species have been experimentally infected with S. mansoni (Richards 1963
; Paraense and Corrêa 1973
). The basal position of B. peregrina is independent of the ITS1 deletions in this taxon, and was consistent throughout all analyses (fig. 1
). There is not a discernable geographical pattern among these basal lineages as all three have wide and overlapping distributions. Biomphalaria schrammi is distributed throughout the Caribbean and much of South America (Paraense, Fauran, and Courmes 1964
), B. helophila is distributed in the Caribbean, Central America, and western South America (Paraense 1996
), and B. peregrina is widespread in South America (Paraense 1966
).
Another lineage that is basal to most of the Biomphalaria spp. consists of B. obstructa, Biomphalaria sp. from Zanja Ferrer, Havana, Cuba, and Puerto Rico, and B. temascalensis, which form a group that is consistently and strongly supported in all trees and is quite closely related genetically (table 2
and branch lengths in fig. 1
). The type locality, and hence the description of B. havanensis, is currently in dispute (Paraense and Deslandes 1958
; Yong, Pointier, and Perera 1997
). Our aim here is not to determine the correct type locality, but our analyses do show that there are two distinct species in Cuba that have been linked to the name B. havanensis. The type locality and anatomical description advocated by Yong, Pointier, and Perera (1997)
is represented here by Biomphalaria sp. from Zanja Ferrer, Havana, Cuba. We obtained sequences from other specimens fitting this morphological description from Puerto Rico, Mexico, and the Dominican Republic, and the sequences were almost identical to Biomphalaria sp. Zanja Ferrer. Yong, Pointier, and Perera (1997)
and Yong et al. (2001)
noted that the morphology of Biomphalaria sp. Zanja Ferrer is very similar to B. obstructa (Paraense 1990
) and B. temascalensis (Rangel-Ruiz 1987
), each represented here by specimens from the type locality, so it is not surprising that they grouped together (figs. 1 and 2
). There is clearly a lineage of Caribbean and Central American distribution that is basal to the Neotropical and African clades (fig. 1
).
The type locality from which Paraense and Deslandes (1958)
described specimens as B. havanensis is no longer accessible. Their description differs from that of Yong et al. (1997, 2001)
. Durand et al. (1998)
recognized a Biomphalaria sp. from several locations in Cuba, that was morphologically distinct from B. havanensis of Yong et al. (1997)
and very similar to B. havanensis of Paraense and Deslandes (1958)
. Allozymes convincingly distinguished it from B. havanensis of Yong et al. (1997)
and from B. helophila. Sequences from specimens from two of the locations (Hanabanilla Lake, Guatao) reported by Durand et al. (1998)
were examined and found to be identical, so only the Hanabanilla Lake specimen was used in the analyses. Biomphalaria sp. from Hanabanilla Lake is clearly distinct from Biomphalaria sp. Zanja Ferrer, and belongs firmly in the species-rich Neotropical clade (discussed later), although it does not have strong affinities for any group within the clade. On the basis of the disparate phylogenetic positions of specimens from Hanabanilla Lake and Zanja Ferrer, the use of the term, B. havanensis complex (Durand et al. 1998
; Yong et al. 2001
), to refer to Biomphalaria spp. from Cuba should be discontinued.
The susceptibility status of B. obstructa and B. havanensis should also be viewed with caution. Several investigators have attempted to infect B. obstructa from various geographic locations without success (Basch 1976
). Biomphalaria havanensis has been reported to be susceptible on multiple occasions (Basch 1976
), but past and continued confusion over its identity makes interpretation of these records difficult.
Species-rich Neotropical Clade
A derived Neotropical clade containing nine species was strongly supported by bootstrap values (Node 26; figs. 1 and 2
), but some relationships of subgroups within the clade were not. Nodes 20 and 23 were the least supported of all the nodes in the tree and were in fact rejected in a few analyses (figs. 1 and 2
). The most strongly supported group in the clade was B. straminea, B. kuhniana, and B. intermedia (Node 17; fig. 2
). These species comprise a previously recognized B. straminea complex based on morphological similarities (Paraense 1988
). Biomphalaria straminea is the exclusive intermediate host involved in natural transmission of S. mansoni in parts of northeast Brazil, despite low susceptibility (Barbosa and Figueiredo 1970
; Paraense and Corrêa 1989
), but B. intermedia is considered refractory to infection (Floch and Fauran 1954
; Malek 1985
). The susceptibility status of B. kuhniana is uncertain because although it was previously considered refractory (Floch and Fauran 1954
), the naturally infected snails in Venezuela identified as B. straminea (de Noya et al. 1999
) are perhaps B. kuhniana. In the analyses of the three combined data sets, the two B. straminea isolates did not cluster with each other. The population from northern Brazil (B. straminea PA) clustered with B. kuhniana, but the population from southern Brazil (B. straminea SP) clustered with B. intermedia (figs. 1 and 2
). This result appears to be entirely derived from the 16S data set as the two B. straminea populations clustered together and formed the sister group of B. kuhniana when ITS1 and ITS2 were analyzed individually or together (Node 16 is rejected by these analyses; fig. 2
). This was the most dramatic conflict among our data sets. It is possible that the close relationship among these species allows some hybridization, which could result in conflict between nuclear and maternally inherited mitochondrial sequences. Interspecific mitochondrial gene flow via hybridization has been reported in various groups of animals, including snails (Shimizu and Ueshima 2000
). Hybridization is known, but not well understood, between Biomphalaria species (Mello-Silva et al. 1998
). Vidigal et al. (2000)
also noted the tendency of a northern population of B. straminea to cluster with B. intermedia. Clearly, the relationships within this group are complex and await further resolution. In addition, our report of B. kuhniana from Dominica, whose identification was confirmed here by sequence analysis, is the first record for this species from any Caribbean island.
