Molecular Biology and Evolution 18:2010-2016 (2001)
© 2001 Society for Molecular Biology and Evolution
Contrasting Levels of Nucleotide Diversity on the Avian Z and W Sex Chromosomes
Department of Evolutionary Biology, Evolutionary Biology Centre, Uppsala University, Uppsala, Sweden
| Abstract |
|---|
|
|
|---|
Sex chromosomes may provide a context for studying the local effects of mutation rate on molecular evolution, since the two types of sex chromosomes are generally exposed to different mutational environments in male and female germ lines. Importantly, recent studies of some vertebrates have provided evidence for a higher mutation rate among males than among females. Thus, in birds, the Z chromosome, which spends two thirds of its time in the male germ line, is exposed to more mutations than the female-specific W chromosome. We show here that levels of nucleotide diversity are drastically higher on the avian Z chromosome than in paralogous sequences on the W chromosome. In fact, no intraspecific polymorphism whatsoever was seen in about 3.4 kb of CHD1W intron sequence from a total of >150 W chromosome copies of seven different bird species. In contrast, the amount of genetic variability in paralogous sequences on the Z chromosome was significant, with an average pairwise nucleotide diversity (ð) of 0.0020 between CHD1Z introns and with 37 segregating sites in a total of 3.8 kb of Z sequence. The contrasting levels of genetic variability on the avian sex chromosomes are thus in a direction predicted from a male-biased mutation rate. However, although a low gene number, as well as some other factors, argues against background selection and/or selective sweeps shaping the genetic variability of the avian W chromosome, we cannot completely exclude selection as a contributor to the low levels of variation on the W chromosome.
| Introduction |
|---|
|
|
|---|
The neutral theory of molecular evolution states that in the absence of selection, the mutation rate should generally be the driving force of evolution (Kimura 1983
Comparative analyses of the degree of nucleotide diversity on sex chromosomes may offer a useful context for studying the effects of local variation in the mutation rate on levels of genetic variability. The two distinct types of sex chromosomes found in most vertebrates (e.g., X and Y in mammals, and Z and W in birds) may inherently be associated with different mutation rates given that they spend different amounts of time in male and female germ lines (Miyata et al. 1987
). Producing a massive amount of sperm, male germ cells undergo many more mitotic cell divisions prior to fertilization than do female germ cells, and, assuming DNA replication to be an important source of mutation, this would lead to a male bias in the mutation rate. Indeed, there are several lines of evidence from different taxonomic groups that males mutate more often than females (Miyata et al. 1987
; Shimmin, Chang, and Li 1993
; Ellegren and Fridolfsson 1997
; Hurst and Ellegren 1998
; Kahn and Quinn 1999
; Ellegren 2000a
), and a male-biased mutation rate should translate into biased mutation pressures on the two sex chromosomes. In mammals, the Y chromosome is only transmitted from fathers to sons, and thus Y-linked mutations arise only in the male germ line. The X chromosome, on the other hand, spends two thirds of its time in the female germ line, and, in a predictable manner, the frequency of X-linked mutations should therefore reflect a combination of male- and female-specific mutation rates. In line with this expectation, presumably neutral sequences on the Y chromosomes of primates and other mammals have been shown to evolve faster than paralogous sequences on the X chromosome (Miyata et al. 1987
; Shimmin, Chang, and Li 1993
; Chang et al. 1994
; Huang et al. 1997
; Agulnik et al. 1997
; Pecon Slattery and O'Brien 1998
). Similarly, in birds, in which males are homogametic ZZ and females are heterogametic ZW, presumably neutral sequences on the Z chromosome have been shown to evolve faster than paralogous sequences on the female-specific W chromosome (Ellegren and Fridolfsson 1997
; Kahn and Quinn 1999
; Carmichael et al. 2000
; Fridolfsson and Ellegren 2000
).
If the mutation rate is male-biased and, as a consequence, the mutation rate is higher on the sex chromosome which spends most of its time in male germ line (i.e., Z in birds), we should expect higher levels of genetic variability on this sex chromosome than on the other, other things being equal. In theory, however, other things might not be identical. For instance, the heteromorphic, sex-limited sex chromosome has a smaller effective population size (typically one third that of the other sex chromosome) and does not undergo recombination outside of the pseudoautosomal region. These are factors generally associated with lowered levels of polymorphism (Maynard-Smith and Haigh 1974
), and they thus need to be taken into account when interpreting levels of genetic variability on sex chromosomes.
