Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (49)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Atanassov, I.
Right arrow Articles by Monéger, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Atanassov, I.
Right arrow Articles by Monéger, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Biology and Evolution 18:2162-2168 (2001)
© 2001 Society for Molecular Biology and Evolution

Analysis and Evolution of Two Functional Y-Linked Loci in a Plant Sex Chromosome System

Ivan Atanassov, Catherine Delichère, Dmitry A. Filatov1, Deborah Charlesworth, Ioan Negrutiu and Françoise Monéger

Laboratoire de Reproduction et Développement des Plantes, Ecole Normale Supérieure Lyon, Lyon, France;
Institute of Genetic Engineering, Kostinbrod, Bulgaria;
Laboratoire de Biochimie et Physiologie Moléculaire des Plantes, Université Montpellier II, Montpellier, France;
Institute of Cell, Animal, and Population Biology, University of Edinburgh, Edinburgh, Scotland


    Abstract
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
White campion (Silene latifolia) is one of the few examples of plants with separate sexes and with X and Y sex chromosomes. The presence or absence of the Y chromosome determines which type of reproductive organs—male or female—will develop. Recently, we characterized the first active gene located on a plant Y chromosome, SlY1, and its X-linked homolog, SlX1. These genes encode WD-repeat proteins likely to be involved in cell proliferation. Here, we report the characterization of a novel Y-linked gene, SlY4, which also has a homolog on the X chromosome, SlX4. Both SlY4 and SlX4 potentially encode fructose-2,6-bisphosphatases. A comparative molecular analysis of the two sex-linked loci (SlY1/SlX1 and SlY4/SlX4) suggests selective constraint on both X- and Y-linked genes and thus that both X- and Y-linked copies are functional. Divergence between SlY4 and SlX4 is much greater than that between the SlY1 and SlX1 genes. These results suggest that, as for human XY-linked genes, the sex-linked plant loci ceased recombining at different times and reveal distinct events in the evolutionary history of the sex chromosomes.


    Introduction
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
Sex determination is a key question in developmental biology. In animals, particularly mammals, extensive molecular genetics studies have characterized regulatory pathways controlling male and female development and led to the elaboration of theories for the evolution of sex chromosomes (Charlesworth 1991Citation ; Ellis 1998Citation ; Lahn and Page 1999Citation ; Mitchell 2000Citation ). Flowering plants are generally hermaphroditic, but in dioecious and monoecious (unisexual) species, reproductive organ development involves sex determination mechanisms (Ainsworth, Parker, and Buchanan-Wollaston 1998Citation ). In white campion (Silene latifolia), the sex determination system appears to be similar to the XY system found in mammals: male heterogamety with a dominant Y and a pseudoautosomal region (Westergaard 1958Citation ). At very early stages, the flowers of white campion contain both male and female primordia. Then, in flowers of a given sex, the reproductive organs of the opposite sex stop developing, depending on the presence or absence of the Y chromosome (Westergaard 1958Citation ; Lardon et al. 1999Citation ).

Sex chromosomes are believed to be evolutionarily derived from a pair of ordinary autosomes (Bull 1983Citation ; Ellis 1998Citation ). It is presumed that sex was initially genetically determined by a system in which the male was heterozygous at two loci. Classical cytogenetic and genetic work showed that at least two sex-determining factors (female inhibition and male activation) are indeed involved in white campion (Westergaard 1958Citation ; Farbos et al. 1999Citation ; Lardon et al. 1999Citation ). Subsequent to this initial stage, meiotic recombination between the proto-sex chromosomes (or parts of them) was suppressed. Thus, the Y chromosome of many species, including S. latifolia, in which pairing is confined to a terminal region (Farbos et al. 1999Citation ), differs from other chromosomes in that it does not recombine along the majority of its length, in addition to its being present only in the male sex in a permanent haploid condition.

Arrest of X-Y recombination appears to be the critical event in the evolution of sex chromosomes and is expected to lead to subsequent genetic events, including degeneration of Y-linked loci (Charlesworth 1996Citation ; Mitchell 2000Citation ) and dosage compensation, for which there is some evidence in plants (Vyskot et al. 1993Citation ; Siroky et al. 1994Citation ; Siroky, Castiglione, and Vyskot 1998Citation ). In the much better studied human Y chromosome, Lahn and Page (1999)Citation analyzed 19 genes with homologs on both the X and the Y chromosomes and estimated their divergence times from nucleotide divergence values at silent sites. They proposed that human Y chromosome evolution involved four inversions, each separately suppressing X-Y recombination without disturbing the gene order on the X chromosome. These events are estimated to have spanned a timescale of 240–300 Myr.