The closest relative of the B. straminea complex appears to be B. amazonica (fig. 1
). Vidigal et al. (2000)
also found these species to cluster together. Biomphalaria amazonica is susceptible to S. mansoni (Corrêa and Paraense 1971
; Paraense and Corrêa 1985
). A previously unidentified specimen, designated as Biomphalaria sp., from Bolivia, appears to be B. amazonica, on the basis of sequence data, and thus extends the known range of this species (western Brazil; Paraense and Corrêa 1985
) to include eastern Bolivia.
Other well-supported groups in the Neotropical clade include B. occidentalis with B. tenagophila and B. prona with B. andecola (fig. 2
). Biomphalaria tenagophila and B. occidentalis have been previously recognized as very similar by morphological study (Paraense 1981
), as well as by low-stringency PCR and RFLP (Pires et al. 1997
; Spatz et al. 1999
). The similarity between these two species is curious nonetheless because B. tenagophila is susceptible to some strains of S. mansoni (Paraense and Corrêa 1981
) and is important in natural transmission in southern Brazil (Paraense and Corrêa 1963
), whereas B. occidentalis is completely refractory to the S. mansoni isolates that have been tested so far (Paraense and Corrêa 1982
). Although the similarity between B. prona and B. andecola has not been noted before, they are alike in the following: (1) both are found in large lakes (Lake Valencia and Lake Titicaca, respectively) and in the surrounding areas (Paraense and Deslandes 1957
; Paraense et al. 1992
), although B. andecola is also reported from streams in Chile (Malek 1985
); and (2) both share a shell whorl that usually increases rapidly in width, although both species exhibit variation in this regard (Malek 1985
; Paraense et al. 1992
). Biomphalaria prona has been found naturally infected with S. mansoni in Venezuela, but its degree of susceptiblity or how large a role it plays in natural transmission is not known (de Noya et al. 1999
).
How did the species in this diverse clade arise? Campbell et al. (2000)
suggested that repeated rain forest fragmentation and coalescence caused by glacial cycles may have encouraged population differentiation and speciation, beginning in the Quaternary, 2.52.6 MYA. As the degree of forest fragmentation caused by aridity occurring during glacial maxima is currently debated (Colinvaux 1997
), other forces, such as marine incursions during glacial minima (Lovejoy, Bermingham, and Martin 1998
) and dramatic changes in drainages (Hoorn et al. 1995
), should also be considered. Facultative self-fertilization was probably also an important factor in the evolution of this group.
Ancestor of B. glabrata Colonized Africa and Gave Rise to African Fauna
One of the best-supported nodes in all the trees (Node 13; figs. 1 and 2 ) confirms the African affinity of B. glabrata, first noticed by Bandoni, Mulvey, and Loker (1995)
using allozyme data and confirmed by Woodruff and Mulvey (1997)
using allozymes and by Campbell et al. (2000)
using DNA sequences. Our data do not support the hypothesis, however, that B. glabrata is derived from African stock and colonized the Neotropics via the slave trade or through an earlier event (Woodruff and Mulvey 1997
). Rather, our data, including four African species not studied previously, agree with Campbell et al. (2000)
that an ancestor of B. glabrata colonized the African continent and gave rise to the African species.
Given that the mean ITS2 sequence divergence between B. glabrata and the African species is 1.7% and that the substitution rates for invertebrate ITS sequences range from 0.4% to 1.2%/Myr (Schlötterer et al. 1994
; Bargues et al. 2000
; Wares 2001
), it is estimated that the colonization of Africa occurred approximately 1.44.3 MYA, in the Pliocene to early Pleistocene. Substitution rate estimates for 16S sequences in invertebrates have a rather wide range (0.1%2.2%; Cunningham et al. 1992
; Romano and Palumbi 1997
). Using the upper range of the divergence rates for invertebrates (1.6%2.2%/Myr, Cunningham et al. 1992
; Patarnello et al. 1996
) and given the 6.4% mean divergence between B. glabrata and the African species, an estimate of 2.94.0 MYA is calculated for the colonization of Africa. These are similar to previous estimates (2.34.5 MYA, Woodruff and Mulvey 1997
; 1.83.6 MYA, Campbell et al. 2000
). The B. glabrata-African split may overestimate the timing of the colonization event, especially as B. glabrata shows some divergence between populations. A minimum age can be estimated using the mean sequence divergences between the African species because all African species have arisen since the colonization (1.62.2 and 1.13.2 MYA for 16S and ITS2, respectively).