In this study, we analyzed the degree of nucleotide diversity in two sex-linked avian genes, CHD1Z (chromo-helicase-DNA-binding protein 1 on the Z chromosome) and CHD1W (its homolog on the W chromosome). Representing two independently evolving paralogs (Fridolfsson and Ellegren 2000
; Garcia-Moreno and Mindell 2000
) exposed to different genomic environments, the avian CHD1 genes offer the possibility to unveil the effect of varying mutation rates on degree of genetic variability. We also discuss the data in the context of possible effects of selection.
| Materials and Methods |
|---|
|
|
|---|
DNA Preparation
Avian blood samples were collected in Scandinavia (collared flycatcher Ficedula albicollis, pied flycatcher Ficedula hypoleuca, willow warbler Phylloscopus trochilus, blue tit Parus caeruleus, black grouse Tetrao tetrix, and kestrel Falco tinnunculus) and in Spain (barn swallow Hirundo rustica) and were stored frozen in EDTA or heparine sulfate containing buffer to prevent coagulation. For DNA preparation, approximately 5 µl of whole blood was incubated overnight at 37°C with 300 µl of 0.1 M NaCl, 10 mM Tris-Cl (pH 8.0), 5% SDS, and 7.5 µl of proteinase K (8 mg/ml). Subsequently, two rounds of phenol/chloroform extraction were performed, and DNA was recovered by ethanol precipitation, dried, and redissolved in water.
PCR Amplification
The complete exon-intron structure of avian CHD1 genes has not been elucidated; hence, we arbitrarily designated the introns studied herein intron A and intron B. For CHD1W, intron A was amplified using primers 2464F (ATACTTGAAGTATGGTCAGTT) and 2781R (Fridolfsson and Ellegren 1999
), and intron B was amplified using primers 2987F and 3112R (Ellegren and Fridolfsson 1997
); these primer pairs consistently revealed W-specific amplification. For CHD1Z, the corresponding introns were amplified with primers 2550F (Ellegren and Fridolfsson 1997
) and 2781R and with 3007F (Fridolfsson and Ellegren 1999
) and 3112R, respectively. Amplification products obtained with these primers contained short parts of exonic sequence in their ends. Unless otherwise stated, these were excluded from analyses. The 20-µl PCR reactions contained 0.2 µM of each primer, 0.2 µM dNTP, 0.04 U AmpliTaq (Perkin Elmer; AmpliTaq Gold for primer pair 2464F-2781R), 1 x AmpliTaq buffer, and 2050 ng DNA. The MgCl2 concentrations used in the reactions were 3 mM for CHD1W intron A, 2.5 mM for CHD1Z intron A, and 2 mM for the others. The following PCR profiles were used in a Perkin-Elmer 9600 thermo cycler: 2987F-3112R and 3007F-3112R95°C for 2 min, 3 x (94°C for 30 s, 60°C for 30 s, and 72°C for 30 s), 29 x (94°C for 30 s, 55°C for 30 s, and 72°C for 30 s); 2464F-2781R95°C for 5 min, 62°C for 30 s, and 72°C for 20 s, 10 x (94°C for 40 s, touchdown 6052°C for 30 s [decreasing 1°C/cycle], and 72°C for 30 s), 35 x (94°C for 30 s, 50°C for 30 s, and 72°C for 40 s); 2550F-2781R95°C for 2 min, 5 x (94°C for 30 s, touchdown 6052°C for 30 s [decreasing 2°C/cycle], and 72°C for 30 s), 27 x (94°C for 30 s, 55°C for 30 s, and 72°C for 50 s). All programs were ended with an extended elongation step of 72°C for 5 min.
Single-Strand Conformation Polymorphism Analysis
PCR products were analyzed for sequence variation using single-strand conformation polymorphism (SSCP). Prior to electrophoresis, 2 µl of PCR product was mixed with 6 µl formamide containing loading buffer, denatured at 96°C for 3 min, and kept on ice. Twelve percent polyacrylamide gels were run at 1 W for 2124 h at 20°C and then silver-stained. The silver staining procedure involved fixation in 10% acetic acid for 20 min, two washes in deionized water, staining in 1 g/liter AgNO3 for 40 min, a short wash in deionized water, and development in Na2CO3 until bands were clearly visible.
Cloning and Sequencing
PCR products of heterozygous males and occasionally also of other templates were cloned. This was done either by blunt-ending and dephosphorylation of PCR products, followed by ligation into SmaI cut pUC18 plasmids, or by using the pGEM T-vector kit from Promega. The identities of inserts were tested by PCR with original primers, and appropriate plasmid DNAs were subsequently purified using a Miniprep kit (Saveen). Plasmids and PCR products (the latter of which had been purified by Qiaquick columns; Qiagen) were cycle-sequenced with BigDye terminator chemistry and analyzed on an ABI 377 automated sequencer (Perkin-Elmer). All sequences observed in this study have been submitted to GenBank under accession numbers AF294630AF294645 and AF364551AF364558.
