Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Adkins, R. M.
Right arrow Articles by Li, W.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adkins, R. M.
Right arrow Articles by Li, W.-H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Biology and Evolution 18:55-60 (2001)
© 2001 Society for Molecular Biology and Evolution


ARTICLE

Bushbaby Growth Hormone Is Much More Similar to Nonprimate Growth Hormones than to Rhesus Monkey and Human Growth Hormones

Ronald M. Adkins, Anton Nekrutenko and Wen-Hsiung Li

*Biology Department and Graduate Program in Organismal and Evolutionary Biology, University of Massachusetts; and
{dagger}Department of Ecology and Evolution, University of Chicago


    Abstract
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Acknowledgements
 literature cited
 
Unlike other mammals, Old World primates have five growth hormone–like genes that are highly divergent at the amino acid level from the single growth hormone genes found in nonprimates. Additionally, there is a change in the interaction of growth hormone with its receptor in humans such that human growth hormone functions in nonprimates, whereas nonprimate growth hormone is ineffective in humans. A Southern blotting analysis of the genome of a prosimian, Galago senegalensis, revealed a single growth hormone locus. This single gene was PCR-amplified from genomic DNA and sequenced. It has a rate of nonsynonymous nucleotide substitution less than one fourth that of the human growth hormone gene, while the rates of synonymous substitution in the two species are less different. Human and rhesus monkey growth hormones exhibit variation at a number of amino acid residues that can affect receptor binding. The galago growth hormone is conservative at each of these sites, indicating that this growth hormone is functionally like nonprimate growth hormones. These observations indicate that the amplification and rapid divergence of primate growth hormones occurred after the separation of the higher primate lineage from the galago lineage.


    Introduction
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Acknowledgements
 literature cited
 
In general, proteins exhibit both a high degree of structural and chemical conservation over time and a consistent pattern of rates of amino acid substitution across species. For example, although rates of substitution vary from protein to protein, rodents consistently replace amino acids at a higher rate than do primates (Li et al. 1996Citation ). The few exceptions in which individual proteins violate the pattern observed at other loci often involve cases of positive selection for diversity (e.g., the MHC genes [e.g., Hughes and Nei 1988Citation ] or viral coat proteins [e.g., Li, Tanimura, and Sharp 1988Citation ]) or for specialization of function, such as lysozyme in ruminants and the langur (Stewart and Wilson 1987Citation ; Messier and Stewart 1997Citation ). These cases provide rare views of the processes by which antigenic or enzymatic properties of a protein are modified while still maintaining function. Over long-term evolution, such structural or functional changes will also occur in systems of interacting proteins that must coevolve to maintain function. Such cases are relatively unknown, but some likely situations are in hormone-receptor systems, enzyme cascades, or multisubunit protein complexes. In this paper, we examine the evolution of primate growth hormone and its receptor, which exhibit unequal rates of substitution and changes in their interaction. This system should provide information on the processes by which proteins undergo coordinated changes in their sequences and interaction while still maintaining their functions.

Evolutionarily, humans, apes, and Old World monkeys exhibit several unique aspects of their growth hormone (GH), a polypeptide of approximately 190 amino acids in its mature form. Amino acid sequences of growth hormone are available from a number of mammals, including rodents, artiodactyls (i.e., cows, sheep), carnivores, and primates, and from these sequences a consensus, or "ancestral," growth hormone can be inferred (Wallis 1994Citation ). Most mammalian GHs differ from this consensus by 0–4 substitutions. In contrast, human and rhesus monkey GHs differ from the consensus by 62 and 64 substitutions, respectively. These values are over three times as high as those (18–19 substitutions) observed for artiodactyls, the second most divergent set of species. This increased number of amino acid substitutions is correlated with a change in the interaction of the hormone with the growth hormone receptor (GHR). Human GH injected into a nonprimate is biologically active and will stimulate growth. However, mouse or pig GH is completely ineffective in humans. Indeed, in vitro studies have demonstrated that bovine GH is 3,000-fold less potent than is human GH in competitive binding assays for the human GHR (Souza et al. 1995Citation ). Another unique aspect of growth hormone evolution in higher primates is that humans and rhesus monkeys have five tandemly arrayed copies of GH-related genes rather than one, as is found in nonprimate mammals. One of these loci (GH) is expressed by the pituitary gland, while the remaining four are expressed only in the placenta (Chen et al. 1989Citation ; Golos et al. 1993Citation ).

