Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Sun, H.
Right arrow Articles by Li, W.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sun, H.
Right arrow Articles by Li, W.-H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Biology and Evolution 18:1905-1918 (2001)
© 2001 Society for Molecular Biology and Evolution

Isolation of Cladonema Pax-B Genes and Studies of the DNA-Binding Properties of Cnidarian Pax Paired Domains

Hongmin Sun, Douglas P. Dickinson, John Costello and Wen-Hsiung Li

Howard Hughes Medical Institute, University of Michigan Medical Center;
Department of Oral Biology, School of Dentistry, Medical College of Georgia;
Department of Biology, Providence College;
Department of Ecology and Evolution, University of Chicago


    Abstract
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Pax genes encode nuclear transcription factors that are involved in developmental control. They contain a conserved DNA-binding domain, the paired domain. The DNA-binding specificity of paired domains is directly related to the gene regulation function of Pax proteins. Pax genes were previously divided into five groups on the basis of a phylogenetic analysis of paired domains. In this study, two highly similar cnidarian Pax-B genes from Cladonema californicum, a jellyfish with eyes, were found and sequenced. In an effort to understand the function of the cnidarian Pax genes isolated in this and a previous study, we characterized the consensus DNA sequences bound by the cnidarian paired domains using a PCR-based method and electrophoretic mobility shift assays. The consensus DNA sequences obtained are very similar to those bound by mammalian Pax proteins. Comparison of known consensus sequences indicates that they are all partially palindromic, but this characteristic is most prominent in cnidarians, which suggests that the DNA sequences bound by the ancestral paired domain could have been palindromic. Also, cnidarian paired domains, like those of Pax-2/5/8, possess a broader binding specificity than other paired domains, which implies that the common ancestor of Pax-2/5/8 and Pax-4/6 paired domains could also have had a similar broad DNA-binding specificity. Thus far, a definitive Pax-6 gene has not been found in several cnidarian species examined, which is consistent with a later origin of the Pax-6 gene and raises two possibilities: the Pax genes of cnidarians are multifunctional and control two or more developmental pathways, including eye development, or they use a Pax-independent pathway for eye development. Whether this pathway does exist and is unique to cnidarians or it whether it represents a true master control under which Pax-6 was later included remains to be determined.


    Introduction
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Pax genes are developmental control genes, notably in the development of the central nervous system and certain organs such as the kidney and the eye (for reviews, see Tremblay and Gruss 1994Citation ; Dressler 1996Citation ; Callaerts, Halder, and Gehring 1997). They contain a paired box that encodes a DNA-binding domain—the paired domain—of ~128 amino acids; some Pax proteins also contain an octapeptide and a paired-type homeodomain. To date, nine different Pax genes have been isolated from humans and mice and denoted Pax-1 to Pax-9 (for a review, see Tremblay and Gruss 1994Citation ). Pax genes have also been isolated from many other animals, including sponges and cnidarians (Noll 1993Citation ; Callaerts, Halder, and Gehring 1997Citation ; Sun et al. 1997Citation ; Hoshiyama et al. 1998Citation ). The known Pax genes have been classified on the basis of a phylogenetic analysis into five groups (Sun et al. 1997Citation ): Pax-1/9, Pax-3/7, Pax-4/6, Pax-A/Pox neuro, and Pax-2/5/8/B. (Pax-A and Pax-B are from cnidarians, and Pox neuro is from Drosophila.) Pax-4/6, Pax-A/Pox neuro, and Pax-2/5/8/B form supergroup I, and Pax-1/9 and Pax-3/7 form supergroup II. Pax-6 has been extensively studied because it was shown to be a key control gene in eye development in many invertebrates, as well as in vertebrates (for a review, see Callaerts, Halder, and Gehring 1997).

Pax proteins are transcription factors with the paired domain as a DNA-specific binding domain (see Tremblay and Gruss 1994Citation ; Callaerts et al. 1998). A transcription factor binds to specific regulatory elements in the promoter or enhancer region of the target gene by its DNA-binding domain and activates or inhibits the transcription of the gene. The DNA-binding domain is the major player in linking a downstream target gene with the transcription factor. The characteristic DNA target sequences bound in the target genes usually contain short consensus sequences and can serve as labels for the transcription factors. The DNA-binding properties of different Pax proteins have been well studied. A number of natural target genes and sequences have been identified, such as Pax-5 with CD-19 and histone H2A, Pax-6 with crystallin, and Pax-8 with thyroglobin and thyroperoxidase (Barberis et al. 1990Citation ; Kozmik et al. 1992Citation ; Zannini et al. 1992Citation ; Cvekl et al. 1994Citation ). The consensus sequences bound by some Pax paired domains have also been inferred either through in vitro experimental approaches or by compiling the natural target sequences. In general, Pax paired domains tend to bind DNA as a monomer and have long, bipartite recognition sequences (Czerny, Schaffner, and Busslinger 1993Citation ; Xu et al. 1995Citation ). The recognition sequence is 15 bp long in the case of the Drosophila paired protein and >20 bp long in Pax-5 and Pax-6 (Czerny, Schaffner, and Busslinger 1993Citation ; Epstein et al. 1994Citation ).

In a previous study, we searched for Pax genes in two cnidarian species, the sea nettle (Chrysaora quinquecirrha) and the hydra (Hydra littoralis) (Sun et al. 1997Citation ). Cnidarians were chosen because Cnidaria is the most primitive animal phylum that possesses a nervous system. As noted above, a major Pax function is the control of nervous system development. Furthermore, cnidarians are not on a sideline of neuronal evolution, because they share similarities with higher animals in action potentials, synaptic transmission, neurosecretion, and neuropeptide biosynthesis (see Grimmelikhuijzen and Westfall 1995Citation ). The major purpose of our study was to identify Pax-6 homologs in cnidarians, because cnidarians are also the most primitive organisms that possess eyes. The eye structures in cnidarians vary from simple eyespots to complicated lens eyes (Land and Fernald 1992Citation ). We were unable to find a Pax gene in the sea nettle or the hydra that could be claimed with certainty to be a Pax-6 ortholog. However, the species tested also lacked true (lens) eyes, so they may not have Pax-6 because they might have diverged prior to the emergence of a true Pax-6 gene or because they might not need a Pax-6 gene.