Data Analysis
DNA sequences were edited and aligned in the programs Sequencher 3.0 (Gene Codes Corp.) and Sequence Navigator 1.0 (Applied Biosystems). Estimates of nucleotide diversity (
and
) were obtained and HKA tests (Hudson, Kreitman, and Aguadé 1987
) for departure from neutrality were performed using the program DnaSP 3.0 (Rozas and Rozas 1999
). The HKA test is a test that relates intraspecific polymorphism at two loci (in this case, CHD1Z and CHD1W) to interspecific divergence at the same two loci. Resampling of sequences and sites was performed using a program written in C++. The proportion of subsamples having more than zero segregating sites was used as the probability that the level of polymorphism was higher on the Z chromosome than on the W chromosome. Probabilities from individual species were combined according to Sokal and Rohlf (2000
, p. 795).
| Results |
|---|
|
|
|---|
We amplified two paralogous introns of the CHD1Z and CHD1W genes in five avian species (collared flycatcher, pied flycatcher, barn swallow, willow warbler, and blue tit) and assessed the levels of nucleotide diversity by SSCP analysis of population samples of unrelated individuals (table 1 ). For two additional species (black grouse and kestrel), one of the introns was analyzed in the same way. Identified alleles were subsequently sequenced. Intron A varied in size between 449 and 494 bp on the Z chromosome and between 280 and 364 bp on the W chromosome. The size of intron B was 232240 bp and 278281 bp on the Z and W chromosomes, respectively. Levels of genetic variability were strikingly higher on the Z chromosomes of all seven bird species than on their W chromosomes. For instance, with the seven species taken together, there were 37 segregating sites (K) in about 3.8 kb of intronic Z chromosome sequence, screened in an average of 38 chromosomes (about one segregating site every 100 bp). In sharp contrast, there was no genetic variation whatsoever in 3.4 kb of intronic W chromosome sequence, screened in an average of 22 chromosomes. Thus, the avian W chromosome appears to be very low in genetic variability. The observation of seven out of seven species being polymorphic for CHD1Z but monomorphic for CHD1W rejects a null hypothesis of equal levels of genetic variability on the Z and W sex chromosomes (P = 0.0078; signs test). However, since the numbers of sites as well as numbers of screened individuals generally were higher for CHD1Z than for CHD1W, we made 1,000 subsamples of CHD1Z intron A and B sequences to perfectly match the sample sizes of CHD1W. Combining the probabilities of polymorphism at CHD1Z exceeding that of CHD1W in this way obtained for each species revealed a highly significant difference (
2 = 52.1, P < 0.001, df = 14).
|
Nine out of 12 Z introns were polymorphic, with the two introns of willow warbler showing the highest degree of genetic variability (table 1 ). With introns A and B taken together, the average pairwise nucleotide diversity (
) between Z chromosome copies varied between 0.00015 for collared flycatcher and 0.0083 for willow warbler (mean, 0.0020). Excluding collared flycatcher or willow warbler gave means of 0.0023 and 0.00093, respectively. Generally, values of the expected nucleotide diversity
were similar to values of
(table 1
), with a mean of 0.0021. In all species except the blue tit, Tajima's D showed no deviation from neutral evolution in Z introns (with D ranging from -0.877 [collared flycatcher] to 1.583 [black grouse]), although the test had relatively low power in this case (Simonsen, Churchill, and Aquadro 1995
Levels of genetic variability at the Z and W chromosomes may not be directly comparable, since nucleotide diversity in neutral DNA sequences is also governed by the effective population size (Crow and Kimura 1970
). With an infinite-sites model,
equals nNeu, where n is the number of haploid sets of chromosomes per breeding pair, Ne is the effective population size, and u is the mutation rate. For the avian Z and W sex chromosomes, n is 3 and 1, respectively. We should thus expect genetic variability on Z to be three times as high as that on W merely due to this fact. Correcting for effective population size (i.e., dividing variability estimates by three),
corr and
corr for CHD1Z introns became 0.00066 and 0.00070, respectively. It is difficult to quantify the relative excess of polymorphism on the Z chromosome compared with the W chromosome given that the latter was monomorphic in our sample. If there had been a single rare allele (e.g., a frequency of 5%) in one of the surveyed W chromosome introns, we would have arrived at
and
values of approximately 0.00004 and 0.00010, respectively, for the W chromosome. We thus conclude that our data suggest the degree of genetic variability on the avian Z chromosome to be at least about 10 times as high as that on the W chromosome, even when effective population size has been corrected for. However, it should be noted that we cannot formally support this quantitative statement with statistical evidence, as there was no variation on the W chromosome.
| Discussion |
|---|
|
|
|---|
Is Selection Shaping Genetic Variability on the Avian W Chromosome?