In addition to the sex-determining gene SRY, three groups of genes have been identified in the nonrecombining region of the human Y chromosome (Delbridge and Graves 1999Citation ; Lahn and Page 1999Citation ). One group contains genes shared between the X and Y chromosomes. This group includes housekeeping genes that are ubiquitously expressed and escape X-inactivation (both X and Y copies are expressed and thus produce two doses of the corresponding gene product). The other two groups, however, differ between the X and Y chromosomes. One category contains testis-specific genes with widespread expression of the X-linked homolog (dosage compensation of the X copy allows the Y copy to acquire male-enhancing functions). The final category contains testis-specific multicopy genes with no homologs on the X chromosome (these are thought to have originated through retrotransposition from autosomes). These categories reflect the diminishing contribution of Y-chromosomal alleles to various developmental processes (Mitchell 2000)Citation .

In white campion, sexual dimorphism and its control by an XY sex chromosome system probably evolved relatively recently, as other species in the genus are hermaphroditic or gynodioecious (Desfeux et al. 1996Citation ). Based on sequence divergence for the internal transcribed spacer (ITS) sequences of ribosomal DNA (Desfeux et al. 1996Citation ), using accepted rates of silent site substitutions in plants (Gaut 1998Citation ), we estimate that in the genus Silene, the sex chromosomes probably evolved about 20 MYA. Plant sex chromosomes therefore represent a unique opportunity to study early steps of sex chromosome evolution. For such work, it is clear that molecular characterization of sex-linked loci is required. We have therefore started a search for sex-linked loci in S. latifolia. The first Y-linked gene described, SlY1 (Delichère et al. 1999Citation ), has a very similar X-chromosomal copy, and molecular evolutionary studies of these loci suggest reduction of the Y-chromosome effective population size, showing that some selective processes must affect this plant Y chromosome (Filatov et al. 2000)Citation .

In this paper, we describe the characterization of a novel Y-linked gene from S. latifolia, SlY4. Like SlY1 (Delichère et al. 1999Citation ), SlY4 also has a homolog on the X chromosome, SlX4. SlY4 and SlX4 are both expressed in all of the tissues tested and are predicted to encode fructose-2,6-bisphosphatases, the sequences of which are reported for the first time in plants. SlY4/SlX4 and SlY1/SlX1 are the first reported active genes located on plant sex chromosomes. Both the Y-linked genes were isolated from a cDNA library, and their expression was detected in several tissues. In addition, analysis of the rates of synonymous substitutions (Ks) and nonsynonymous substitutions (Ka) for each pair of sex-linked loci revealed selective constraints, suggesting that they encode functional proteins. Furthermore, this analysis indicates that the two loci characterize Y-chromosome regions that have ceased recombining at different times during the evolution of sex chromosomes.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
Plant Material
The plants used for this study were as described in Delichère et al. (1999)Citation . The developmental stages of the flowers used for RNA extraction were defined according to Farbos et al. (1997)Citation . Male flowers at stage 1 (<1 mm long) contain floral meristems to anthers at the tetralobal stage. Male flowers at stage 2 (1–2.5 mm long) contain anthers before and during meiosis. Female flowers at stage 1 (<1 mm long) contain floral meristems to gynoecium with five distinct locules. Female flowers at stage 2 (1–2.5 mm long) contain carpels with differentiated tissues and vascularization established.

Screening of cDNA and Genomic Libraries
The screening of the cDNA library of male flowers at premeiotic and meiotic stages with the Y-derived probe was as described by Delichère et al. (1999)Citation . The genomic library of male plants (a kind gift from P. Gilmartin) was constructed into Lambda FIX II (Stratagene). One million plaques were transferred onto Hybond N+ nylon membranes (Amersham) and were hybridized with the two cDNAs, SlY1 and SlY4. DNA was extracted from the phages containing inserts hybridizing to the probes, and restriction fragments were subcloned into pBluescript plasmid (Stratagene).

Genomic Southern Blot Analysis and Northern Blot Analysis
Genomic Southern blot analysis and Northern blot analysis protocols were as described by Delichère et al. (1999)Citation .

PCR
Rapid amplification of cDNA ends (RACE)-PCR and reverse-transcribed (RT)-PCR were as described by Delichère et al. (1999)Citation . For RACE-PCR, the primers 95S1 (CCACTGGGAAGGTTGCCCTCGTTCT) and 95S3 (CCGAAGCTCCATTAGCGAACCGAATAC) were used for the 3' amplification, and the primer 95AS4 (GACGTCGGCTCCTACGGACAGTT) was used for the 5' amplification. The gene-specific primers used for both RT-PCR and PCR from genomic DNA for SlY4 were CAACCTGACTTCTCCGCTCCTTCTGG and CAACATGAGCTCCTCGTGAGCACGGCG, and those for SlX4 were CCACTGGGAAGGTTGCCCTCGTTCT and CCGAAGACAGTAAACCGTCAACCCAACC. For the SlY4-specific set of primers, the conditions were as follows: 3 x (30 s at 95°C, 30 s at 65°C, 2 min at 72°C); 3 x (30 s at 95°C, 30 s at 62°C, 2 min at 72°C); 27 x (30 s at 95°C, 30 s at 59°C, 2 min at 72°C). For the SlX4-specific set of primers, the conditions were as follows: 3 x (30 s at 95°C, 30 s at 68°C, 2 min at 72°C); 3 x (30 s at 95°C, 30 s at 65°C, 2 min at 72°C); 27 x (30 s at 95°C, 30 s at 62°C, 2 min at 72°C).