In this study, we searched for Pax genes in Cladonema californicum, another cnidarian, because this species has lens eyes, in contrast to simple eyes in the sea nettle and no eyes in the hydra. Since the function of paired domains is specific DNA binding, the DNA-binding properties of paired domains of the same group should be phylogenetically related. Therefore, we studied the DNA-binding patterns of the isolated cnidarian paired domains and compiled their consensus recognition sequences. Here we report the characterization of the two new Pax–B-like genes from C. californicum and the consensus DNA-binding properties of five cnidarian paired domains.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
cDNA Cloning of Cladonema Pax-B
Genomic DNA and total RNA of C. californicum were isolated several times from approximately 1 mg of polyps as described previously (Sun et al. 1997Citation ). Paired-box sequences from Cladonema Pax genes were first amplified from genomic DNA by degenerate PCR. Only one paired-box sequence was isolated by this approach. The cDNA of this paired-box-containing gene was amplified by 3' and 5' RACE-PCR (Sun et al. 1997Citation ). Internal primers based on the acquired genomic paired-box sequences were designed. The primers used in 3' RACE were clpbf1 (ATTAGAAGAAAGATCGTT GAT) and clpbf2 (GTCTAGTCAAGGAGTTCGAC). Because the PCR product did not extend to the stop codon due to an A-rich region, approximately 1 µg of genomic DNA was digested with FspI, extracted with phenol-chloroform, and precipitated with ethanol. The pellet was dissolved in 6 µl water, and a polyG tail was added to the restriction fragments by terminal deoxynucleotide transferase (Promega, Madison, Wis.) in 100 mM cacodylate buffer (pH 6.8), 1 mM CoCl2, 0.1 mM DTT, and 1 mM dGTP. Primers clpbf4 (CTACCAGCCTCAGCCTGCTTC) and clpbf3 (CTGATGCTTCACAGAGGGAGC) were used in a nested PCR with oligo-dC (GTAC[C]17) to amplify downstream sequences. Then, genomic DNA was digested with restriction enzymes NaeI and NruI. A polyG tail was added, and primers clpbf7 (GGAAGTTAGCATCTCTCATCTC) and clpbf8 (CCCAAGCTTATTCAGCTGTTTC) were used with oligo-dC to amplify further downstream sequences. Primers clpbar1 (TTGAAACCGAAAAAGTACCT) and clpbar2 (CGAATACTGCTTAAGAGTAC) were designed based on the downstream genomic sequence and used with upstream primers to amplify the cDNA sequences to verify that the stop codon had been reached.

For the Cladonema 5' RACE, the primer clpbr1 (CACCTGGTCTTATTGATCCTG) was used to reverse-transcribe cDNA from RNA. A polyG tail was added to the cDNA, and primers clpbr2 (CATAGAATCGTCCTAAAATC) and clpbr6 (CCTTGACTA GGCAAATCAAGC) were used with oligo-dC to amplify the upstream sequence. In order to exclude the effect of PCR errors on the accuracy of the sequence, in total, 15 clones of the PCR fragment from clpa2 (ATCATCAGTGAAAACCCTATG) and clpar1 were sequenced in one strand and compared.

Phylogenetic Analysis
The Pax paired-domain sequences from other organisms were retrieved from GenBank (table 1 ). Sequences were first aligned with the Pileup program in the GCG package (Genetics Computer Group, Madison, Wis.), and then adjusted manually. A phylogenetic tree of Pax paired domains was inferred using the MEGA software (Kumar, Tamura, and Nei 1993Citation ). The evolutionary distances were computed under the assumption that the rate of amino acid replacement varied among sites according to the gamma distribution with {alpha} = 1, and the Neighbor-Joining method was used for tree construction.


View this table:
[in this window]
[in a new window]
 
Table 1 The Paired-Box Sequences from GenBank

 
Southern Hybridization
Ten micrograms each of human, Drosophila, planarian, and Cladonema genomic DNA was digested with EcoRI and blotted onto Zeta-probe GT membrane (Bio-Rad, Hercules, Calif.). The entire coding regions of human Pax-6 and Cladonema Pax-B paired domains were used as probes. The blot was hybridized at 60°C in 0.5 M Na2PO4, 7% SDS and washed with 2 x SSC.

Constructs
The coding regions of sea nettle Pax-A and Pax-B and hydra Pax-A and Pax-B paired domains were cloned into the BamHI/XhoI sites of the polylinker region of pCITE 4b(+) vector, and the Cladonema Pax-B paired box was cloned into EcoRI/XhoI sites of pCITE 4b(+) vector (Novagen, Madison, Wis.). Their sequences were verified and used as templates for in vitro transcription/translation in the TNT T7-coupled reticulocyte lysate system (Promega) according to the manufacturer's instructions. The paired-domain peptides from the above constructs are named SNA, SNB, HYA, HYB, and CLB.

Radioactive Consensus Recognition Sequence Selection
The oligonucleotide RANDOMER (ACGTCGAGACGGAATTCGCGGCCGC(N)26CTCGAGGGATCGTGCTGTCCCTATCG) and primers BINDR (CGATAGGGACTGAGCACGGATCCCT) and ADR1 (ACGTCGAGACGGAATTCGCGGCCGC) were synthesized. RANDOMER was made double-stranded by extending the BINDR primer with the Klenow fragment and labeling with 32P. Double-stranded RANDOMER (0.33 pmol) was incubated with 5 µl in vitro translated paired-domain peptide in 2 µg poly[d(I-C)], 10 mM HEPES (pH 7.9), 100 mM KCl, 4% Ficoll, 1 mM EDTA, and 1 mM DTT at room temperature for 1 h. Then, the DNA-peptide complex was separated in a native 6% polyacrylamide gel. The gel slices were cut from the position at which the SNA formed a shifted band with a control-binding probe. Gel slices were soaked in 80 µl TE buffer overnight, and 5 µl from the buffer was used as template for PCR amplification. The PCRs were performed with BINDR and ADR1 as primers for 30 cycles of 94°C for 30 s, 61°C for 30 s, and 72°C for 1 min. PCR products were separated in 1.5% low-melting agarose gel and the products were excised from the gel. Gel slices were soaked in 200 µl TE buffer overnight, and 8 µl was used to make a radiolabeled probe for the next round of selection. A total of four rounds of selection were performed, after which the DNA was cloned into pBluescript vector and sequenced. The consensus DNA sequences bound by SNA, SNB, and HYA were inferred by this approach. Each position in the consensus sequence was tested by a chi-square test against H0 (the probability of each nucleotide appearance is 25%). If H0 was rejected in one position, one or more dominant nucleotides would be assigned to this position. The dominant nucleotides were chosen so that they would account for >50% of cases in all sequences.

Nonradioactive Consensus Recognition Sequence Selection
The consensus recognition sequences bound by HYB and CLB were selected by a nonradioactive method. By using the binding between the S-tag in the chimerical peptide and S-protein agarose, the DNA–paired-domain complex could be coprecipitated by S-protein agarose.