The contrasting levels of nucleotide diversity on the avian sex chromosomes revealed by this study, with Z being more variable than W, are in the direction predicted from a male-biased mutation rate. However, this does not necessarily mean that mutation rate variation is the only factor behind the difference in polymorphism levels. In the analysis, we assumed intronic sequences to be selectively neutral, an assumption which in many cases seems appropriate (Li 1997
2 = 15.28, df = 12, NS) or are not applicable (Tajima's D, Fu and Li's D* and F* tests), since the W chromosome was monomorphic in our sample.
It is thus difficult to evaluate the possible role of selection based on our sequence data. Are there other lines of evidence which might argue for or against an effect from selection at linked loci on the W chromosome? Relevant to this question is the fact that it is unclear if the avian W chromosome contains a sex-determining locus (Raymond et al. 1999
; Smith et al. 1999
; Ellegren 2000b, 2001
). Overall, the nonrecombining part of the avian W chromosome contains very few coding sequences (Ellegren 2000b
). Only three expressed genes have so far been identified across avian lineages: CHD1W (Ellegren 1996
; Griffiths, Daan, and Dijkstra 1996
), the
subunit of ATP synthase (ATP5A1W; Dvorák et al. 1992
; Fridolfsson et al. 1998
), and a modified variant of the protein kinase C inhibitor PKCIW (Hori et al. 2000
; O'Neill et al. 2000
). Although it is difficult to make a quantitative assessment, this suggests that the deleterious mutation rate of the avian W chromosome may not be high enough for background selection to reduce nucleotide diversity (cf. Charlesworth, Morgan, and Charlesworth 1993
; Nachman 1998
; Zuruvcova and Eanes 1999). Moreover, two of the three W-linked genes (CHD1W and ATP5A1W) have paralogs on the Z chromosome which are very similar on the amino acid level (97%98% identity for CHD1), as well as on the nucleotide level (the frequency of nonsynonymous substitutions is 0.0150.02 for CHD1; Fridolfsson and Ellegren 2000
; Carmichael et al. 2000
). This may suggest that CHD1Z and CHD1W, as well as ATP5A1Z and ATP5A1W, share functional properties to the extent that these gene pairs could in fact be seen as allelic variants of the same proteins. In line with this, an analysis of the molecular evolution of CHD1W provided no evidence for positive selection (Fridolfsson and Ellegren 2000
), which would have been suggestive of a female-specific role. If these observations represent a general pattern for W-linked genes in birds, selective sweeps may not be a common feature shaping the degree of genetic variability on the avian W chromosome.
Effects of Reproduction and Migration
In theory, reproductive skewness (sexual selection) and female migration could cause rapid spread of W chromosomes, thereby acting to reduce the levels of genetic variability on W relative to Z. However, polyandry, leading a few females to mother a disproportionally large number of offspring, is rare among birds (Waite and Parker 1997; Ligon 1999
). Indeed, male passerine birds generally tend to be more philopatric than females (Clarke, Saether, and Roskaft 1997
), but the overall picture for many species, including at least the barn swallow (Møller 1994
) and the collared flycatcher (Pärt 1995
) analyzed in this study, is that of weak dispersal among both sexes. Therefore, reproduction and migration can likely be ruled out as being important in this context.