Cloning and Sequencing
Cloning and sequencing were done as described by Delichère et al. (1999)Citation .

Sequence Comparisons
Sequence data were initially analyzed using BLAST and BESTFIT (GCG7.3 version) using the blosum62.cmp matrix. Multiple protein sequence alignments were performed using the program MEGALIGN (DNASTAR). To assess amino acid sequence conservation, Ka and Ks values were calculated with the MEGA program (Kumar et al. 2000)Citation using P-distances (the proportion of sites at which the two sequences compared are different, without correction for transition-vs.-transversion bias in substitutions). No correction was made for multiple substitutions at the same site, which is conservative for our purposes, as it underestimates silent substitutions between highly diverged sequences and therefore underestimates the degree of conservation of amino acids (Li 1997Citation ). For Silene conica, portions of the genes orthologous to SlX4/SlY4 and SlX1/SlY1 were sequenced from genomic DNA and analyzed after removal of intron sequences. In both cases, the PCR products were single sequences, suggesting that only one homolog of both genes is present in the S. conica genome.


    Results
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
Identification of SlY4 and SlX4 and Deletion Mapping
Screening of a male flower cDNA library with a microdissected Y-chromosome–derived probe (Delichère et al. 1999Citation ) resulted in the identification of five cDNA clones showing sex-linked polymorphism. A first clone that yielded the SlX1 and SlY1 genes was reported previously (Delichère et al. 1999Citation ). In this paper, we describe the characterization of a new clone which was shown to be sex-linked by Southern blot analysis on a segregating population. HindIII-restricted DNAs from two parents and 28 progeny plants (14 males and 14 females) were tested. The results obtained for 10 representative plants are shown in figure 1 . An 8-kb fragment was always detected in male plants but was never detected in female plants, demonstrating that it carries a Y-linked gene. Following the same nomenclature used for the first gene, we named this fragment SlY4. Two additional restriction fragments, of 3.5 and 2.3 kb, were detected, as shown in figure 1 . They exhibited the expected pattern for an X-linked polymorphism (two alleles in females but only one in males). We thus conclude that the 3.5- and 2.3-kb fragments correspond to two allelic forms of the X-linked gene homologous to SlY4 (which we denote SlX4). Genomic Southern blot analysis showed that SlY4 and SlX4 were the only genes in the S. latifolia genome that hybridize to this cDNA.



View larger version (108K):
[in this window]
[in a new window]
 
Fig. 1.—Segregation analysis of a male-specific fragment and characterization of SlY4 and SlX4. Genomic DNA isolated from two parent plants (male and female) and from their male (males 1–4) and female (females 1–4) progeny was restricted by HindIII and analyzed by Southern blot. Genomic DNA was hybridized with the cDNA insert obtained through screening with the Y-derived probe. The sizes of the fragments which hybridize to the probe are indicated. According to their segregation behavior, the identities of these different fragments are indicated. The 8-kb fragment which segregates with the male sex is labeled with a Y (left). The other two fragments (3.5 and 2.3 kb, respectively) correspond to two allelic forms of the X-linked gene, as two alleles are present in the females and only one is present in the males. These fragments are therefore labeled Xa and Xb (left)

 
As for SlY1 (Delichère et al. 1999Citation ), genomic Southern blot analysis revealed no deletion of SlY4 in our Y deletion mutants, which covered 90% of the p-arm (Farbos et al. 1999Citation ; Lardon et al. 1999Citation ) and 30% of the q-arm (data not shown). Since the p-arm nondeleted portion essentially contains the pericentric heterochromatic domain (Farbos et al. 1999Citation ; Lardon et al. 1999Citation ), it seems unlikely that the two genes are located on the p-arm. In addition, population genetics analyses have revealed that both Y-linked genes never recombine with their X-homologs, indicating they are not in the pseudoautosomal region (PAR). As a consequence, they probably localize somewhere along the q-arm of the Y chromosome outside the PAR and outside the 30% deleted in our deletion mutants. Interestingly, deletions in the q-arm cause various types of male sterility, indicating that several active genes controlling anther development and pollen fertility are located there. The recent identification of a spontaneous male sterile plant in which SlY4 is apparently deleted (unpublished data) is consistent with this gene being in the q-arm.