The double-stranded RANDOMER (12.5 µg) was incubated with 5 µl in vitro translated paired-domain peptide in 6.5% glycerol, 0.5% NP40, 0.5 mg/ml BSA, 0.2 mM DTT, 0.7 mM EDTA, 90 mM KCl, 15 mM Tris-HCl (pH 7.5), and 1 µg poly[d(I-C)] at room temperature for 30 min. Then, 20 µl of S-protein agarose (Novagen) was added. The binding was allowed to continue for 30 min longer. Then, the agarose was pelleted by centrifugation and washed with 15 mM Tris-HCl (pH 7.5) with increasing KCl concentrations (100, 150, and 200 mM KCl). The DNA-protein complex was released from agarose by cleaving the protein with thrombin (5 U, Sigma) in 20 µl 15 mM Tris-HCl (pH 7.5) and 100 mM KCl solution. The supernatant was phenol–chloroform-cleaned, and 5 µl of the supernatant was used as template in PCR amplification using BINDR and ADF1 as primers. The PCR conditions were as follows: 30 cycles of 94°C for 30 s, 56°C for 1 min, and 72°C for 1 min. The PCR product was purified through a G-50 column (Pharmacia, Piscataway, N.J.), and 5 µl was used for the next round of selection. A total of three rounds of selection were performed before the DNA was cloned into a pZero-2 vector (Invitrogen, Carlsbad, Calif.) and sequenced.

Electrophoretic Mobility Shift Assays
The eluted selected binding oligonucleotides (8 µl) were annealed with primers BINDR and ADF1 (99°C for 5 min, 50°C for 10 min), labeled with 32P using Taq enzyme (72°C for 30 min), and then eluted into 120 µl TE through a G-50 column (Pharmacia). The labeled probes (2 µl) were used in one binding reaction with paired domain peptides. The in vitro translated peptide (5 µl) was mixed with the probe in 6.5% glycerol, 0.5% NP40, 0.5 mg/ml BSA, 0.2 mM DTT, 0.7 mM EDTA, 90 mM KCl, 15 mM Tris-HCl (pH 7.5), and 1 µg poly[dI-C] in 25°C for 30 min. Then, the DNA-protein complexes were resolved in 8% native long-range sequence gels (FMC, Rockland, Maine) containing 0.25% TBE.

Each of the complementary strands of paired-domain target sequences H2A2.2, CD19.1, CD19.2, H2B2.1, H2B2.2, 5S2A, and PRS5 were synthesized as oligonucleotides (table 2 ) and annealed in 2 x SSC/10 mM Tris-HCl (pH 8.0). The oligonucleotides were labeled with 32P by Klenow and incubated with approximately 0.4 to 0.5 pmol in vitro translated paired-domain peptide in 6.5% glycerol, 0.5% NP40, 0.5 mg/ml BSA, 0.2 mM DTT, 0.7 mM EDTA, 90 mM KCl, 15 mM Tris-HCl (pH 7.5), and 1 µg poly[dI-C] at room temperature for 30 min. The DNA-protein complex was resolved in 8% native long-range sequence gels (FMC) containing 0.25% TBE. The amount of in vitro translated peptide was measured with the S-tag rapid assay kit (Novagen).


View this table:
[in this window]
[in a new window]
 
Table 2 DNA Sequences Bound by Paired Domains Used in Electrophoretic Mobility Shift Assays

 

    Results
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Isolation of Cladonema Pax-B Genes
We carried out a search for paired boxes in C. californicum, a hydromedusa with lens eyes, using the same PCR primers previously used in searching for sea nettle and hydra paired boxes (Sun et al. 1997Citation ). The PCR fragments were cloned, and approximately 20 individual clones were sequenced. Only paired box B was found. In the cases of the sea nettle and the hydra, both paired box A and paired box B sequences would have been obtained easily from such a large sample. It is possible that paired box A either is very divergent or has been lost in Cladonema. Since the sea nettle and hydra Pax-A genes are more closely related to each other than are their Pax-B genes, Pax-A appears to be more conserved than Pax-B, and we suspect that Pax-A might have been lost in Cladonema.

RT-PCR was then used to clone the cDNA of Pax-B. An in-frame initiation methionine could not be identified unequivocally based on either homology, presence of Kozak consensus sequence, or in-frame stop codons in the presumptive 5' untranslated region. Thus, the cDNA sequence might not include all coding regions of the gene. The problem could have been due to the difficulty in isolating large amounts of intact RNA from the polyp tissue, which is very difficult to lyse. However, it is very likely that only a few amino acids in the 5' end are missing because the paired domain region is very close to the 5' end of the protein in almost all known Pax proteins. From the 15 clones of PCR fragments sequenced, two distinct cDNA sequences were identified. At the very 3' end of the two cDNAs, one sequence contains a 2-nt deletion that creates a slightly different protein. The two cDNA sequences also differ in their 3' untranslated regions (a 13-nt and a 2-nt indel) and in eight positions in their coding regions (fig. 1 ). One of the differences in the coding regions causes an amino acid substitution in the homeodomain region. Thus, it is quite likely that they represent two duplicated genes.



View larger version (85K):
[in this window]
[in a new window]
 
Fig. 1.—The cDNA sequences of Cladonema Pax-B genes. The paired-domain, octapeptide, and homeodomain regions are in bold letters. The differences in the 15 clones sequenced might be due to the differences between two forms of cDNA, population polymorphisms, or PCR errors. Only those differences that occurred in multiple clones, which cannot be due to PCR error, are indicated here, so this is an underestimated representation of the differences between the two cDNA forms. The two forms of sequences are aligned and denoted B and B' in the first and second rows, and the translated protein sequences are indicated as B/B'. Dots denote identity between B' and B DNA sequences. The B' protein sequence is shown only when it is different from the B protein sequence. GenBank accession numbers: Pax-B1, AF260127; Pax-B2, AF260128

 
Phylogenetic Analysis
A phylogenetic tree was constructed using the known paired domain sequences listed in table 1 (fig. 2 ). This tree is in agreement in most parts with the previous one (Sun et al. 1997Citation ). Drosophila ey and all Pax-6 genes belong to one cluster, although the branching order within this cluster apparently involves some errors; e.g., the clustering of human Pax-6 with Drosophila ey rather than with Amphioxus Pax-6 is incorrect. The new Pax-6 gene (Dt-Pax-6) from Girardia tigrina (a planarian) also belongs to this cluster (Callaerts et al. 1999Citation ). Moreover, mouse Pax-4 is also clustered into this group, although it appears to be very divergent. Sea nettle, hydra and Cladonema Pax-B belong to another cluster, which is grouped with the large cluster of Pax-2/5/8. The two recently cloned coral Pax genes (Pax-Cam, Pax-Aam) cluster with the Pax-A/Poxneuro subgroup. However, the phylogenetic position of the Pax-A/Poxneuro subgroup is very uncertain. The bootstrap value for clustering this group with Pax-2/5/8 is only 29%. Thus, the phylogenetic relationships among the Pax-6, Pax-A, and Pax-2/5/8 groups are not certain and might be close to a trichotomy. On the other hand, the bootstrap values for the Pax-3/7 and Pax-1/9 subgroups are quite high (95% and 87%). The bootstrap value separating the two supergroups is 81%, giving some support to the concept of two supergroups.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2.—Phylogenetic tree of paired domains. The evolutionary distances were computed under the assumption that the rate of amino acid replacement varied among sites according to the gamma distribution with {alpha} = 1, and the neighbor-joining method was used for tree construction. The names of paired domains are as in table 1

 
There are also some Caenorhabditis elegans genomic sequences homologous to the paired box, but there is currently no information about their function. To get a complete picture of the entire Pax gene family, we included the tentative C. elegans paired-domain sequences derived from the genomic sequence (Wilson et al. 1994Citation ). Caenorhabditis elegans sequence 8 is clustered with Pax-3/7 and may be a homolog of Pax-3/7, and C. elegans sequence 1 appears to be a homolog of Pax-1/9 (fig. 2 ).