These dates correspond well to the fossil record, for there are ancient Biomphalaria fossils in South America (Paleocene, 5565 MYA; Parodiz 1969
), as well as in other continents, but not in Africa despite a very rich and well-studied fauna of fossil molluscs (Van Damme, personal communication). In fact, the oldest fossil of Biomphalaria in Africa may be as recent as 0.255 MYA (Van Damme, personal communication). We calibrated the B. glabrata-African divergence with this date, but the rates of substitution derived are nearly an order of magnitude greater than those known for these sequences (25.2%/Myr and 6.7%/Myr for 16S and ITS2, respectively). Thus, a slightly earlier colonization is more likely in the Plio-Pleistocene. In geologic time, this is still a recent event, and both morphological data (Mello 1972
) and the genetic data presented here are consistent with this idea (table 2
and branch lengths in fig. 1
).
The mode of transport by which a proto-B. glabrata may have completed a west-to-east trans-Atlantic dispersal is presumed to have been as tiny neonate snails embedded in the feathers of aquatic birds or as eggs, neonates, or adults aboard Amazonian vegetation rafts. Woodruff and Mulvey (1997)
and Wesselingh, Cadée, and Renema (1999)
provide excellent discussions on this topic. Hermaphroditism and the ability of adults to aestivate may have facilitated colonization. This is not to say that colonizations were frequent, rather that they were rare. There is no indication of multiple events; no other Neotropical species exhibits any affinity with African species on the basis of sequence data.
Biogeography of African Species
Despite a relatively recent history for African Biomphalaria, these species exhibit interesting biogeographical patterns. The most important host for S. mansoni, B. pfeifferi has the most widespread distribution, found throughout the tropical middle of the continent and in Madagascar and Arabia. It is known from Pleistocene and Holocene fossils in the Sahara as well. There is a small amount of genetic difference between populations (0.290.50%, using all the data), showing that there is some genetic isolation of populations. Further investigation is needed to see what kind of genetic structure exists across populations, using a more variable marker than that employed here. Additionally, our data show that B. stanleyi from Lake Albert is derived from B. pfeifferi. One interpretation is that B. stanleyi is merely a lacustrine form of B. pfeifferi; it is no more differentiated from B. pfeifferi populations (genetic differences of 0.140.35%) than B. pfeifferi populations are from each other. Biomphalaria stanleyi has also been described from Lake Chad in sub-Saharan Africa and Lake Cohoha in Burundi (Brown 1994
), and it would be interesting to obtain specimens from these locations to determine whether B. pfeifferi has colonized large lakes once or multiple times. Similarly, there is within the African clade a poorly differentiated Nilotic species complex (B. alexandrina, B. choanomphala, B. smithi, and B. sudanica; genetic differences of 0.140.58%), species which primarily inhabit the Nile basin but which have also invaded some of the great lakes in the Nile drainage. An endemic of Lake Victoria and several Rift Valley lakes, B. choanomphala, may be regarded as a lacustrine form of B. sudanica. Another lacustrine form is B. smithi, an endemic of Lake Edward, but its status relative to either B. alexandrina or B. sudanica is not clear as it has a basal position in the Nilotic complex (fig. 1
). All three lacustrine species in the present study (B. choanomphala, B. smithi, and B. stanleyi), as well as other rare, African lacustrine species, share a common conchological feature: a rapid widening of the shell whorl (Brown 1994
). As it has occurred in two separate African lineages, it appears to be a convergent feature induced or selected for by lacustrine environments.
A Nilotic distribution is best illustrated by B. alexandrina, but with the following peculiarities. This species has historically been confined to the Nile Delta in Egypt, one location in Libya and in the Sudan between Khartoum and Kosti (Brown 1994
). In recent decades, however, it has colonized the Egyptian Nile from the Delta (Vrijenhoek and Graven 1992
). Its close relative (fig. 1
), B. sudanica, is also present in the Nile drainage, in the Sudan and southwards (Brown 1994
). Although the genetic distances are small and more study is needed, the branching order in our tree suggests that previous colonizations may have taken place in a southerly direction, with B. alexandrina giving rise to B. sudanica. Also, it is curious that colonization could occur in a predominantly upstream direction.
The final member of the Africa group is B. camerunensis, the position of which is not clear: sometimes it is the sister group of B. pfeifferi, and sometimes it is the sister group of the Nilotic species. Here again, there appears to be some conflict between nuclear ITS and mitochondrial 16S data (fig. 2
). This species is unique in that it is primarily a rain forest species occurring in western Central Africa (Greer et al. 1990
).
Biomphalaria glabrata Is a Diverse Species
Four B. glabrata populations formed a monophyletic group with 100% bootstrap support (fig. 1
), including one population (B. glabrata Salvador, Brazil) that is resistant to S. mansoni. Populations from the Caribbean islands of Hispaniola and Puerto Rico clustered together (fig. 1
), suggesting that the colonization of these two islands occurred from the same source population or that an initial colonization of one of these islands led to subsequent island-to-island colonization. There was a substantial amount of genetic variation among the four populations (0.291.38%), in agreement with Woodruff and Mulvey (1997)
who commented that B. glabrata was either the most genetically diverse mollusc species yet described or a complex of more than three species. As B. glabrata populations form a monophyletic assemblage in all our trees, we suggest that the species is valid but that experimental studies involving B. glabrata should be wary of geographical variation.
Susceptibility to S. mansoni
All the most susceptible hosts for S. mansoni are found in a single clade: B. glabrata + African species. Pragmatically speaking, assuming that all African species belong in this clade, the three African species not yet tested for susceptibility, B. barthi, B. rhodesiensis, and B. tchadiensis, are probably also susceptible.