Analysis of SlY4 and SlX4 Transcripts
In order to identify complete cDNAs for both SlY4 and SlX4, we performed RACE-PCR and RT-PCR experiments. The longest cDNA obtained was 1,713 bp (excluding the polyA tail). Given the estimated size of about 1,750 bases from Northern blot analysis shown in figure 2A, we believe that this transcript is nearly or entirely complete. Consistent with this view, the 5' region of the cDNA contains stop codons and is rich in CT motifs (9.8% in the 194 bp of the putative 5' untranslated region vs. 4% in the open reading frame), as previously observed in 5' untranslated regions of other cDNAs from S. latifolia (unpublished data). These data suggest that our cDNA contains a complete open reading frame.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 2.—Expression of SlY4 and SlX4. A, Northern blot analysis. Flower development stages are as described in Materials and Methods. Fifteen micrograms of total RNA from different tissues of male or female plants were loaded in each lane: Fb1 and Fb2 = flower buds at stages 1 and 2, respectively; L = leaves; sh = shoot; st = stem; se = seedlings (mixture of males and females). The RNAs were hybridized with the initial cDNA (corresponding to SlY4), as for the Southern blot analysis in figure 1 . On the right, the sizes of the transcripts are indicated in bases. B, SlY4- and SlX4-specific primers (see Materials and Methods) were used in PCR experiments with genomic DNA from male and female plants. C, RT-PCR analysis. Total RNA from the same tissues in A were used as template for reverse transcription from an oligo-dT primer and subsequent PCR amplification using SlY4- and SlX4-specific primers (as in B). The PCR products were separated on an agarose gel and hybridized with the cDNA probe (the same as for Southern and Northern blot analyses)

 
Two types of homologous transcripts were isolated from male flower buds. PCR primers specific for each of them were designed and used for amplification from genomic DNA from male and female plants. The results are shown in figure 2B. As expected, one pair of primers amplified a fragment with DNA from male plants only, whereas the other one amplified a fragment from both male and female plants. This allowed the identification of SlY4 and SlX4 cDNA sequences. The complete Y-linkage of SlY4 and X-linkage of SlX4 were confirmed by analyzing unrelated individuals from several natural populations (data not shown).

A Northern blot analysis of total RNA is shown in figure 2A. Transcripts homologous to the cDNA are detected in all of the tissues tested: premeiotic (stage 1) and postmeiotic (stage 2) flower buds from both males and females, and leaves, shoots, stems, and seedlings from mixtures of male and female plants. To test for tissue-specific expression patterns of SlY4 and SlX4, RT-PCR experiments were performed using the gene-specific primer sets used on genomic DNA (fig. 2B ). The results, shown in figure 2C, demonstrate that both SlY4 and SlX4 are expressed in all of the tissues in which Northern blotting detected transcripts (fig. 2A ). In female plants, SlX4 was also detected in pre- and postmeiotic flower buds. These results suggest that both SlY4 and SlX4 are ubiquitously expressed in S. latifolia.

SlY4 and SlX4 May Encode Fructose-2,6-Bisphosphatases
The polypeptide sequences deduced from the SlY4 and SlX4 cDNAs (respectively, 422 and 425 amino acids long) were compared with sequences in the databases. The two highest protein similarity scores were obtained with two predicted proteins from Arabidopsis thaliana: the first one (SPTNEW BAB01224, on chromosome 3) shared 65.8% identity with SlY4 and 68.1% with SlX4. The second (SPTNEW AAF78490, on chromosome 1) shared 64.6% identity with SlY4 and 65.4% with SlX4. Protein sequence alignments showed significant homology between SlY4, SlX4 and the two homologous proteins from A. thaliana, and the bisphosphatase domain of the 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatases (bifunctional 6PF–2-K/Fru-2,6-P2ases) from animals (42.5%–48.3% similarity, based on 133 amino acids). The important residues were conserved, indicating that the plant genes analyzed probably encode monofunctional fructose-2,6-bisphosphatases. Surprisingly, these fructose-2,6-bisphosphatases have higher similarity to animal than to plant bifunctional enzymes.

Comparative Analysis of the Two X- and Y-Linked Loci
In order to investigate the genomic organization of the two sex-linked loci characterized so far, SlY4/SlX4 and the previously described SlY1/SlX1 (Delichère et al. 1999Citation ), we used the cDNAs as probes on a male genomic library. A genomic clone was isolated for each gene. The entire nucleotide sequence was determined for SlX1, and almost all of it was determined for SlY1. For SlX4, the 5' part of the cDNA was not present in our genomic clone, so the first exon is missing. Finally, the first intron of the SlY4 genomic clone was not sequenced. Alignment with the corresponding cDNA sequences allowed the localization of the introns.

The genomic structures of the two loci are shown in figure 3 . SlY1 and SlX1 were very similar in structure. Both contained 14 introns which had the same locations and were highly conserved in both size and sequence: the average identity was 96.8%, with a range of 93.2%–99%. The genomic structures of the SlY4 and SlX4 genes were also similar, with both genes having at least two long introns in the same positions. The intron sizes differed considerably, however. The second intron of SlX4 was 2,853 bp long, while that of SlY4 was 4,167 bp long, and they shared no significant identity, even locally.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3.—Genomic structure of SlY1/SlX1 and SlY4/SlX4 loci. The genomic structures of the two loci are shown. The exons are represented by boxes and are numbered above. Dotted lines represent missing sequence data. For each locus, the scale is indicated in base pairs. The cDNAs are represented by boxes, and the coding sequences are filled in black. The top part of the figure represents the genomic and cDNA sequences of SlY1 and SlX1. The bottom part of the figure represents SlY4 and SlX4 genomic and cDNA sequences. The deletions observed in the cDNA sequences are indicated with arrowheads. Note that the size of the second intron is larger (by approximately 1,300 bp) for SlY4 than for SlX4