Zoo-Blot Analysis of Pax Genes
In an effort to further characterize the distribution of Pax genes in Cladonema and to further test for the existence of a Pax-6 ortholog, we performed a "Zoo-blot" analysis of genomic DNA from four distantly related species: humans, Drosophila, planarians, and Cladonema. We used the human Pax-6 paired box as a probe to screen for homologous sequences. Under the experimental condition (60°C), we were able to detect several bands from both humans and Drosophila. However, no band was detected in planarians and Cladonema (fig. 3A ). Hybridization at lower temperatures generated such a high background that the bands were indistinguishable from the background. In order to prove that the amounts of genomic DNA in planarians and Cladonema were enough for single-copy gene detection under the experimental condition, the Cladonema Pax-B paired box was used to probe the same blot (fig. 3B ). A single band was detected in Drosophila, planarians, and Cladonema.



View larger version (78K):
[in this window]
[in a new window]
 
Fig. 3.—Southern blot of human, Drosophila, planarian, and Cladonema genomic DNA. A, Human Pax-6 paired box as probe. B, Cladonema Pax-B paired box as probe. C, Ethidium-bromide-stained gel of EcoRI-digested genomic DNA

 
Selection of Consensus Recognition Sequences Bound by Cnidarian Paired Domains
The consensus recognition sequences bound by sea nettle paired domains A and B and hydra A were selected by cutting the shifted DNA-protein complex from the gel and amplifying with primers flanking the random sequence. After four rounds of selection, sea nettle A and B and hydra A were found to have strong shifts with the selected sequences. Approximately 30 sequences from each of the paired domains of sea nettle A and B and hydra A were sequenced and aligned using the Pileup program (fig. 4 ). Three sequences from each sequence pool bound by the three cnidarian paired domains were picked at random and tested for binding with SNA, SNB, and HYA (fig. 5 ). The consensus recognition sequences of HYB and CLB were sequenced and aligned after three rounds of selection (fig. 4 ). An electrophoretic mobility shift assay (EMSA) was carried out after three rounds of nonradioactive selection, and strong shifted bands were observed, as in radioactive selection. Both methods have been used in selecting consensus sequences bound by Pax proteins (Epstein et al. 1994Citation ; Chalepakis and Gruss 1995Citation ). Since selection is a progressively enriching process, a pool of sequences with the highest affinities with the protein would be generated in the end. We found that the consensus recognition sequences compiled after three and four rounds of selection for the same protein were indistinguishable (data not shown). It thus appears that the pool of sequences contains the optimal sequences bound by the protein after three rounds of selection, and the consensus sequences will change very little after that. This observation makes it feasible to compare consensus sequences compiled from different methods.



View larger version (79K):
[in this window]
[in a new window]
 
Fig. 4.—Sequence alignment of selected sequences bound by cnidarian paired domains. A dot indicates sequence outside the random region of the oligonucleotide RANDOMER, and a dash indicates that there is no predominant nucleotide in one position. Consensus sequences are indicated at the bottom. SNA, SNB, and HYA recognition sequences were selected with a radioactive detection method, while HYB and CLB were selected with a nonradioactive method. A, The sequences bound by sea nettle paired domain A (SNA). B, The sequences bound by sea nettle paired domain B (SNB). C, The sequences bound by the hydra Pax-A paired domain (HYA). D, The sequences bound by the hydra Pax-B paired domain (HYB). E, The sequences bound by the Cladonema Pax-B paired domain (CLB). The nonbound sequences are separated from the bound sequences (table 3 )

 


View larger version (60K):
[in this window]
[in a new window]
 
Fig. 5.—Electrophoretic mobility shift assay of three selected sequences bound by SNA, SNB, and HYA with SNA, SNB, and HYA peptide. The selected sequences (as named in fig. 3 ) are indicated under each panel. In each panel, the order of the paired domains used is SNA, SNB, and HYA

 
The base composition percentage of each site in the consensus sequences was calculated by the Consensus program of the GCG package (Genetics Computer Group). The consensus sequence pools bound by the paired domains of sea nettle A and B and hydra A and B were relatively uniform. A consensus sequence core of GTCANGCNTGACTG can be inferred, in which N denotes any of the four bases. Seventy percent of the sequences had a G at the first position, and >80% of the sequences had the core TCANGCNTGA. The last two positions of the consensus sequence were more divergent, with the dominant bases having percentages of 50%–60%. The consensus sequences bound by cnidarian paired domains A and B from the hydra and the sea nettle were virtually the same, as shown in figure 6 .



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 6.—Consensus sequences bound by the paired domains of various Pax genes. M = A or C; Y = C or T; W = A or T; S = G or C; K = G or T; R = A or G; D = A, G, or T. A dash indicates that there is no predominant nucleotide at a position. Each position in the consensus sequences was tested with a chi-square test, and the dominant nucleotide in each position was assigned accordingly. Consensus sequences of Pax-6 and Pax-2 are from Epstein et al. (1994)Citation , those of Pax-8 and Paired (Prd) are from Jun and Desplan (1996)Citation , that of Pax-5 is from Czerny and Busslinger (1995), and that of Pax-3 is from Chalepakis and Gruss (1995)Citation

 
The consensus sequence bound by Cladonema paired domain B was less conserved than the consensus sequences bound by the paired domains of the sea nettle and the hydra. A core sequence of NTNNNGCNTGANNN was inferred from the sequence pool. This is very divergent as compared with other DNA sequences bound by hydra and sea nettle paired domains. In order to minimize the error due to carryover of nonbound sequences, it was necessary to test whether the chosen sequences could actually bind the paired domain. All of the sequences were aligned against the core sequence, TNNNGCNTGA, and mismatches with the core sequences were counted. Those sequences that had more than one mismatch were tested in the EMSA for binding with Cladonema paired domain B (table 3 and fig. 7 ). As expected, there were some nonbound sequences in the pool. With one exception (CLBO83), these were the sequences that had more than three mismatches with the core sequence. However, the majority of the sequences bound to the paired domain including some with 3 mismatches with the core sequence. The consensus recognition sequence bound by Cladonema paired domain B was then inferred again excluding the nonbound sequences. After excluding nonbound sequences, the consensus recognition sequence bound by Cladonema paired domain B was still less conserved than those of other paired domains. The consensus sequences bound by cnidarian paired domains were also compared with those of other known paired domains (fig. 6 ).