These unique features of higher primate GH evolution raise many questions. (1) When did the duplications which gave rise to multiple GH-like genes occur during primate evolution? (2) Is the increased protein divergence a common feature of all primates, or is it restricted to a subset of primates? (3) Have amino acid substitution rates been high throughout primate evolution, or did most of the changes occur over only a short period of time? (4) What amino acid substitutions are responsible for the species specificity of human GH? Wallis (1996)Citation demonstrated several cases of rate variation in vertebrate GH evolution and determined that most of the amino acid changes in primates occurred before humans and macaques diverged. In this paper, we demonstrate that Galago senegalensis, a prosimian, has a single GH gene, and we show that the acceleration of the amino acid substitution rate occurred after the separation of the higher primate lineage from the galago lineage. Indeed, the Galago GH sequence is very similar to the "ancestral" mammalian GH and shares none of the amino acid substitutions present in human GH which are expected to affect GHR binding.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Acknowledgements
 literature cited
 
PCR, Cloning, and Sequencing
DNA was extracted from liver tissue of two bushbaby species, Galago senegalensis and Otolemur crassicaudatus, obtained from Rodney L. Honeycutt (Texas A&M University) and the Duke Primate Center, respectively. The G. senegalensis GH locus was amplified in two parts. Initially, primers were designed from evolutionarily conservative regions of exon 4 (5'-GATGCCTTCCTCTAGGTCCTT-3') and the 5' flanking region (GACCAGCTCCAGGATCCCAA) of GH. Once sequence information was obtained, a primer specific for exon 2 (GGGAATGGGTGCTAGTGAGG) was used in conjunction with a conservative primer 3' of GH (CAGGG(C/T)CA(A/G)G(A/G)GAGGCACTGGGGAGG) to amplify the remainder of the locus. PCR products were ligated into an EcoRV digested SK+ pBluescript vector (Stratagene). Two clones of each PCR product were sequenced, and no sequence discrepancies were found. A list of primers used in sequencing are available upon request. The G. senegalensis GH sequence has been deposited in GenBank under the accession number AF292938. To amplify GH from O. crassicaudatus, we used primers 3F and 9R provided by Dr. K. Makova. These primers amplify 1034 bp of the GH gene including last 44 bp of the 2nd exon, intron 2, exon 3, intron 3, exon 4, intron 4 and first 103 bp of exon 5. This fragment was cloned into pGEM-T vector (Promega) and two clones were sequenced using the original amplificational primers as well as primers 5F and 6R (Liu et al. submitted). The O. crassicaudatus GH sequence was deposited to GenBank under accession number AF319878.

Southern Hybridization
Fifteen to 20 micrograms of genomic O. crassicaudatus DNA was digested with EcoRI, Pst I, BamH and Sau3A (all obtained from New England Biolabs), electrophoresed through a 0.8% agarose gel (2% for Sau3A digest) and transferred to a Zeta-Probe GT blotting membrane (Bio-Rad). A cloned PCR product obtained with primers 3F and 9R (see above) on genomic DNA of O. crassicaudatus was labelled with [{alpha}-32P]-dCTP using a Random Primed DNA Labeling kit (Boehringer Mannheim) and used as a probe. Hybridization was performed at 65 degrees overnight in 6 ml of fluid (7% SDS, 0.5 M Na2HPO4, pH 7.2). The membrane was washed twice at 65 degrees in 50 ml of 5% SDS, 0.04 M Na2HPO4, pH 7.2, twice at 65 degrees and once at 65 degrees in 50 ml of 1% SDS, 0.04 M Na2HPO4, pH 7.2. The membrane was exposed to film for 48–72 hours.

Sequence Analysis
The new sequence from Galago was aligned with sequences from GenBank (table 1 ) using the program CLUSTAL W (Thompson, Higgins, and Gibson 1994Citation ). Numbers of substitutions at nonsynonymous and synonymous sites were calculated by the method of Li (1993)Citation for the entire prohormone-coding region (218 codons in Galago), and relative-rate tests were performed according to Wu and Li (1985)Citation . Because the number of substitutions at twofold-degenerate sites was small, rate tests were performed only on nondegenerate and fourfold-degenerate sites. Numbers of nonsynonymous substitutions per site were apportioned among the branches of a user-defined tree by the Fitch-Margoliash method using the program Fitch in the PHYLIP, version 3.572c, package of programs (Felsenstein 1993Citation ). This user-defined tree was also input into the program PAUP, version 3.1.1 (Swofford 1993Citation ), and the ancestral GH nucleotide sequence at each node among primates, rodents, and artiodactyls was inferred by parsimony. Using this inferred sequence, the numbers of synonymous and nonsynonymous substitutions along each branch within these three orders were counted. At those sites where the ancestral state was ambiguous, the pathway which minimized the number of nonsynonymous substitutions was accepted. Fisher's exact test was used to test the equality of the ratio of nonsynonymous to synonymous substitutions in two areas of the tree: the combined human/macaque branches versus the branch preceding their split, and the combined cow/goat/sheep branches versus the branch preceding their split. The nonrandom clustering of amino acid replacements along the length of the GH protein in human GH was tested by a chi-square analysis, with the P value calculated according to a Monte Carlo procedure. For the chi-square test, the growth hormone protein was divided along its length into 10 segments of 19 amino acids. The tests were performed using the programs Fisher6 and Monte Carlo RxC (B. Engels, personal communication).