 
Sequence Divergence Analysis
To test for conservation of protein sequences, we estimated Ks and Ka from our sequence data. Two types of comparison are possible: between species and within species. To compare the S. latifolia Y- and X-linked sequences with the sequences of homologous genes from another species, we used S. conica, a hermaphroditic species that is thought to be closely related to S. latifolia (Desfeux et al. 1996Citation ). The results shown in table 1 indicate clearly that in both Y-linked genes, amino acid replacements are much less frequent than silent changes, taking into account the relative numbers of silent and replacement sites estimated in our sequences. The second comparison was between the S. latifolia Y-linked sequences and their X-linked homologs. The SlY1 and SlX1 cDNA sequences were 98% identical overall; in the coding region, the Ka value was 0.0018 (table 1 ), and the two corresponding proteins shared 99.6% identity (and 99% similarity). In contrast, SlY4 and SlX4 cDNAs were 92.3% identical, and in the coding regions, their Ka value was 0.03 (table 1 ), and the two proteins were 94.8% identical (95.7% similar); the SlY4 protein product had three amino acid deletions compared with the corresponding SlX4 protein: two at positions 22 and 23 and one at position 61 in the SlX4 protein sequence. The deletion at amino acid 61 is not present in the sequence of the S. conica homolog, which supports the conclusion that this is a deletion in the S. latifolia Y-linked genes, rather than an insertion in SlX4 (the other codons were not included in our sequence data from S. conica). There was also a longer deletion, of 21 bases (from base 78 to base 98 in SlX4), in the 5' noncoding region of SlY4 with respect to SlX4. The coding regions of the two genes differed at 3% of amino acid replacement sites and at 18% of silent sites (table 1 ).


View this table:
[in this window]
[in a new window]
 
Table 1 Comparison of Divergence in Coding Sequences Between the Silene latifolia or X- and Y-Linked Genes and the Silene conica Homolog (between-species comparisons), and Between the X- and Y-Linked Genes of S. latifolia (within-species comparisons)

 

    Discussion
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
The Gene Content of the S. latifolia Y Chromosome
Our results shed some light on the gene content of the Y chromosome of S. latifolia. Interestingly, both of the plant Y-linked genes discussed here are ubiquitously expressed housekeeping genes with X homologs: SlY1 and SlX1 encode WD-repeat proteins that are probably involved in cell proliferation (Delichère et al. 1999Citation ), and SlY4 and SlX4 encode proteins that are probably involved in carbohydrate metabolism. We know from genetic studies that, in addition to the genes involved in sex determination, the Y chromosome carries loci involved in stamen differentiation, microsporogenesis, and sex ration bias (Farbos et al. 1999Citation ; Lardon et al. 1999Citation ).

The sex chromosomes of S. latifolia evolved recently (Desfeux et al. 1996Citation ), whereas genetic degeneration probably requires large amounts of evolutionary time. Recent evolution may therefore increase the chance of finding Y-linked genes that have detectable X homologs and are transcribed and encode functional proteins. Our finding of two such genes does not necessarily reflect a low level of degeneration for this Y chromosome, but may simply represent a bias due to the fact that only transcribed genes would be detected by our approach. To determine what proportion of X-linked genes remain as expressed loci on the Y chromosome, it will be necessary to test an unbiased set of X-linked genes. To date, only one such gene (MROS3) has been tested, and its Y-linked counterpart was found to have degenerated (Guttman and Charlesworth 1998Citation ).

The fact that both of the Y-linked genes have low Ka/Ks ratios in both inter- and intraspecies comparisons indicates that amino acid replacements are much less frequent than silent changes, given the relative numbers of silent and replacement sites in the sequences. This is good evidence that both the SlY1 and the SlY4 genes have encoded functional proteins during most or all of the period since their evolutionary divergence from their respective X homologs and that their coding sequences are evolving as expected for genes encoding proteins with substantial natural selection against amino acid sequence changes. The possibility that the Y-linked genes have only recently ceased to encode functional proteins is disproved by the observation that the SlY4 and SlX4 are much more diverged from one another than are SlY1 and SlX1. It is highly unlikely that the SlY1 and SlY4 genes both lost their function recently, despite their very different divergence times. In addition, all of these genes have been shown to be transcribed. The sequences of these genes give no other indications of loss of function, such as stop codons or frameshifts.