View this table:
[in this window]
[in a new window]
 
Table 3 The Binding of Cladonema Paired Domain B with DNA Sequences from the Consensus Binding Selection

 


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 7.—Electrophoretic mobility shift assay of selected sequences bound by CLB with CLB paired domain (the names of the sequences are the same as in fig. 4 )

 
DNA-Binding Patterns of Cnidarian Paired Domains
The cnidarian paired domain B clustered with the Pax-2/5/8 group in the phylogenetic analysis. It has been proposed that the Pax-2/5/8 group is very ancient. With few exceptions, such as the sea urchin Pax-B, the DNA-binding properties within this group are conserved (Czerny et al. 1997Citation ). There are some known natural DNA target sequences bound by paired domains, and different groups of paired domains show different binding patterns to these sequences (Czerny, Schaffner, and Busslinger 1993Citation ). A paired domain forms two helix-turn-helix subdomains (designated PAI for the N-terminal subdomain and RED for the C-terminal subdomain). PAI is the major DNA-binding subdomain. The RED subdomain participates in DNA binding in the Pax-2/5/8 and Pax-6 groups, but does not bind DNA in the Pax-3/7 group. A specific panel of seven target sequences was selected to test the binding patterns of cnidarian paired domains. This panel of target sequences included both class I and class II target sequences. Class I target sequences (CD19-1, H2B2.1, H2B2.2, H2A2.2) are paired domain target sequences that need both PAI and RED subdomains to bind. Class II sequences are bound only by PAI, without the participation of RED, and can be bound by all groups of paired domains. Paired domains from the Pax-3/7 group can bind only class II sequences (Czerny, Schaffner, and Busslinger 1993Citation ). The DNA-binding patterns of cnidarian paired domains were tested with this panel of sequences and compared with the published DNA-binding patterns of other paired domains that were tested with the same panel of target sequences. Of the seven target sequences tested, all could bind the Pax-5 paired domain, and two of them, CD19.1 and H2B2.2, could bind the Pax-6 paired domain. All three cnidarian paired domains B bound the seven target sequences (fig. 8 ), thus supporting the results of the phylogenetic analysis that they were clustered with the Pax-2/5/8 group. The two cnidarian paired domains A also bound all seven target sequences (fig. 8 ).



View larger version (88K):
[in this window]
[in a new window]
 
Fig. 8.—Electrophoretic mobility shift assay of SNA, HYA, SNA, HYB, and CLB with a panel of Pax-5 target sequences (table 2 )

 

    Discussion
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Pax genes belong to one of the early developmental control gene families. The specific DNA-binding domain, the paired domain, has been well conserved during evolution. We have been performing phylogenetic studies of Pax genes by searching for Pax genes in cnidarians. In this study, two closely related Pax-B genes were isolated from the hydromedusa C. californicum. The two genes probably arose from a recent duplication, although we cannot fully exclude the possibility that they represent polymorphism of the same gene in the population. We note that there are also two closely related sea nettle Pax-A genes (Sun et al. 1997Citation ). The two Cladonema Pax-B genes share identical paired domains and octapeptides, but there is one nonsynonymous substitution near the end of the homeodomain; i.e., there is either a lysine or an asparagine at amino acid position 52. All known Pax homeodomains have an arginine at this position. Since lysine is very similar to arginine biochemically, the change from arginine to lysine is expected to have little effect on the structure of the homeodomain. In a crystallographic study of DNA binding by the homeodomain, it was found that position 52 was not directly involved in DNA interactions (Wilson et al. 1995). However, it is localized close to where helix 1 crosses over helix 3. Also, its close neighbors, positions 50 and 51, both directly interact with bases in DNA-specific interactions (Wilson et al. 1995). By simulating the homeodomain structures of the two Cladonema Pax-B proteins with the Swiss-Model program (http://www.expasy.ch/swissmod/SWISS-MODEL.html), we found that the substitution had little effect on the overall structure (data not shown). The side chain orientation of position 58 was changed by this substitution, but, since position 58 is not directly involved in the interaction with the DNA, the substitution may have only a subtle effect on the structure and function of the homeodomain. The Cladonema Pax-B genes also contain a Pax-2/5/8 type octapeptide and the complete homeodomain, like the Pax-B genes of the sea nettle and the hydra, consistent with their phylogenetic grouping based on the paired domain.

In comparison to other cnidarian paired domains, Cladonema paired domain B possesses a more degenerate consensus recognition sequence (TNANGCMTGAC). Sequences with 5-bp differences from this consensus can still bind the paired domain. It is possible that this more degenerate consensus recognition sequence of Cladonema paired domain B allows for the binding of a broad spectrum of target sequences in the genome. Cladonema apparently has only a Pax-B gene, while the sea nettle and the hydra have both Pax-A and Pax-B genes. The broad binding specificity of the Cladonema Pax-B might represent an ancestral form, while the narrower binding specificity found in sea nettle and hydra Pax-B might represent specialization in Pax-B function in cnidarians that carry two distinct Pax genes. Thus, in Cladonema, Pax-B could control a relatively large set of genes, while in the sea nettle and the hydra, control is divided between two Pax genes. A more restricted binding specificity would serve to avoid cross-talk between the target genes of Pax-A and Pax-B and vice versa and allow more sophisticated developmental pathways to be constructed. It is important to note that specialization cannot be detected at the level of consensus binding sequences, and at present no cnidarian Pax target sequences are known. Another possible explanation for the degeneracy of Pax-B might be that Pax-A has been lost in Cladonema. The selection pressure to maintain specificity could be relaxed in Cladonema if there were no Pax-A to interfere with Pax-B DNA binding.

All paired domains, including cnidarian paired domains, share highly related consensus recognition sequences. It appears that there are only very minor differences between the paired domains of different groups. The cnidarian paired domains all have a core consensus recognition sequence, GTCAYGCGTGACTG, except that Cladonema paired domain B has a less conserved binding site (RTYAMGCGTGACY). This core sequence is also shared by the Drosophila paired, Pax-2, and Pax-8 paired domains. The Pax-6 paired domain has T instead of G at the third position of the core recognition sequence (80% of pooled binding sequences of the Pax-6 paired domain have T; Epstein et al. 1994Citation ) (fig. 5 ). Pax-5 and Pax-6 paired domains have longer consensus recognition sequences than other paired domains. The Pax-3 paired domain also possesses a similar consensus recognition sequence, but it has a more degenerate 5' half. However, the overall consensus recognition sequences are not sufficiently different to clearly distinguish between the paired domains on this basis alone.