From the standpoint of host-parasite coevolution, there are two ways to view this susceptible clade. One is that the characteristics that rendered proto-B. glabrata susceptible appear to have been retained throughout the African taxa and also in modern B. glabrata. However, it is the parasite which is under pressure to adapt to changing snail taxa; the snails are likely to be under no pressure to retain susceptibility and, if anything, might be under pressure to evolve resistance. Thus, susceptibility in African taxa might also be the result of the continuous opportunity the parasite has had to adapt to the various African lineages. These viewpoints are not necessarily mutually exclusive, and both are probably validly used to describe what has occurred on the African continent between Schistosoma and Biomphalaria. An African schistosome, part of an already present schistosome fauna, acquired Biomphalaria as an additional host, eventually lost the ability to use its ancestral snail host, and diverged from other African schistosomes. It is likely that part of this process was the improvement in compatibility over time as the parasite adjusted to the snail. This can be regarded as fine-tuning by the parasite. As Biomphalaria differentiated into the current lineages in Africa, exploitation of these hosts was possible because of the small amount of genetic differentiation between them (table 2 ), and because of the ability of the parasite to fine-tune to new and evolving snail lineages.
It is also relevant to consider that Biomphalaria are exploited by many digenetic trematode species in addition to S. mansoni. Although their digenean fauna is poorly characterized (especially in South America), Biomphalaria are known to host at least 20 species in the Neotropics (Nasir 1980
) and about 30 species in Africa (Loker, Moyo, and Gardner 1981
). It seems likely that most African digeneans (a few species that use birds as definitive hosts may be global in distribution) encountered Biomphalaria only after it arrived in Africa. The ability to establish rapidly in Biomphalaria was obviously not limited to S. mansoni.
Our data, including six additional Neotropical and four additional African Biomphalaria, confirm previous studies (Woodruff and Mulvey 1997
; Campbell et al. 2000
) that show that the colonization of the New World by S. mansoni (Desprès, Imbert-Establet, and Monnerot 1993
) was successful because B. glabrata was more closely related to the African species than to its Neotropical counterparts (table 2
). The initial compatibility between them is unknown, but it was high enough so that the parasite rapidly became widely established in its new hemisphere. The high susceptibility presently exhibited by most B. glabrata may also be in part caused by subsequent fine-tuning by S. mansoni.
An interesting finding is the degree to which basal lineages in the tree include susceptible species (B. helophila and B. peregrina), especially considering the large genetic distances between them and other Biomphalaria as well as between each other (table 2
). Susceptibility, at least weak susceptibility, does not therefore appear to be dependent upon long association with S. mansoni, as the parasite has only been in the New World for a few centuries. Paraense and Corrêa (1973)
found B. peregrina from Ecuador to be susceptible, but S. mansoni has never occurred there. It is likely that the susceptibility of Biomphalaria is determined by a suite of genetic factors which combine and interact to render a species potentially susceptible, and if this suite is similar enough to previous suites the parasite has associated with, infection can occur. High susceptibility might occur only after the parasite adapts to this suite through time. This is concordant with what is known regarding the compatibility between S. mansoni and Biomphalaria: it is a complex interaction and is genetically controlled (Richards, Knight, and Lewis 1992
). The weak susceptibility of basal lineages suggests that there are ancestral features retained in at least some (if not all) species of Biomphalaria that are keyed in on by S. mansoni. However, these features appear to be unique to Biomphalaria because the genus Helisoma, including the outgroup used in this study, H. trivolvis, is refractory to S. mansoni (Brown 1994
).
Features contributing to susceptibility appear to have been obscured in the clade of nine Neotropical species (fig. 1
), which is the least susceptible major lineage. Yet, there are susceptible species within the clade, suggesting that such features were not totally lost (fig. 1
). Of particular interest are B. straminea and B. tenagophila, which are exclusive vectors of the parasite in particular areas of Brazil, even though they are not highly susceptible (Paraense and Corrêa 1981, 1989
). The acquisition of these species as hosts must have occurred after the onset of the slave trade. Paraense and Corrêa (1963, 1987)
noted that A. Lutz was unable to infect B. tenagophila during his pioneering work on Brazilian schistosomiasis in 1916. The parasite has apparently adapted to this snail species since that time, for B. tenagophila is now a moderately efficient host in southeastern Brazil. Similarly, S. mansoni has adapted to B. straminea in the northeast part of the country. The acquisition of new intermediate host species has been accompanied by the differentiation of isolates of S. mansoni (Paraense and Corrêa 1963, 1981
). Moreover, these were two separate acquisitions as B. straminea and B. tenagophila are not the closest relatives of each other, and both species are closely related to the refractory species (B. straminea to B. intermedia, and B. tenagophila to B. occidentalis; fig. 1
). Continued adaptation by S. mansoni is probable, both in the form of increased compatibility with current hosts (B. straminea appears to be still especially poor) and in the adoption of new hosts in this clade. Indeed, another species within this clade, B. amazonica, is susceptible, though it has never been implicated in natural transmission (Corrêa and Paraense 1971
; Paraense and Corrêa 1985
).