Cessation of Recombination in the S. latifolia Y Chromosome
The characterization of these first two X- and Y-linked loci allows us to compare the evolution of plant sex chromosomes with those of mammals. The human X and Y chromosomes have been proposed to have at least four "evolutionary strata" with different amounts of divergence (Lahn and Page 1999Citation ). In S. latifolia, the divergence between SlY4 and SlX4 is much greater than that between the SlY1 and SlX1 genes. Silent-site divergence between S. latifolia SlY4 and SlX4 is about 18%, compared with 4% between SlY1 and SlX1, and amino acid differences between SlY4 and SlX4 are also much greater than those between SlY1 and SlX1 (table 1 ). The SlY4/SlX4 silent-site divergence is similar to the estimated value of about 19% between the X-linked MROS3 gene and the degenerated Y-linked copy, which has been evolving in a neutral manner (Guttman and Charlesworth 1998Citation ). However, this finding is based on only a short sequence, as only a 159-bp region has high homology between the X- and Y-linked homologs. Assuming a synonymous molecular clock with a rate of about 0.6%/Myr (Gaut 1998Citation ), we can then estimate that SlY4 and SlX4, and also the MROS3-X and MROS3-Y gene pair, stopped recombining about 15 MYA. This is consistent with the age of this sex chromosome system as estimated from ITS sequences (Desfeux et al. 1996Citation ), but it is much longer ago than the estimate for SlY1 and SlX1 (3.3 Myr). A molecular clock with a constant rate for synonymous sites is, of course, an approximation, but the more than fourfold smaller synonymous-site divergence between SlY1 and SlX1 compared with the X- and Y-linked members of the other two gene pairs currently available suggests a difference in their divergence times. Out of 14 genes compared between A. thaliana and Arabidopsis lyrata (mean Ks = 0.21), the least diverged gene has 42% of the Ks value of the most diverged (Lagercrantz and Axelsson 2000)Citation . As for human XY-linked genes, the plant sex-linked loci analyzed therefore probably ceased recombining at very different times in the evolutionary history of the sex chromosomes. This conclusion should be tested further if additional sex-linked loci can be discovered in this plant.

Genes on an X/Y chromosome pair will start diverging as soon as they become isolated from one another by suppression of recombination. This suppression could have progressed along the sex chromosomes during evolution by successive inversions, as has been proposed for the human sex chromosomes (Lahn and Page 1999Citation ). If this hypothesis is true, SlX1 should be closer than SlX4 to the pseudoautosomal region. An alternative is that the chromosome region containing SlX1 could have been translocated relatively recently onto both members of an X/Y chromosome pair that already carried diverged SlY4/SlX4 genes, similar to the XAR region that has been proposed for mammalian sex chromosomes (Graves 1995Citation ). For either of these hypotheses, the results presented here identify two distinct "strata" within the Y chromosome according to Ks values found for the X- and Y-chromosome gene pairs (Lahn and Page 1999Citation ).

Where are these strata located on the Y chromosome? Available results from Y deletion mapping studies in sexual mutants suggest that the two potential strata identified in this work, carrying SlY1 and SlY4, probably localize somewhere along the q-arm of the Y chromosome outside the pseudoautosomal region. Additional genes located on these plant sex chromosomes are needed to improve the resolution of these first results and to determine more precisely how sex chromosomes have evolved in the plant kingdom.


    Supplementary Material
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
Sequences were submitted to GenBank under the following accession numbers: AJ310655 (SlY1 gene), AJ310656 (SlX1 gene), AJ310657 (SlY4 gene), AJ310658 (SlX4 gene), AJ310659 (SlY4 mRNA), and AJ310660 (SlX4 mRNA).


    Acknowledgements
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 
We thank C. Dumas for supporting this project. We thank Sheila McCormick and Charlie Scutt for reading the manuscript. We are grateful to A. Lacroix, A. Guillermin, F. Deguerry, S. Madi, and H. Leyral for technical assistance. We thank P. Gilmartin for the kind gift of his genomic library. D.A.F. was supported by a grant to D.C. from the Leverhulme Trust, and D.C. was supported by a NERC Senior Research Fellowship. This work was also supported through grants from MENRT (France) to I.A. and C.D. and by research contracts from the CNRS, the INRA, the ENS, and the University Lyon I, France.


    Footnotes
 
Pekka Pamilo, Reviewing Editor

1 Present address: School of Biosciences, University of Birmingham, Edgbaston, Birmingham, England. Back

Abbreviations: Ka, nonsynonymous substitution rate; Ks, synonymous substitution rate; RT-PCR, reverse-transcribed PCR; SlY1/SlX1, Silene latifolia Y/X-chromosome gene 1; SlY4/SlX4, Silene latifolia Y/X-chromosome gene 4. Back

Keywords: plant sex chromosomes dioecy Silene latifolia molecular evolution Back

Address for correspondence and reprints: Françoise Monéger, Laboratoire de Reproduction et Développement des Plantes, Ecole Normale Supérieure Lyon, 46 Allée d'Italie, 69364 Lyon cedex 07, France. francoise.moneger{at}ens-lyon.fr . Back


    References
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Supplementary Material
 Acknowledgements
 References
 

    Ainsworth C., J. Parker, V. Buchanan-Wollaston, 1998 Sex determination in plants Curr. Top. Dev. Biol 38:167-223[Web of Science][Medline]