The core consensus recognition sequence is an imperfect palindromic sequence, with CKTGAC partially complementary to GTCAYG. Palindromic recognition sequences are characteristic of transcription factors that bind DNA as a dimer. However, crystal structure studies have shown that paired domains only bind DNA as a monomer (Xu et al. 1995, 1999Citation ). The core sequence is mainly bound by the PAI subdomain, which is the dominant subdomain for DNA binding and is also the most conservative part of the paired domain (Czerny, Schaffner, and Busslinger 1993Citation ; Jun and Desplan 1996Citation ). One half of the partially palindromic sequence fits into the major groove, and the other half fits into the minor groove. Both halves are contacted by different amino acid residues from the PAI subdomain in the Paired paired domain (Xu et al. 1995Citation ) and by both the PAI and the RED subdomains in the case of the Pax-6 paired domain (Xu et al. 1999Citation ). This partially palindromic consensus recognition sequence may be the original target sequence of the ancestor paired domain, because it is shared by supergroup I paired domains from cnidarians to vertebrates and also by a supergroup II paired domain (Drosophila paired).

The paired domain recognition sequences show an incomplete symmetry, although there is no symmetry in the paired domain. It is intriguing to speculate that the original paired domain target sequence was a palindromic sequence recruited from the target sequences of other transcription factors and then the target sequence coevolved with its recognition paired domain, giving rise to different pairs of paired domains and target sequences. The divergence of paired domains probably arose from duplication of the common ancestral paired domain, with accumulation of mutations in duplicated copies giving rise to different types of extant paired domains. The selection probably happened at the level of protein function. A newly diversified paired domain might be able to recognize mutated target sequences. The palindromic character of the target sequence offered greater flexibility to accommodate the diversification of paired domains. It appears that the second half of the palindromic sequence is more conserved between different groups of paired domains. The paired domain contacts this conserved half of the recognition sequence in the minor groove. Mutations that affect the distribution of base composition in the minor groove abolish binding by the paired domain (Pellizzari et al. 1996Citation ). The importance of minor groove contacts may also explain why CLBO83 (table 3 ) cannot bind CLB because it has a critical difference (A to G) at position 13 (fig. 5 ), a site included in the minor groove contact. The change from AT to GC changes the composition in the minor groove. Thus, this conserved part may serve as an anchor for the common interactions between DNA and the conserved amino acid residues in the paired domain. This conserved part of DNA-protein recognition can help to prevent deleterious disruptions of the DNA-protein interaction by mutations in the paired domain or the target sequence. The more divergent half of the recognition sequence would then be allowed to accumulate more mutations and could be selected by diversified paired domains. The palindromic property is most obvious in the consensus recognition sequences of cnidarian paired domains. This probably implies that cnidarian paired domains better preserve an ancient DNA-binding property than do paired domains of higher animals. The coevolution of target sequences and paired domains will be very interesting to investigate in the future.

The cnidarian paired domain B shares the same DNA-binding pattern as Pax-5 with a specific panel of seven test target sequences which includes both class I and class II recognition sequences. The fact that the cnidarian paired domain B can bind both classes of target sequences implies that the ancestral paired domain of Pax-2/5/8 also bound DNA with the participation of both the PAI and the RED subdomains. Furthermore, the cnidarian paired domain A can also bind all seven test target sequences, suggesting that they also bind DNA with both the PAI and the RED subdomains. The Drosophila Pox neuro paired domain clusters with cnidarian Pax-A in the phylogeny, yet Pox neuro binds only to class II sequences (Czerny, Schaffner, and Busslinger 1993Citation ). This discrepancy may be attributed to the 75Q insertion in the Pox neuro paired domain, which has been shown to reduce the DNA binding of the RED subdomain in Pax-3, Pax-7, and Pax-6 (Vogan, Underhill, and Gros 1996Citation ). Therefore, it appears that the paired domains of members of the same group of Pax genes indeed share very similar DNA-binding properties, supporting the phylogeny inferred from the sequence analysis.

The Pax-2/5/8 group is very divergent and can be divided into four subgroups: (1) Human-2/5/8/sea urchin258/Drosophila sparkling, (2) cnidarian B, (3) C. elegans258, and (4) sea urchin B. The DNA-binding study of Czerny et al. (1997)Citation and the present study show that all of the subgroups have the same broad binding pattern except that sea urchin B shows a more restricted pattern. In agreement with this observation, sea urchin B is the most divergent group within the Pax-2/5/8 group in the phylogenetic tree (fig. 2 ). This study also shows that Pax-A also has the same broad binding pattern as the majority of the Pax-2/5/8 group. This implies that the restricted binding pattern of sea urchin B specifically evolved in its own lineage and that the Pax-6 lineage also evolved its specific DNA-binding pattern. Thus, it is very likely that the common ancestor of supergroup I also possessed the broad DNA-binding properties of Pax-2/5/8/A.

In comparing the DNA-binding properties of cnidarian paired domains with their homologous paired domains in higher organisms, it becomes evident that the DNA-binding properties in the same group have been highly conserved since the separation of the radiata and bilateria groups more than 600 MYA. It is the fine-tuning of the DNA-binding properties of each individual paired domain that leads to the specific interaction with downstream genes. This fine-tuning cannot be detected at the level of consensus recognition sequence because the major bases in the consensus sequence were not changed, due to the conservation of the major DNA contacting amino acid residues (Xu et al. 1995). However, the minor variations in the recognition sequences, notably in the first half of the palindromic recognition sequence, may have coevolved with the amino acid substitutions in the paired domain, which could account for the differences in the functions of different paired domains.

In light of these phylogenetic and DNA-binding studies of paired domains, we propose that the first event in the diversification of Pax genes generated ancestors for supergroups I and II. Subsequent diversification inside supergroup I generated the ancestors of the Pax-2/5/8, Pax-A, and Pax-4/6 groups, while diversification inside supergroup II generated the ancestors of Pax-1/9 and Pax-3/7. The ancestral Pax gene probably contained all three conserved regions found in modern Pax genes (the paired domain, the octapeptide, and the homeodomain), because both cnidarian Pax-B and sponge Pax-2/5/8 contain a complete paired domain and octapeptide, while cnidarian Pax-B contains the complete homeodomain and sponge Pax-2/5/8 contains a partial homeodomain (42 amino acids out of 60).