Genetic Variability of X and Y Sex Chromosomes
While this is the first report of contrasting levels of genetic variability on the two sex chromosomes of organisms with female heterogamety (ZW), such data are available for some organisms with male heterogamety (XY). Among the latter, we might expect higher levels of genetic variability on the Y than on the X chromosome (corrected for the difference in effective population size) if the mutation rate is male-biased. However, several reports have pointed in the opposite direction. For instance, genetic variability of the human Y chromosome has been claimed to be low (Jakubiczka et al. 1989
; Ellis et al. 1990
; Malaspina et al. 1990
; Dorit, Akashi, and Gilbert 1995
; Jobling and Tyler-Smith 1995
; Whitfield, Sulston, and Goodfellow 1995
; Hammer et al. 1997
), a situation commonly attributed to the effect of selective sweeps. For example, a recent comparison of nucleotide diversity in a 16.5-kb region on the Y chromosome and in a 5-Mb region on the human X chromosome, with the latter using the solid-phase chemical mismatch-cleavage method, revealed a twofold deficit of variation on Y relative to X (Anagnostopoulos et al. 1999
; effective population size taken into account). However, it has been argued that the interpretation of selective sweeps lacks firm support, since most tests of neutrality of human Y-linked sequences fail to reject neutral models (Hammer 1995
). Indeed, some recent comparisons of several Y-linked, X-linked, and autosomal sequences indicate that there is at most only a modest reduction in human Y chromosome variability (Nachman 1998
; Jaruzelska, Zietkiewicz, and Labuda 1999
). Similar to our study, however, the low intraspecific variability typically seen in studies of the human Y chromosome will inevitably give low statistical power in HKA and Tajima tests (Nachman 1998
; Jaruzelska, Zietkiewicz, and Labuda 1999
). Perhaps there are intrinsic differences in the evolutionary rates of different Y chromosome sequences that can explain the varying results of different studies. For instance, it appears that both ZFY and ZFX evolve slowly and are unusually low in polymorphism (Hammer 1995
; Huang et al. 1998
; Jaruzelska, Zietkiewicz, and Labuda 1999
). However, an important conclusion from these studies is that the human Y chromosome is at least not associated with an unusually high degree of polymorphism, as would be predicted from a male-biased mutation rate.
Low levels of Y-chromosome variation have also been documented in other taxa. In the dioecious plant Silene latifolia, DNA polymorphism in a 2-kb genomic region of the Y-linked SLY-1 gene (including both exons and introns) was found to be 20-fold lower than in paralogous sequences of the X-linked SLX-1 gene (Filatov et al. 2000
). In Drosophila melanogaster and Drosophila simulans, nucleotide diversity in the Y-linked Dhc-Yh3 gene was about an order of magnitude less than that predicted from data on autosomal and X-linked sequences (Zurovcova and Eanes 1999
). The fact that the Drosophila Y chromosome has a low gene number led Zurovcova and Eanes (1999)
to favor adaptive sweeps as explaining the deficit of Y-chromosome variation. It should be noted that the mutation rate in Drosophila is probably not sex-biased (Bauer and Aquadro 1997
). In the Silene study, on the other hand, the pattern of nucleotide diversity in Y chromosome sequences (no singletons among polymorphic sites) was not consistent with selective sweeps (Filatov et al. 2000
).
Methodological Aspects
One potentially confounding factor affecting the degree of nucleotide diversity seen in this study is the efficiency of the SSCP technique in uncovering polymorphisms. Previous studies have suggested that SSCP analysis detects well above 80% of polymorphisms and in some cases as much as 98%, depending on fragment length (Hayashi 1991
; Hayashi and Yandell 1991
; Jaruzelska, Zietkiewicz, and Labuda 1999
). It seems reasonable to assume that SSCP efficiency should depend on sequence characteristics of the fragment being assayed. Importantly, since we analyzed Z- and W-chromosome fragments with significant sequence homology, it is difficult to see that the relative efficiency of SSCP detection could have been dramatically different for CHD1Z and CHD1Z introns. In fact, sequencing of 10 males and 10 females of both pied flycatcher and collared flycatcher did not uncover any additional polymorphisms compared with that detected with SSCP. Moreover, in addition to arguing against possible methodological artifacts, the use of homologous introns should also warrant that sequence-specific effects are avoided (e.g., due to distinctly different GC contents).
| Conclusions |
|---|
|
|
|---|
From the studies of humans, Drosophila, and Silene, there is no general consensus in patterns and interpretations of the relative degrees of nucleotide diversity on the sex chromosomes of different lineages. A small number of genes on the avian W chromosome parallel the situation in Drosophila and may argue against background selection as an explanation of the large excess of genetic variability seen on Z relative to W. However, some arguments can also be used against selective sweeps as a strong factor shaping the genetic variability on the W chromosome. Moreover, we observed low W-chromosome variability in all seven bird species studied, and it may be unlikely that selective sweeps are common enough to give this pattern. It can thus be argued that the contrasting levels of nucleotide diversity on the avian sex chromosomes are due to a male-biased mutation rate. Although this is a tempting interpretation, the question is whether the data tie in quantitatively with the estimated male bias (
) to the mutation rate. We and others have estimated
at 25 in different avian lineages (Ellegren and Fridolfsson 1997
is in agreement with the observed levels of nucleotide diversity on Z and W. We therefore conclude that while our data point in a direction predicted from a male-biased mutation rate, we cannot exclude effects of selection as explaining the low levels of nucleotide diversity of the avian W chromosome.