    Bull J. J., 1983 Evolution of sex determining mechanisms Benjamin/Cummings, Menlo Park, Calif

    Charlesworth B., 1991 The evolution of sex chromosomes Science 251:1030-1032[Abstract/Free Full Text]

    ———. 1996 The evolution of chromosomal sex determination and dosage compensation Curr. Biol 6:149-162[Web of Science][Medline]

    Delbridge M. L., J. A. Graves, 1999 Mammalian Y chromosome evolution and the male-specific functions of Y chromosome-borne genes Rev. Reprod 4:101-109[Abstract]

    Delichère C., J. Veuskens, M. Hernould, N. Barbacar, A. Mouras, I. Negrutiu, F. Monéger, 1999 SlY1, the first active gene cloned from a plant Y chromosome, encodes a WD-repeat protein EMBO J 18:4169-4179[Web of Science][Medline]

    Desfeux C., S. Maurice, J. P. Henry, B. Lejeune, P. H. Gouyon, 1996 Evolution of reproductive systems in the genus Silene Proc. R. Soc. Lond. B Biol. Sci 263:409-414[Medline]

    Ellis N. A., 1998 The war of the sex chromosomes Nat. Genet 20:9-10[Web of Science][Medline]

    Farbos I., M. Oliveira, I. Negrutiu, A. Mouras, 1997 Sex organ determination and differentiation in the dioecious plant Melandrium album (Silene latifolia): a cytological and histological analysis Sex. Plant Reprod 10:155-167

    Farbos I., J. Veuskens, B. Vyskot, M. Oliveira, S. Hinnisdaels, A. Aghmir, A. Mouras, I. Negrutiu, 1999 Sexual dimorphism in white campion: deletion on the Y chromosome results in floral asexual phenotype Genetics 151:1187-1196[Abstract/Free Full Text]

    Filatov D. A., F. Monéger, I. Negrutiu, D. Charlesworth, 2000 Low variability in a Y-linked plant gene and its implications for Y-chromosome evolution Nature 404:388-90[Medline]

    Gaut B. S., 1998 Molecular clocks and nucleotide substitution rates in higher plants Evol. Biol 30:93-120

    Graves J. A., 1995 The origin and function of the mammalian Y chromosome and Y-borne genes—an evolving understanding Bioessays 17:311-320[Web of Science][Medline]

    Guttman D. S., D. Charlesworth, 1998 An X-linked gene with a degenerate Y-linked homologue in a dioecious plant Nature 393:263-266[Medline]

    Kumar S., K. Tamura, I. Jacobsen, M. Nei, 2000 MEGA2: molecular evolutionary genetics analysis Pennsylvania and Arizona State Universities

    Lagercrantz U., T. Axelsson, 2000 Rapid evolution of the family of CONSTANS LIKE genes in plants Mol. Biol. Evol 17:1499-1507[Abstract/Free Full Text]

    Lahn B. T., D. C. Page, 1999 Four evolutionary strata on the human X chromosome Science 286:964-967[Abstract/Free Full Text]

    Lardon A., S. Georgiev, A. Aghmir, G. Le Merrer, I. Negrutiu, 1999 Sexual dimorphism in white campion: complex control of carpel number is revealed by Y chromosome deletions Genetics 151:1173-1185[Abstract/Free Full Text]

    Li W. H., 1997 Principles of molecular evolution Sinauer, Sunderland, Mass

    Mitchell M. J., 2000 The unique Y chromosome Pp. 233–270 in McElreavey, ed. Results and problems in cell differentiation. Vol. 28. Springer-Verlag, Berlin, Heidelberg

    Siroky J., M. R. Castiglione, B. Vyskot, 1998 DNA methylation patterns of Melandrium album chromosomes Chromosome Res 6:441-446[Web of Science][Medline]

    Siroky J., B. Janousek, A. Mouras, B. Vyskot, 1994 Replication patterns of sex chromosomes in Melandrium album female cells Hereditas 120:175-181

    Vyskot B., A. Arayas, J. Veuskens, I. Negrutiu, A. Mouras, 1993 DNA methylation of sex chromosomes in a dioecious plant, Melandrium album Mol. Gen. Genet 239:219-224[Web of Science][Medline]

    Westergaard M., 1958 The mechanism of sex determination in dioecious flowering plants Adv. Genet 9:217-281[Web of Science][Medline]