The phylogeny of supergroup I members is of particular interest because Pax-6 has been well studied in many organisms for its role as the master control gene of eye development. Although the precise phylogenetic relationships among Pax-2/5/8, Pax-A, and Pax-6 are unclear (see above), it is quite possible that the ancestor of supergroup I possessed a present-day Pax-2/5/8-like paired domain and had broad DNA-binding properties similar to the Pax-2/5/8 paired domain. Based on their studies on the coral Pax genes, Catmull et al.(1998)Citation proposed a model for Pax gene evolution. In that model, the ancestor of Pax genes possessed a Pax–A-like paired domain and a Pax–Cam-like homeodomain (a coral Pax gene; see table 1 ). In this model, the ancestral gene of the Pax-6 lineage branched out first, the Pax-2/5/8 branch diversified after the capture of octapeptide, and the last branch was the ancestor of Pax-1/9 and Pax-3/7. This model is different from our classification of Pax genes. We put the root between Pax-2/5/8/4/6 and Pax-1/9/3/7, while they put the root between Pax-6 and the rest of the family. Since there is no reliable outgroup for the paired domain, it is hard to judge between the two models. However, we think that the ancestor of supergroup I is more likely a Pax-2/5/8 type than a Pax-A type, because not only is the Pax-2/5/8 type paired domain found in cnidarians, it has also been found in sponges (Hoshiyama et al. 1998Citation ), which are the most primitive extant animals. If Pax-6 is the earliest group, it is hard to explain why no authentic Pax-6-type paired domain has been found in cnidarians and sponges in spite of extensive searches. Recently, Miller et al. (2000)Citation isolated two new coral Pax genes and remodeled their hypothesis of Pax evolution. Their second model had Pax-2/5/8/B as the most ancestral group and the coral Pax-C as a homologous gene of the Pax-4/6 group. Our model is similar to their second model, except that we put the root between Pax-2/5/8/4/6 and Pax-1/9/3/7, while they put the root between Pax-2/5/8/B and the rest of the family. To further assign a root for the tree, more data from primitive animals such as sponges are needed.

So-called Zoo-blots are a useful tool to examine the phylogenetic distribution of genes. A Zoo-blot with human, Drosophila, planarian, and Cladonema genomic DNA probed with the entire human Pax-6 paired-box cDNA probe under low stringency detected multiple bands in both humans and Drosophila, but no band was detected in Dugesia or Cladonema. Despite extensive efforts, we have been unable to demonstrate cross-hybridization between human and Cladonema pax genes: they are simply too divergent to be detectable by Southern blotting using homologous probes, and efforts to further reduce stringency produce unacceptable lane backgrounds that obscure any signal. Therefore, the question of the existence or absence of a Cladonema Pax-6 gene remains open. However, empirically, we can establish a range for the similarity between the human Pax-6 paired domain and a putative Cladonema domain. Based on the Drosophila genomic sequence in GenBank, we were able to assign the Drosophila hybridization bands detected with the human Pax-6 paired box probe. One of the weak bands was a 6.1-kb EcoRI fragment from the toy gene of Drosophila. The paired-box region from this fragment is about 67% identical to the probe. In contrast, the nucleotide similarity between Dugesia Pax-6 (which is not detected) and the human probe is 63%. The similarity between Cladonema Pax-B and the human probe is only 60%. This allows us to empirically set an upper limit of roughly 63% to 67% similarity for a Cladonema gene that is present but undetected. In the human genome, the Pax-2, Pax-5, and Pax-8 paired boxes have comparable nucleotide similarities with the Pax-6 paired box (68%, 65%, and 62%, respectively). Although nucleotide similarity is a poor indicator of divergence, these results suggest that a putative Cladonema Pax-6 is more divergent from human Pax-6 than human Pax-2, Pax-5, and Pax-8 are from Pax-6. This would suggest that either there is no Pax-6 gene in Cladonema or there is a very divergent Pax-6 gene that is almost unidentifiable. However, given the failure to detect a Pax-6 ortholog by any method, along with the predicted phylogeny, we must consider the possibility that there simply is no Pax-6 gene in Cladonema, which has important implications.

In summary, our studies indicate that the ancestral Pax gene of supergroup I had a paired domain, an octapeptide, and a complete homeodomain based on the broad phylogenetic distribution of these domains in this supergroup. This ancestral paired domain had relatively broad DNA-binding specificity, and binding probably involved both N- and C-terminal subdomains of the paired domain. This broad DNA-binding property persists in modern Pax-2/5/8/B and Pax-A proteins. The ancestral target sequences of the paired domain were likely to have contained a palindromic or partial palindromic core sequence (as found in consensus sequences bound by cnidarian paired domains). Subsequent evolution of Pax genes involved duplications and recruitment of genes under the control of Pax genes, perhaps by recognition of palindromic target sequences of other transcription factor–binding sites in these genes. Coevolution of Pax genes and their target sites likely involved anchoring of the paired domain to the 3' proximal half-site of the core recognition sequence, and divergence in the recognized 5' proximal half of palindromic sites and the paired domain.

The potential lack of a Pax-6 like gene in cnidaria raises interesting question about the development of the cnidarian eyes. There are two possible scenarios. The first scenario is that the Pax genes of cnidarians are multifunctional genes that are also able to control eye development. Consistent with this, Pax-B-like genes have been isolated from all cnidarian species studied so far. Furthermore, cnidarian paired domain B possesses a broader DNA-binding property than does the Pax-6 paired domain. Cnidarian Pax-B also possesses all three conserved protein domains of the Pax family. The second scenario is that cnidarians have developed a Pax-independent pathway for eye development. Then, the Pax-6 gene would have been recruited into the eye pathway after the separation of cnidaria from bilateria. In this scenario, the common eye master control genes upstream of Pax-6 would still need to be found. Alternatively, the cnidarians may have evolved a unique pathway of eye development.



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 4 (Continued)

 

    Acknowledgements
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
We thank Casey Bergman and two anonymous reviewers for their comments. This study was supported by NIH grant HD38287 and assistance from the Texas Advanced Research Program (011618-061) to W.-H.L. H.S. was a recipient of the Schissler Fellowship for Human Genetics.


    Footnotes
 
David Irwin, Reviewing Editor

1 Keywords: Pax genes Cladonema californicum cnidarian paired domains DNA-binding property Back

2 Address for correspondence and reprints: Wen-Hsiung Li, Department of Ecology and Evolution, University of Chicago, 1101 East 57th Street, Chicago, Illinois 60637. whli{at}uchicago.edu . Back


    References
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 

    Barberis A., G. Superti-Furga, L. Vitelli, I. Kemler, M. Busslinger, 1989 Developmental and tissue-specific regulation of a novel transcription factor of the sea urchin Genes Dev 3:663-675[Abstract/Free Full Text]

    Barberis A., K. Widenhorn, L. Vitelli, M. Busslinger, 1990 A novel B-cell lineage-specific transcription factor present at early but not late stages of differentiation Genes Dev 4:849-859[Abstract/Free Full Text]

    Callaerts P., G. Halder, W. J. Gehring, 1997 PAX-6 in development and evolution Annu. Rev. Neurosci 20:483-532[Web of Science][Medline]

    Callaerts P., A. M. Munoz-Marmol, S. Glardon, E. Castillo, H. Sun, W. Li, W. J. Gehring, E. Salo, 1999 Isolation and expression of a Pax-6 gene in the regenerating and intact Planarian Dugesia(G)tigrina Proc. Natl. Acad. Sci. USA 96:558-563[Abstract/Free Full Text]