| Acknowledgements |
|---|
|
|
|---|
We thank Martin Lascoux for helpful discussions and Simon Griffith, Jacob Höglund, and Ben Sheldon for samples. Financial support was obtained from the Swedish Natural Sciences Research Council. H.E. is a Royal Swedish Academy of Sciences Research fellow supported by a grant from the Knut and Alice Wallenberg foundation.
| Footnotes |
|---|
Diethard Tautz, Reviewing Editor
1 Keywords: germ line
male bias
mutation
selective sweep
background selection
sex chromosomes ![]()
2 Address for correspondence and reprints: Hans Ellegren, Department of Evolutionary Biology, Evolutionary Biology Centre, Uppsala University, Norbyvägen 18D, SE-752 36 Uppsala, Sweden. hans.ellegren{at}ebc.uu.se
. ![]()
| References |
|---|
|
|
|---|
Agulnik A. I., C. E. Bishop, J. L. Lerner, S. I. Agulnik, V. V. Solovyev, 1997 Analysis of mutation rates in the SMCY/SMCX genes shows that mammalian evolution is male driven Mamm. Genome 8:134-138[ISI][Medline]
Anagnostopoulos T., P. M. Green, G. Rowley, C. M. Lewis, F. Giannelli, 1999 DNA variation in a 5-MB region of the X chromosome and estimates of sex-specific/type-specific mutation rates Am. J. Hum. Genet 64:508-517[ISI][Medline]
Bauer V. L., C. F. Aquadro, 1997 Rates of DNA sequence evolution are not sex-biased in Drosophila melanogaster and D. simulans Mol. Biol. Evol 14:1252-1257[Abstract]
Carmichael A., A. K. Fridolfsson, J. Halverson, H. Ellegren, 2000 Male-biased mutation rates revealed from Z- and W-chromosome linked ATP synthase
-subunit (ATP5A1) sequences in birds J. Mol. Evol 50:443-447[ISI][Medline]
Chang B. H.-J., L. C. Shimmin, S.-K. Shuye, D. Hewett-Emmett, W.-H. Li, 1994 Weak male-driven molecular evolution in rodents Proc. Natl. Acad. Sci. USA 91:827-832
Charlesworth B., 1996 The evolution of chromosomal sex determination and dosage compensation Curr. Biol 6:149-162[ISI][Medline]
Charlesworth B., M. T. Morgan, D. Charlesworth, 1993 The effect of deleterious mutations on neutral molecular variation Genetics 134:1289-1303[Abstract]
Clarke A. L., B. E. Saether, E. Roskaft, 1997 Sex biases in avian dispersal: a reappraisal Oikos 79:429-438
Crow J. F., M. Kimura, 1970 An introduction to population genetic theory Harper and Row, New York
Dorit R. L., H. Akashi, W. Gilbert, 1995 Absence of polymorphism at the ZFY locus on the human Y chromosome Science 268:1183-1185
Dvorák J., J. L. Halverson, P. Gulick, K. A. Rauen, U. K. Abbott, B. J. Kelly, F. T. Shultz, 1992 cDNA cloning of a Z-linked and W-linked gene in Gallinaceous birds J. Hered 83:22-25
Ellegren H., 1996 First gene on the avian W chromosome (CHD) provides a tag for universal sexing of non-ratite birds Proc. R. Soc. Lond. B 263:1635-1641[Medline]
. 2000a. Heterogenous mutation processes in human microsatellite DNA sequences Nat. Genet 24:400-402[ISI][Medline]
. 2000b. Evolution of the avian sex chromosomes and their role in sex determination Trends Ecol. Evol 15:188-192[Medline]
. 2001 Hens, cocks and avian sex determination: a quest for genes on Z or W? EMBO Rep 2:192-196[ISI][Medline]
Ellegren H., A. K. Fridolfsson, 1997 Male-driven evolution of DNA sequences in birds Nat. Genet 17:182-184[ISI][Medline]
Ellis N., P. Yen, K. Neiswanger, L. Shapiro, P. N. Goodfellow, 1990 Evolution of the pseudoautosomal boundary in Old World monkeys and great apes Cell 63:977-986[ISI][Medline]
Filatov D. A., F. Monéger, I. Negrutiu, D. Charlesworth, 2000 Low variability in a Y-linked plant gene and its implications for Y-chromosome evolution Nature 404:388-390[Medline]
Fridolfsson A.-K., H. Cheng, N. G. Copeland, N. A. Jenkins, H. C. Liu, T. Raudsepp, T. Woodage, B. Chowdhary, J. Halverson, H. Ellegren, 1998 Evolution of the avian sex chromosomes from an ancestral pair of autosomes Proc. Natl. Acad. Sci. USA 95:8147-8152