Finally, the close relationships between susceptible and refractory taxa, such as those mentioned above (B. straminea with B. intermedia and B. tenagophila with B. occidentalis; fig. 1 ), demonstrate that the changes in the genetic suite affecting susceptibility are not necessarily accompanied by large morphological differences or by genetic isolation. The overall pattern of susceptibility appearing and disappearing in the species tree is continued within a species on a population scale as well. The most susceptible species, B. glabrata, includes populations that vary considerably in susceptibility, including a naturally resistant population from Salvador, Brazil.
Insights into the Future and Control of S. mansoni
The results of this study highlight the remarkable ability of S. mansoni to adapt to Biomphalaria snails, and this should be a point of concern as it could facilitate the spread of S. mansoni. The continued acquisition of new Neotropical hosts will be favored by peripatry of Biomphalaria species. In addition, one of the recently acquired species, B. straminea, shows an exceptional ability to spread, probably aided by human activity, and has established in Hong Kong (Meier-Brook 1974
) and in the Caribbean (Pointier, Paraense, and Mazille 1993
). Compatibility with newly acquired hosts may also increase through time.
Future efforts should be made to incorporate the rarer species of Biomphalaria, to gain further insight into the patterns of susceptibility and resistance and to ensure that our understanding of the intercontinental relationships within the genus are correct. Some unstudied species may be discovered to be close relatives of the already susceptible species, identifying them as potential future intermediate hosts.
| Acknowledgements |
|---|
|
|
|---|
We thank Jenny Brown, Angela Costanza, August Goodman, Crystal Gonzalez, Nicole Ruple, and Lynn Hertel for technical assistance. We gratefully acknowledge the assistance of Ben Mungai, Joseph Kinuthia, and Geoffrey Maina in Kenya, and André Théron and Adrian Pointer for logistic support in Guadeloupe and Dominica, respectively. Thomas Turner and John Wares provided insightful discussions. Our thanks are due to the UNM Biology Molecular Biology Facility and to George Rosenberg for sequencing facilities and assistance. We are grateful for the loan of specimens from the University of Florida Museum of Natural History and to Fred Thompson, Curator, for his assistance. The Director of Kenya Medical Research Institute is thanked for permission to publish this paper. This project was supported by NIH grant AI44913.
| Footnotes |
|---|
Mark Ragan, Reviewing Editor
Keywords: Biomphalaria
Schistosoma mansoni,
biogeography
phylogeny
snails
data congruence ![]()
Address for correspondence and reprints: Eric S. Loker, Department of Biology, University of New Mexico, Albuquerque, New Mexico 87131. esloker{at}unm.edu
. ![]()
| References |
|---|
|
|
|---|
Baldauf S. L., A. J. Roger, I. Wenk-Siefert, W. F. Doolittle, 2000 A kingdom-level phylogeny of eukaryotes based on combined protein data Science 290:972-977
Bandoni S. M., M. Mulvey, E. S. Loker, 1995 Phylogenetic analysis of eleven species of Biomphalaria Preston, 1910 (Gastropoda: Planorbidae) based on comparisons of allozymes Biol. J. Linn. Soc 54:1-27
Barbosa F. S., T. Figueiredo, 1970 Susceptibility of the snail intermediate hosts of schistosomiasis from northeastern Brazil to the infection with Schistosoma mansoni. Rev. Inst. Med. Trop. São Paulo 12:198-206[Medline]
Bargues M. D., A. Marcilla, J. M. Ramsey, J. P. Dujardin, C. J. Schofield, S. Mas-Coma, 2000 Nuclear rDNA-based molecular clock of the evolution of the Triatominae (Hemiptera: Reduviidae), vectors of Chagas disease Mem. Inst. Oswaldo Cruz 95:567-573[Web of Science][Medline]
Barrett M., M. J. Donoghue, E. Sober, 1991 Against consensus Syst. Zool 40:486-493
Basch P. F., 1976 Intermediate host specificity in Schistosoma mansoni. Exp. Parasitol 39:150-169[Web of Science][Medline]
Brown D. S., 1994 Freshwater snails of Africa and their medical importance. 2nd edition Taylor and Francis, London
Bull J. J., J. P. Huelsenbeck, C. W. Cunningham, D. L. Swofford, P. J. Waddell, 1993 Partitioning and combining data in phylogenetic analysis Syst. Biol 42:384-397[Web of Science]
Campbell G., C. S. Jones, A. E. Lockyer, S. Hughes, D. Brown, L. R. Noble, D. Rollinson, 2000 Molecular evidence supports an African affinity of the Neotropical freshwater gastropod, Biomphalaria glabrata, Say 1818, an intermediate host for Schistosoma mansoni. Proc. R. Soc. Lond. Ser. B Biol 267:2351-2358