Accepted for publication August 2, 2001.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Biol EvolHome page
V. B. Kaiser, R. Bergero, and D. Charlesworth
Slcyt, a Newly Identified Sex-Linked Gene, Has Recently Moved onto the X Chromosome in Silene latifolia (Caryophyllaceae)
Mol. Biol. Evol., October 1, 2009; 26(10): 2343 - 2351.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
E. C. Howell, S. J. Armstrong, and D. A. Filatov
Evolution of Neo-Sex Chromosomes in Silene diclinis
Genetics, August 1, 2009; 182(4): 1109 - 1115.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
Y. Kazama, M. T. Fujiwara, A. Koizumi, K. Nishihara, R. Nishiyama, E. Kifune, T. Abe, and S. Kawano
A SUPERMAN-like Gene is Exclusively Expressed in Female Flowers of the Dioecious Plant Silene latifolia
Plant Cell Physiol., June 1, 2009; 50(6): 1127 - 1141.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
A. Koizumi, Y. Amanai, K. Ishii, K. Nishihara, Y. Kazama, W. Uchida, and S. Kawano
Floral Development of an Asexual and Female-Like Mutant Carrying Two Deletions in Gynoecium-Suppressing and Stamen-Promoting Functional Regions on the Y Chromosome of the Dioecious Plant Silene latifolia
Plant Cell Physiol., October 1, 2007; 48(10): 1450 - 1461.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Zluvova, S. Georgiev, B. Janousek, D. Charlesworth, B. Vyskot, and I. Negrutiu
Early Events in the Evolution of the Silene latifolia Y Chromosome: Male Specialization and Recombination Arrest
Genetics, September 1, 2007; 177(1): 375 - 386.
[Abstract] [Full Text] [PDF]


Home page
ANN BOT (LOND)Home page
T. R. Meagher
Linking the Evolution of Gender Variation to Floral Development
Ann. Bot., August 1, 2007; 100(2): 165 - 176.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. Bergero, A. Forrest, E. Kamau, and D. Charlesworth
Evolutionary Strata on the X Chromosomes of the Dioecious Plant Silene latifolia: Evidence From New Sex-Linked Genes
Genetics, April 1, 2007; 175(4): 1945 - 1954.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
R. Ming, J. Wang, P. H. Moore, and A. H. Paterson
Sex chromosomes in flowering plants
Am. J. Botany, February 1, 2007; 94(2): 141 - 150.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Zluvova, B. Janousek, I. Negrutiu, and B. Vyskot
Comparison of the X and Y Chromosome Organization in Silene latifolia
Genetics, July 1, 2005; 170(3): 1431 - 1434.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. A. Filatov
Evolutionary History of Silene latifolia Sex Chromosomes Revealed by Genetic Mapping of Four Genes
Genetics, June 1, 2005; 170(2): 975 - 979.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L.-J. L. Handley, H. Ceplitis, and H. Ellegren
Evolutionary Strata on the Chicken Z Chromosome: Implications for Sex Chromosome Evolution
Genetics, May 1, 2004; 167(1): 367 - 376.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
S. A. Sandstedt and P. K. Tucker
Evolutionary Strata on the Mouse X Chromosome Correspond to Strata on the Human X Chromosome
Genome Res., February 1, 2004; 14(2): 267 - 272.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
B. F. McAllister
Sequence Differentiation Associated With an Inversion on the Neo-X Chromosome of Drosophila americana
Genetics, November 1, 2003; 165(3): 1317 - 1328.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Lengerova, R. C. Moore, S. R. Grant, and B. Vyskot
The Sex Chromosomes of Silene latifolia Revisited and Revised
Genetics, October 1, 2003; 165(2): 935 - 938.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
S. Matsunaga, E. Isono, E. Kejnovsky, B. Vyskot, J. Dolezel, S. Kawano, and D. Charlesworth
Duplicative Transfer of a MADS Box Gene to a Plant Y Chromosome
Mol. Biol. Evol., July 1, 2003; 20(7): 1062 - 1069.
[Abstract] [Full Text] [PDF]


Home page
Integr. Comp. Biol.Home page
J.-C. Mounolou, G. Queney, G. Bolet, N. Dennebouy, and M. Monnerot
Integrative Biology and Genetic Resources Management
Integr. Comp. Biol., April 1, 2003; 43(2): 271 - 275.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
Genetic and Functional Analysis of DD44, a Sex-Linked Gene From the Dioecious Plant Silene latifolia, Provides Clues to Early Events in Sex Chromosome Evolution
Genetics, January 1, 2003; 163(1): 321 - 334.



Home page
Nucleic Acids ResHome page
K. Ishizaki, Y. Shimizu-Ueda, S. Okada, M. Yamamoto, M. Fujisawa, K. T. Yamato, H. Fukuzawa, and K. Ohyama
Multicopy genes uniquely amplified in the Y chromosome-specific repeats of the liverwort Marchantia polymorpha
Nucleic Acids Res., November 1, 2002; 30(21): 4675 - 4681.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
D. A. Filatov and D. Charlesworth
Substitution Rates in the X- and Y-Linked Genes of the Plants, Silene latifolia and S. dioica
Mol. Biol. Evol., June 1, 2002; 19(6): 898 - 907.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
C. P. Scutt, T. Jenkins, M. Furuya, and P. M. Gilmartin
Male Specific Genes from Dioecious White Campion Identified by Fluorescent Differential Display
Plant Cell Physiol., May 15, 2002; 43(5): 563 - 572.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (49)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Atanassov, I.
Right arrow Articles by Monéger, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Atanassov, I.
Right arrow Articles by Monéger, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?