    Catmull J., D. C. Hayward, N. E. Mcintyre, J. S. Reece-Hoyes, R. Mastro, P. Callaerts, E. E. Ball, D. J. Miller, 1998 Pax-6 origins—implications from the structure of two coral pax genes Dev. Genes Evol 208:352-356[Web of Science][Medline]

    Chalepakis G., P. Gruss, 1995 Identification of DNA recognition sequences for the Pax3 paired domain Gene 162:267-270[Web of Science][Medline]

    Cvekl A., C. M. Sax, E. H. Bresnick, J. Piatigorsky, 1994 A complex array of positive and negative elements regulates the chicken alphaA-crystallin gene: involvement of Pax-6, USF, CREB and/or CREM, and AP-1 proteins Mol. Cell. Biol 14:7363-7376[Abstract/Free Full Text]

    Czerny T., M. Bouchard, Z. Kozmik, M. Busslinger, 1997 The characterization of novel Pax genes of the sea urchin and Drosophila reveal an ancient evolutionary origin of the Pax2/5/8 subfamily Mech. Dev 67:179-192[Web of Science][Medline]

    Czerny T., M. Busslinger, 1995 DNA-binding and transactivation properties of Pax-6: three amino acids in the paired domain are responsible for the different sequence recognition of Pax-6 and BSAP (Pax-5) Mol. Cell. Biol 15:2858-2871[Abstract]

    Czerny T., G. Schaffner, M. Busslinger, 1993 DNA sequence recognition by Pax proteins: bipartite structure of the paired domain and its binding site Genes Dev 7:2048-2061[Abstract/Free Full Text]

    Dressler G. R., 1996 Pax-2, kidney development, and oncogenesis Med. Pediatr. Oncol 27:440-444[Web of Science][Medline]

    Epstein J., J. Cai, T. Glaser, L. Jepeal, R. Maas, 1994 Identification of a Pax paired domain recognition sequence and evidence for DNA-dependent conformational changes J. Biol. Chem 269:8355-8361[Abstract/Free Full Text]

    Grimmelikhuijzen C. J., J. A. Westfall, 1995 The nervous systems of cnidarians EXS 72:7-24[Medline]

    Hoshiyama D., H. Suga, N. Iwabe, M. Koyanagi, N. Nikoh, K. Kuma, F. Matsuda, T. Honjo, T. Miyata, 1998 Sponge pax cDNA related to pax-2/5/8 and ancient gene duplications in the pax family J. Mol. Evol 47:640-648[Web of Science][Medline]

    Jun S., C. Desplan, 1996 Cooperative interactions between paired domain and homeodomain Development 122:2639-2650[Abstract]

    Kozmik Z., S. Wang, P. Dorfler, B. Adams, M. Busslinger, 1992 The promoter of the CD19 gene is a target for the B-cell-specific transcription factor BSAP Mol. Cell. Biol 12:2662-2672[Abstract/Free Full Text]

    Kumar S., K. Tamura, M. Nei, 1993 MEGA: molecular evolutionary genetics analysis Version 1.01. Institute of Molecular Evolutionary Genetics, Pennsylvania State University, University Park

    Land M. F., R. D. Fernald, 1992 The evolution of eyes Annu. Rev. Neurosci 15:1-29[Web of Science][Medline]

    Miller D. J., D. C. Hayward, J. S. Reece-Hoyes, I. Scholten, J. Catmull, W. J. Gehring, P. Callaerts, J. E. Larsen, E. E. Ball, 2000 Pax gene diversity in the basal cnidarian Acropora millepora (Cnidaria, Anthozoa): implications for the evolution of the Pax gene family Proc. Natl. Acad. Sci. USA 97:4475-4480[Abstract/Free Full Text]

    Noll M., 1993 Evolution and role of Pax genes Curr. Opin. Genet. Dev 3:595-605[Medline]

    Pellizzari L., D. Fabbro, R. Lonigro, R. Di Lauro, G. Damante, 1996 A network of specific minor-groove contacts is a common characteristic of paired-domain-DNA interactions Biochem. J 315:363-367

    Sun H., A. Rodin, Y. Zhou, D. P. Dickinson, D. E. Harper, D. Hewett-Emmett, W. H. Li, 1997 Evolution of paired domains: isolation and sequencing of jellyfish and hydra Pax genes related to Pax-5 and Pax-6 Proc. Natl. Acad. Sci. USA 94:5156-5161[Abstract/Free Full Text]

    Tremblay P., P. Gruss, 1994 Pax: genes for mice and men Pharmacol. Ther 61:205-226[Web of Science][Medline]

    Vogan K. J., D. A. Underhill, P. Gros, 1996 An alternative splicing event in the Pax-3 paired domain identifies the linker region as a key determinant of paired domain DNA-binding activity Mol. Cell. Biol 16:6677-6686[Abstract]

    Wilson R., R. Ainscough, K. Anderson, et al. (55 co-authors) 1994 2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans Nature 368:32-82[Medline]

    Wilson D. S., B. Guenther, C. Desplan, J. Kuriyan, 1995 High resolution crystal structure of a paired (Pax) class cooperative homeodomain dimer on DNA Cell 82:709-719[Web of Science][Medline]

    Xu H. E., M. A. Rould, W. Xu, J. A. Epstein, R. L. Maas, C. O. Pabo, 1999 Crystal structure of the human Pax6 paired domain-DNA complex reveals specific roles for the linker region and carboxy-terminal subdomain in DNA binding Genes Dev 13:1263-1275[Abstract/Free Full Text]

    Xu W., M. A. Rould, S. Jun, C. Desplan, C. O. Pabo, 1995 Crystal structure of a paired domain-DNA complex at 2 5 A resolution reveals structural basis for Pax developmental mutations. Cell 80:639-650

    Zannini M., H. Francis-Lang, D. Plachov, R. Di Lauro, 1992 Pax-8, a paired domain-containing protein, binds to a sequence overlapping the recognition site of a homeodomain and activates transcription from two thyroid-specific promoters Mol. Cell. Biol 12:4230-4241[Abstract/Free Full Text]

Accepted for publication June 14, 2001.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J HeredHome page
W. J. Gehring
New Perspectives on Eye Development and the Evolution of Eyes and Photoreceptors
J. Hered., May 1, 2005; 96(3): 171 - 184.
[Abstract] [Full Text] [PDF]


Home page
Integr. Comp. Biol.Home page
J. Piatigorsky
Gene Sharing, Lens Crystallins and Speculations on an Eye/Ear Evolutionary Relationship
Integr. Comp. Biol., August 1, 2003; 43(4): 492 - 499.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
Y.-H. Zhou, J. B. Zheng, X. Gu, G. F. Saunders, and W.-K. A. Yung
Novel PAX6 Binding Sites in the Human Genome and the Role of Repetitive Elements in the Evolution of Gene Regulation
Genome Res., November 1, 2002; 12(11): 1716 - 1722.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Sun, H.
Right arrow Articles by Li, W.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sun, H.
Right arrow Articles by Li, W.-H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?