Chitsulo L., D. Engels, A. Montresor, L. Savioli, 2000 The global status of schistosomiasis and its control Acta Trop 77:41-51[Web of Science][Medline]
Colinvaux P. A., 1997 An arid Amazon? Trends Ecol. Evol 12:318-319
Corrêa L. R., W. L. Paraense, 1971 Susceptibility of Biomphalaria amazonica to infection with two strains of Schistosoma mansoni. Rev. Inst. Med. Trop. São Paulo 13:387-390[Medline]
Cox C. B., 2000 Plate tectonics; seaways and climate in the historical biogeography of mammals Mem. Inst. Oswaldo Cruz 95:509-516[Web of Science][Medline]
Crompton D. W. T., 1999 How much human helminthiasis is there in the world? J. Parasitol 85:397-403[Medline]
Cunningham C. W., 1997 Can three incongruence tests predict when data should be combined? Mol. Biol. Evol 14:733-740[Abstract]
Cunningham C. W., N. W. Blackstone, L. W. Buss, 1992 Evolution of king crabs from hermit crab ancestors Nature 355:539-542[Medline]
Davis G. M., 1980 Snail hosts of Asian Schistosoma infecting man: evolution and coevolution Malacol. Rev. (Suppl. 2):195238
. 1992 Evolution of prosobranch snails transmitting Asian Schistosoma; coevolution with Schistosoma: a review Prog. Clin. Parasitol 3:145-204
de Noya B. A., C. Balzan, C. Arteaga, I. Cesari, O. Noya, 1999 The last fifteen years of schistosomiasis in Venezuela: features and evolution Mem. Inst. Oswaldo Cruz 94:139-146
de Queiroz A. D., M. J. Donoghue, J. Kim, 1995 Separate versus combined analysis of phylogenetic evidence Annu. Rev. Ecol. Syst 26:657-681[Web of Science]
Desprès L., D. Imbert-Establet, M. Monnerot, 1993 Molecular characterization of mitochondrial DNA provides evidence for the recent introduction of Schistosoma mansoni into America Mol. Biochem. Parasitol 60:221-230[Web of Science][Medline]
Durand P., M. Yong, G. Perera, A. Ducreux, J. P. Pointier, 1998 Genetic evidence of two species in the Biomphalaria havanensis complex (Gastropoda: Planorbidae) from Cuba Acta Trop 71:179-188[Web of Science][Medline]
Felsenstein J., 1985 Confidence limits on phylogenies: an approach using the bootstrap Evolution 39:783-791[Web of Science]
. 1988 Phylogenies from molecular sequences: inference and reliability Annu. Rev. Genet 22:521-565[Web of Science][Medline]
Fletcher M., P. T. LoVerde, D. S. Woodruff, 1981 Genetic variation in Schistosoma mansoni: enzyme polymorphisms in populations from Africa, Southwest Asia, South America, and the West Indies Am. J. Trop. Med. Hyg 30:406-421
Floch H., P. Fauran, 1954 Essais infructueux d'infection expérimentale de Tropicorbis kuhnianus (Clessin) par Schistosoma mansoni. Bull. Soc. Pathol. Exot 47:452-459
Greer G. J., R. Mimpfoundi, E. A. Malek, A. Joky, E. Ngonseu, R. C. Ratard, 1990 Human schistosomiasis in Cameroon. II. Distribution of the snail hosts Am. J. Trop. Med. Hyg 42:573-580
Hasegawa M., H. Kishino, T. Yano, 1985 Dating the ape-human split by a molecular clock of mitochondrial DNA J. Mol. Evol 22:160-174[Web of Science][Medline]
Hillis D. M., 1996 Inferring complex phylogenies Nature 383:130-131[Medline]
Hoorn C., J. Guerrero, G. A. Sarmiento, M. A. Lorente, 1995 Andean tectonics as a cause for changing drainage patterns in Miocene northern South America Geology 23:237-240
Huelsenbeck J. P., K. A. Crandall, 1997 Phylogeny estimation and hypothesis testing using maximum likelihood Annu. Rev. Ecol. Syst 28:437-466[Web of Science]
Loker E. S., H. G. Moyo, S. L. Gardner, 1981 Trematode-gastropod association in nine non-lacustrine habitats in the Mwanza region of Tanzania Parasitology 83:381-399[Web of Science]
Lovejoy N. R., E. Bermingham, A. P. Martin, 1998 Marine incursion into South America Nature 396:421-422
Malek E. A., 1985 Snail hosts of schistosomiasis and other snail-transmitted diseases in tropical America: a manual Pan American Health Organization Scientific Publication No. 478. PAHO, Washington
Meier-Brook C., 1974 A snail intermediate host of Schistosoma mansoni introduced into Hong Kong Bull. WHO 15:661
Mello D. A., 1972 The comparative morphology of the genital system of some African species of Biomphalaria (Mollusca, Planorbidae) Rev. Bras. Biol 32:443-450
Mello-Silva C. C., C. E. Grault, V. A. da Costa, F. S. Barbosa, 1998 Possible hybridization of Brazilian planorbid snails and its importance in population dynamics Mem. Inst. Oswaldo Cruz 93:227-232
Miyamoto M. M., W. M. Fitch, 1995 Testing species phylogenies and phylogenetic methods with congruence Syst. Biol 44:64-76
Morgan J. A. T., R. J. DeJong, S. D. Snyder, G. M. Mkoji, E. S. Loker, 2001 Schistosoma mansoni and Biomphalaria: past history and future trends Parasitology (in press)