Fridolfsson A. K., H. Ellegren, 1999 A simple and universal method for molecular sexing of non-ratite birds J. Avian Biol 30:116-121
. 2000 Molecular evolution of the avian CHD1 genes in the Z and W sex chromosomes Genetics 155:1903-1912
Garcia-Moreno J., D. P. Mindell, 2000 Rooting a phylogeny with homologous genes on opposite sex chromosomes (gametologs): a case study using avian CHD Mol. Biol. Evol 17:1826-1832
Griffiths R., S. Daan, C. Dijkstra, 1996 Sex identification in birds using two CHD genes Proc. R. Soc. Lond. B Biol. Sci 263:1251-1256[Medline]
Hammer M. F., 1995 A recent common ancestry for human Y chromosomes Nature 378:376-378[Medline]
Hammer M. F., A. Spurdle, T. Karafet, E. T. Wood, A. Novelletto, P. Malaspina, R. J. Mitchell, S. Horai, T. Jenkins, S. L. Zegura, 1997 The geographical distribution of human Y chromosome variation Genetics 145:785-805
Hayashi K., 1991 PCR-SSCP: a simple and sensitive method for detection of mutations in the genomic DNA PCR Methods Appl 1:34-38[Medline]
Hayashi K., D. W. Yandell, 1991 How sensitive is PCR-SSCP? Hum. Mutat 2:338-346
Hori T., S. Asakawa, Y. Itoh, N. Shimizu, S. Mizuno, 2000 Wpkci, encoding an altered form of PKCI, is conserved widely on the avian W chromosome and expressed in early female embryos: implication of its role in female sex determination Mol. Biol. Cell 11:3645-3660
Huang W., B. H.-J. Chang, X. Gu, D. Hewett-Emmett, W.-H. Li, 1997 Sex differences in mutation rate in higher primates estimated from AMG intron sequences J. Mol. Evol 44:463-465[ISI][Medline]
Huang W., Y. X. Fu, B. H-J. Chang, X. Gu, L. B. Jorde, W.-H. Li, 1998 Sequence variation in ZFX introns in human populations Mol. Biol. Evol 15:138-142[Abstract]
Hudson H. H., N. L. Kaplan, 1995 Deleterious background selection with recombination Genetics 141:1605-1617[Abstract]
Hudson R. R., M. Kreitman, M. Aguad, 1987 A test of neutral molecular evolution based on nucleotide data Genetics 116:153-159
Hurst L. D., H. Ellegren, 1998 Sex differences in the mutation rate Trends Genet 14:446-452[ISI][Medline]
Jakubiczka S., J. Arnemann, H. J. Cooke, M. Krawczak, J. Schmidtke, 1989 A search for restriction fragment length polymorphism on the human Y chromosome Hum. Genet 84:86-88[ISI][Medline]
Jaruzelska J., E. Zietkiewicz, D. Labuda, 1999 Is selection responsible for the low level of variation in the last intron of the ZFY locus? Mol. Biol. Evol 16:1633-1640[Abstract]
Jobling M. A., C. Tyler-Smith, 1995 Fathers and sons: the Y chromosome and human evolution Trends Genet 11:449-456[ISI][Medline]
Kahn N. W., T. W. Quinn, 1999 Male-driven evolution among Eoaves? A test of the replicative division hypothesis in a heterogametic female (ZW) system. J. Mol. Evol 49:750-759[ISI][Medline]
Kaplan N. L., R. R. Hudson, C. H. Langley, 1989 The "hitch-hiking effect" revisited Genetics 123:887-899
Kimura M., 1983 The neutral theory of evolution Cambridge University Press, Cambridge, England
Li W.-H., 1997 Molecular evolution Sinauer, Sunderland, Mass
Ligon J. D., 1999 The evolution of avian breeding systems Oxford University Press, Oxford, England
Malaspina P., F. Persichetti, A. Novelletto, C. Iodice, L. Terrenato, J. Wolfe, M. Ferraro, G. Prantera, 1990 The human Y chromosome shows low level of DNA polymorphism Ann. Hum. Genet 54:297-305[ISI][Medline]
Maynard-Smith J., J. Haigh, 1974 The hitch-hiking effect of a favourable gene Genet. Res 23:23-35[ISI][Medline]
Miyata T., H. Hayashida, K. Kuma, K. Mitsuyasu, T. Yasunaga, 1987 Male-driven molecular evolution: a model and nucleotide sequence data Cold Spring Harb. Symp. Quant. Biol 52:863-867[ISI][Medline]
Møller A. P., 1994 Sexual selection and the barn swallow Oxford University Press, Oxford, England
Nachman M. W., 1998 Y chromosome variation of mice and men Mol. Biol. Evol 15:1744-1750[Abstract]