View this table:
[in this window]
[in a new window]
 
Table 1 Sequences Used in this Study

 

    Results and Discussion
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Acknowledgements
 literature cited
 
A Single GH Gene in G. senegalensis
Two representatives of bushbabies (family Galagoniidae) were utilized in this study: Northern Lesser bushbaby (Galago senegalensis) and Thick-tailed Greater bushbaby (Otolemur crassicaudatus). For the G. senegalensis we have sequenced the entire growth hormone gene, whereas for O. crassicaudatus we sequenced the region that includes exon 2 through the beginning of exon 5. There are 43 nucleotide differences between the fragment of O. crassicaudatus GH (1043 bp) and the corresponding region of the G. senegalensis GH gene. Nine of these differences are within the coding region of the gene. Of these seven are third position transitions with no effect on amino acid coding. The remaining two differences are first and second position transitions changing Thr74 (polar) and Leu132 (nonpolar) of G. senegalensis to Ala (nonpolar) and Ser (polar) in corresponding positions of the O. crassicaudatus GH. None of these amino acid replacements occur in functionally important sites.

Single GH locus in bushbabies
Four digestions of O. crassicaudatus genomic DNA each produced a single band in a Southern hybridization (fig. 1 ). This indicates that there is only a single GH-like locus in bushbabies. Additionally, we performed Southern blot experiment with O. crassicaudatus DNA digested with Sau3A (fig. 1 ). According to the inferred restriction map this frequently cutting enzyme has two recognition sites within the region of the O. crassicaudatus GH gene corresponding to the probe we used and, therefore, we expected the Southern blot experiment to yield three bands one of which should correspond to a 605 bp GH fragment between Sau3A sites. Indeed, as shown in figure 1 , there are three bands one of which is approximately 605 bp in length. Thus, the duplications which gave rise to five GH-like loci in human and macaque occurred after the higher primate line of descent branched off from the bushbaby lineage. On this basis, it is reasonable to assume that the single locus sequenced in this study is the ortholog of the pituitarily expressed locus in human and macaque.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 1.—Southern hybridization of intron 1 through exon 3 of the Galago GH gene to a digestion of Galago genomic DNA with EcoRI (lane 1) and EcoRV (lane 2). The scale is in kilobases.

 
Conservatism of G. senegalensis GH
The Galago sequence exhibits much less divergence than does human GH, as can be seen (table 2 ) by a comparison of nonsynonymous and synonymous sequence divergence of various mammals versus the pig, which has been hypothesized to have a sequence identical to that of the ancestral mammalian GH (Wallis 1994Citation ). Synonymous divergence values range from 0.231 to 0.56 substitutions per site, with the human being the most divergent. By contrast, at nonsynonymous sites, Galago and the nonprimate sequences range from 0.007 to 0.055 substitutions per site, while the human sequence has 0.176 substitutions per site, about five times the number for Galago. Thus, although the human GH gene is significantly more divergent at both synonymous and nonsynonymous sites, it is much more so at nonsynonymous sites (table 3 ). The increase in the rate of synonymous substitution in humans may be partly ascribed to the tendency of the synonymous rate to increase with the nonsynonymous rate (Graur 1985Citation ; Li, Wu, and Luo 1985Citation ; Mouchiroud, Gauthier, and Bernardi 1995Citation ). The result of the relative-rate test for nonsynonymous substitutions indicates that most of the additional amino acid substitutions present in humans and macaques accumulated after the divergence of the human/macaque lineage from the Galago lineage.