Nasir P., 1980 Freshwater larval trematodes. XXXV. Biomphalarians as host of larval digeneansan outline Riv. Parassitol 41:451-460
Omland K. E., S. M. Lanyon, S. J. Fritz, 1999 A molecular phylogeny of the new world orioles (Icterus): the importance of dense taxon sampling Mol. Phylogenet. Evol 12:224-239[Web of Science][Medline]
Page R. D., 1996 TreeView: an application to display phylogenetic trees on personal computers Comput. Appl. Biosci 12:357-358
Palumbi S. R., 1996 Nucleic acids II: the polymerase chain reaction Pp. 205248 in D. M. Hillis, C. Moritz, and B. K. Mable, eds. Molecular systematics. Sinauer, Sunderland, Mass
Paraense W. L., 1966 The synonymy and distribution of "Biomphalaria peregrina" in the Neotropical region Rev. Bras. Biol 26:269-296
. 1976 Helisoma trivolvis and some of its synonyms in the Neotropical region (Mollusca: Planorbidae) Rev. Bras. Biol 36:187-204
. 1981 Biomphalaria occidentalis sp. n. from South America (Mollusca Basommatophora Pulmonata) Mem. Inst. Oswaldo Cruz 76:199-211[Medline]
. 1988 Biomphalaria kuhniana (Clessin, 1883), planorbid mollusc from South America Mem. Inst. Oswaldo Cruz 83:1-12
. 1990 Biomphalaria obstructa (Morelet, 1849): a study of topotypic specimens (Mollusca: Pulmonata: Planorbidae) Mem. Inst. Oswaldo Cruz 85:391-399
. 1996 Neotropical planorbid snails with apertural lamellae. I. Biomphalaria helophila (Orbigny, 1835) Mem. Inst. Oswaldo Cruz 91:177-186[Web of Science][Medline]
Paraense W. L., L. R. Corrêa, 1963 Susceptibility of Australorbis tenagophilus to infection with Schistosoma mansoni. Rev. Inst. Med. Trop. São Paulo 5:23-29[Medline]
. 1973 Susceptibility of Biomphalaria peregrina from Brazil and Ecuador to two strains of Schistosoma mansoni. Rev. Inst. Med. Trop. São Paulo 15:127-130[Medline]
. 1981 Observations on two biological races of Schistosoma mansoni. Mem. Inst. Oswaldo Cruz 76:287-291[Medline]
. 1982 Unsusceptibility of Biomphalaria occidentalis to infection with a strain of Schistosoma mansoni. Mem. Inst. Oswaldo Cruz 77:55-58[Medline]
. 1985 Further experiments on susceptibility of Biomphalaria amazonica to Schistosoma mansoni. Mem. Inst. Oswaldo Cruz 80:259-262[Medline]
. 1987 Probable extension of schistosomiasis mansoni to southernmost Brazil Mem. Inst. Oswaldo Cruz 82:577[Medline]
. 1989 A potential vector of Schistosoma mansoni in Uruguay Mem. Inst. Oswaldo Cruz 84:281-288[Web of Science][Medline]
Paraense W. L., N. Deslandes, 1956 Observations on "Australorbis janeirensis" (Clessin, 1884) Rev. Bras. Biol 16:81-102
. 1957 "Taphius pronus" (Martens, 1873) Rev. Bras. Biol 18:367-373
. 1958 Observations on "Taphius havanensis" (Pulmonata, Planorbidae) Rev. Bras. Biol 18:87-91
Paraense W. L., P. Fauran, E. Courmes, 1964 Observations sur la morphologie, la taxonomie, la répartition géographique et les gites d'Australorbis schrammi. Bull. Soc. Pathol. Exot 57:1,236-1,254
Paraense W. L., J. P. Pointier, B. Delay, A. F. Pernot, R. N. Incani, C. Balzan, P. Chrosciechowski, 1992 Biomphalaria prona (Gastropoda: Planorbidae): a morphological and biochemical study Mem. Inst. Oswaldo Cruz 87:171-179
Parodiz J. J., 1969 The Tertiary non-marine Mollusca of South America Ann. Carnegie Mus 40:1-242
Patarnello T., L. Bargelloni, V. Varotto, B. Battaglia, 1996 Krill evolution and the Antarctic ocean currents: evidence of vicariant speciation as inferred by molecular data Mar. Biol 126:603-608[Web of Science]
Pierce H. G., 1993 The nonmarine mollusks of the Late Oligocene-Early Miocene cabbage patch fauna of western Montana III. Aquatic mollusks and conclusions J. Paleontol 67:980-993[Abstract]
Pilsbry H. A., 1911 Non-marine mollusca of Patagonia Report of the Princeton University Expedition to Patagonia, Pp. 18961899
Pires E. R., T. H. D. A. Vidigal, H. M. S. Teles, A. J. G. Simpson, O. S. Carvalho, 1997 Specific identification of Biomphalaria tenagophila and Biomphalaria occidentalis populations by the low stringency polymerase chain reaction Mem. Inst. Oswaldo Cruz 92:101-106
Pointier J. P., W. L. Paraense, V. Mazille, 1993 Introduction and spreading of Biomphalaria straminea (Dunker, 1848) (Mollusca, Pulmonata, Planorbidae) in Guadeloupe, French West Indies Mem. Inst. Oswaldo Cruz 88:449-455
Preston H. B., 1910 Additions to the non-marine molluscan fauna of British and German East Africa and Lake Albert Edward Ann. Mag. Nat. Hist. 8th Series 6:526-536
Rangel-Ruiz L. J., 1987 Biomphalaria temascalensis, sp nov. (Pulmonata: Planorbidae) en Temascal, Oaxaca, Mexico Univ. Ciencia 4:25-34