O'Neill M. J., M. D. Binder, C. A. Smith, J. Andrews, K. Reed, M. J. Smith, C. Miller, D. Lambert, A. H. Sinclair, 2000 ASW: a gene with conserved avian W-linkage and female specific expression in chick embryonic gonad Dev. Genes Evol 210:243-249[ISI][Medline]
Pärt T., 1995 The importance of local familiarity and search costs for age-biased and sex-biased philopatry in the collared flycatcher Anim. Behav 49:1029-1038
Pecon Slattery J., S. J. O'Brien, 1998 Patterns of Y and X chromosome DNA sequence divergence during the Felidae radiation Genetics 148:1245-1255
Raymond C. S., J. R. Kettlewell, B. Hirsch, V. J. Bardwell, D. Zarkower, 1999 Expression of Dmrt1 in the genital ridge of mouse and chicken embryos suggests a role in vertebrate sexual development Dev. Biol 215:208-220[ISI][Medline]
Rice W. R., 1987 Genetic hitchhiking and the evolution of reduced genetic activity of the Y sex chromosome Genetics 116:161-167
Rozas J., R. Rozas, 1999 DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis Bioinformatics 15:174-175
Shimmin L. C., B. H.-J. Chang, W.-H. Li, 1993 Male driven evolution of DNA sequences Nature 362:745-747[Medline]
Simonsen K. L., G. A. Churchill, C. F. Aquadro, 1995 Properties of statistical tests of neutrality for DNA polymorphism data Genetics 141:413-429[Abstract]
Smith C. A., P. J. McClive, P. S. Western, K. J. Reed, A. H. Sinclair, 1999 Conservation of a sex-determining gene Nature 402:601-602[Medline]
Sokal R. R., F. J. Rohlf, 2000 Biometrythe principles and practice of statistics in biological research 3rd edition. W. H. Freeman, New York
Stephan W., T. H. Wiehe, M. W. Lenz, 1992 The effect of strongly selected substitutions on neutral polymorphism: analytical results based on diffusion theory Theor. Popul. Biol 41:237-254
Waite T. A., P. G. Parker, 1997 Extrapair paternity and the effective size of socially monogamous populations Evolution 51:620-621
Whitfield L. S., J. E. Sulston, P. N. Goodfellow, 1995 Sequence variation of the human Y chromosome Nature 378:379-380[Medline]
Zurovcova M., W. F. Eanes, 1999 Lack of nucleotide polymorphism in the Y-linked sperm flagellar dynein gene Dhc-Yh3 of Drosophila melanogaster and D. simulans Genetics 153:1709-1715
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
R. Bergero, A. Forrest, and D. Charlesworth Active Miniature Transposons From a Plant Genome and Its Nonrecombining Y Chromosome Genetics, February 1, 2008; 178(2): 1085 - 1092. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Truyens, M. M. Arbo, and J. S. Shore Phylogenetic relationships, chromosome and breeding system evolution in Turnera (Turneraceae): inferences from its sequence data Am. J. Botany, October 1, 2005; 92(10): 1749 - 1758. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Berlin and H. Ellegren Chicken W: A genetically uniform chromosome in a highly variable genome PNAS, November 9, 2004; 101(45): 15967 - 15969. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ceplitis and H. Ellegren Adaptive Molecular Evolution of HINTW, a Female-Specific Gene in Birds Mol. Biol. Evol., February 1, 2004; 21(2): 249 - 254. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Hellborg and H. Ellegren Low Levels of Nucleotide Diversity in Mammalian Y Chromosomes Mol. Biol. Evol., January 1, 2004; 21(1): 158 - 163. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sundstrom, M. T. Webster, and H. Ellegren Is the Rate of Insertion and Deletion Mutation Male Biased?: Molecular Evolutionary Analysis of Avian and Primate Sex Chromosome Sequences Genetics, May 1, 2003; 164(1): 259 - 268. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Galian, J. E. Hogan, and A. P. Vogler The Origin of Multiple Sex Chromosomes in Tiger Beetles Mol. Biol. Evol., October 1, 2002; 19(10): 1792 - 1796. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