Richards C. S., 1963 Infectivity of Schistosoma mansoni for Puerto Rican mollusks, including a new potential intermediate host Am. J. Trop. Med. Hyg 12:26-33
Richards C. S., M. Knight, F. A. Lewis, 1992 Genetics of Biomphalaria glabrata and its effects on the outcome of Schistosoma mansoni infection Parasitol. Today 8:171-174[Web of Science][Medline]
Romano S. L., S. R. Palumbi, 1997 Molecular evolution of a portion of the mitochondrial 16S ribosomal gene region in scleractinian corals J. Mol. Evol 45:397-411[Web of Science][Medline]
Schlötterer C., M.-T. Hauser, A. von Haeseler, D. Tautz, 1994 Comparative evolutionary analysis of rDNA ITS regions in Drosophila Mol. Biol. Evol 11:513-522[Abstract]
Shimizu Y., R. Ueshima, 2000 Historical biogeography and interspecific mtDNA introgression in Euhadra peliomphala (the Japanese land snail) Heredity 85:84-96
Simmons M. P., H. Ochoterena, 2000 Gaps as characters in sequence-based phylogenetic analyses Syst. Biol 49:369-381[Web of Science][Medline]
Smith J. F., 2000 Phylogenetic signal common to three data sets: combining data which initially appear heterogeneous Plant Syst. Evol 221:179-198
Snyder S. D., E. S. Loker, D. Johnston, D. Rollinson, 2001 The Schistosomatidae: advances in phylogenetics and genomics Pp. 194200 in D. T. J. Littlewood and R. A. Bray, eds. Interrelationships of Platyhelminthes. Taylor and Francis, London
Spatz L., T. H. D. A. Vidigal, R. L. Caldeira, E. D. Neto, S. M. G. Cappa, O. S. Carvalho, 1999 Study of Biomphalaria tenagophila tenagophila, B. t. guaibensis and B. occidentalis by polymerase chain reaction amplification and restriction enzyme digestion of the ribosomal RNA intergenic spacer regions J. Molluscan Stud 65:143-149
Sullivan J., 1996 Combining data with different distributions of among-site rate variation Syst. Biol 45:375-380[Web of Science]
Sullivan J. T., S. R. Brammer, C. D. Hargraves, B. S. Owens, 1995 Heterotropic heart-transplants in Biomphalaria glabrata (Mollusca: Pulmonata): fate of xenografts from 7 pulmonate genera Invertebr. Biol 114:151-160
Swofford D. L., 1998 PAUP*: phylogenetic analysis using parsimony (*and other methods). Version 4.0b4 Sinauer, Sunderland, Mass
Taylor D. W., 1988 Aspects of freshwater mollusc ecological biogeography Palaeogeogr. Palaeoclimateol. Palaeoecol 62:511-576
Thompson J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, D. G. Higgins, 1997 The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 25:4876-4882
Truett G. E., P. Heeger, R. L. Mynatt, A. A. Truett, J. A. Walker, M. L. Warman, 2000 Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and Tris (HotSHOT) Biotechniques 29:52-54[Web of Science][Medline]
Vidigal T. H. D. A., J. C. Kissinger, R. L. Caldeira, E. C. R. Pires, E. Monteiro, A. J. G. Simpson, O. S. Carvalho, 2000 Phylogenetic relationships among Brazilian Biomphalaria species (Mollusca: Planorbidae) based upon analysis of ribosomal ITS2 sequences Parasitology 121:611-620
Vrijenhoek R. C., M. A. Graven, 1992 Population genetics of Egyptian Biomphalaria alexandrina (Gastropoda, Planorbidae) J. Hered 83:255-261
Wares J. P., 2001 Biogeography of Asterias: North Atlantic climate change and speciation Biol. Bull. (in press)
Wesselingh F. P., G. C. Cadée, W. Renema, 1999 Flying high: on the airborne dispersal of aquatic organisms as illustrated by the distribution histories of the gastropod genera Tryonia and Planorbarius. Geol. Mijnbouw 78:165-174
Winnepenninckx B., T. Backeljau, R. De Wachter, 1993 Extraction of high molecular weight DNA from molluscs Trends Genet 9:407[Web of Science][Medline]
Woodruff D. S., M. Mulvey, 1997 Neotropical schistosomiasis: African affinities of the host snail Biomphalaria glabrata (Gastropoda: Planorbidae) Biol. J. Linn. Soc 60:505-516
Yang Z., 1994 Maximum likelihood estimation from DNA sequences with variable rates over sites: approximate methods J. Mol. Evol 39:306-314[Web of Science][Medline]
Yong M., A. Gutierrez, G. Perera, P. Durand, J. P. Pointier, 2001 The Biomphalaria havanensis complex (Gastropoda: Planorbidae) in Cuba: a morphological and genetic study J. Molluscan Stud 67:103-111
Yong M., J. P. Pointier, G. Perera, 1997 The type locality of Biomphalaria havanensis (Pfeiffer, 1839) Malacol. Rev 30:115-117
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
W. M. LOTFY, R. J. DEJONG, A. ABDEL-KADER, and E. S. LOKER A MOLECULAR SURVEY OF BIOMPHALARIA IN EGYPT: IS B. GLABRATA PRESENT? Am J Trop Med Hyg, July 1, 2005; 73(1): 131 - 139. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

50% of 234 shortest trees and in the ML tree, and correspond to 