View this table:
[in this window]
[in a new window]
 
Table 2 Numbers of Substitutions per Nonsynonymous Site (Ka) and per Synonymous Site (Ks) Relative to Pig

 

View this table:
[in this window]
[in a new window]
 
Table 3 Relative-Rate Test on Substitutions at Nondegenerate and Fourfold-Degenerate Sites

 
Ratio of Nonsynonymous to Synonymous Substitutions
Wallis (1996)Citation suggested that the rate of amino acid substitution in GH was high before the divergence of humans and macaques and subsequently slowed. This possibility was tested by examining the ratio of nonsynonymous to synonymous substitutions before and after the macaque/human split. Based on an inferred ancestral primate GH sequence (fig. 2 ), 64 nonsynonymous and 30 synonymous substitutions occurred between the common ancestor of Galago and higher primates and the divergence of macaques and humans, while a combined 8 nonsynonymous and 19 synonymous substitutions have occurred in the macaque and human lineages since that split. These ratios are significantly different (Fisher's exact test, P = 0.0006), indicating that relative to the synonymous rate of substitution, the rate of nonsynonymous substitution was much higher before the macaque/human divergence. As pointed out by Wallis (1996)Citation , this increased rate of nonsynonymous divergence cannot be directly ascribed to the expansion of the GH locus to five genes, because the majority of these substitutions are shared among all the loci and thus predate those duplications. The branch preceding the divergence of cows, goats, and sheep represents another period during which the number of nonsynonymous substitutions exceeded the number of synonymous changes. However, the ratio of nonsynonymous to synonymous substitutions before (22.5/17) and after (5/13) the split of cows from goats and sheep is only marginally significant (P = 0.05), meaning that the rate of nonsynonymous substitution was not nearly as high relative to the synonymous rate during this period as it was before the macaque/human split.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2.—Phylogeny of the mammalian species used in this study. Branch lengths are proportional to KA distances. These branch lengths were determined by apportioning distances along a user-defined tree ([(rat, mouse) hamster] ([([(goat, sheep) cow] pig) (cat [dog]) (macaque, human) Galago])) (Li et al. 1990Citation ; Honeycutt and Adkins 1993Citation ) by the Fitch-Margoliash method. Ancestral GH sequences were inferred by parsimony, and these sequences were used to assign numbers of nonsynonymous (N) and synonymous (S) substitutions to some branches. Some numbers are fractional because a small number of substitutions could not be unambiguously assigned to a certain branch; those substitutions were equally apportioned among the branches along which they could have occurred

 
The results of the relative-rate tests and Fisher's exact test narrow the period during which most of the amino acid substitutions in humans and macaques must have occurred. The clade containing Galago diverged from the higher primate lineage slightly more than 55 MYA (Kay, Ross, and Williams 1997Citation ), and Old World monkeys diverged from the ape/human lineage about 22 MYA (Pickford 1986Citation ). This means that 64 amino acid substitutions occurred in a span of about 33 Myr, a very high rate of replacement (~10 x 10-9 substitutions per site per year).

Divergence of Primate GH at Functionally Significant Sites
Nonprimate GH does not function in humans, indicating that significant amino acid replacements occurred in the GH/GHR complex along the human lineage. It is therefore of interest to examine in humans those amino acid substitutions which occur at sites known to be important for GH/GHR interaction and to determine which of these changes may be shared with Galago, whose divergence precedes the increase in amino acid replacement rate.

Of the 11 residues of GH that form salt bridges or hydrogen bonds with the GHR (Devos, Ultsch, and Kossiakoff 1992Citation ), four (residues 19, 41, 167, and 171) vary in humans and macaques (table 4 ). Additionally, residue 64, which is not a ligand for GHR but is known to have a major effect on binding energy (Wells 1996Citation ), varies only in humans and macaques. In each case, Galago exhibits the ancestral amino acid state. Site 167 is Arg in both higher primates and ruminants and thus seems unlikely to be a major determinant of the species specificity of human GH. Residue 171 of GH interacts with site 43 of GHR, and it has been demonstrated that the replacement of His with Asp at site 171, accompanied by the Leu-to-Arg change at site 43, accounts for most, but not all, of the change in binding affinity of nonhuman GH for the human receptor (Souza et al. 1995Citation ; Behncken et al. 1997Citation ). The effect of the remaining three residues in table 4 have not been examined experimentally in terms of species specificity, and this would be an interesting topic for further study. On the basis of its protein sequence conservation and lack of variability at sites important for GHR interaction, Galago GH probably behaves like nonprimate GHs physiologically.


View this table:
[in this window]
[in a new window]
 
Table 4 Sites Important for Growth Hormone (GH)/Growth Hormone Receptor Interaction Which Vary in Humans and Macaques

 
Mutation Pattern in Higher Primates Relative to Other Mammals
It is unlikely that the results we report are due to a radically different nucleotide frequency or mutation pattern in higher primates. For example, there is no indication of nonstationarity of nucleotide frequency in any mammal (chi-square test, P > 0.6). Additionally, amino acid replacements appear to be randomly distributed throughout the human and rhesus GH proteins relative to pigs (P > 0.9). There is a difference in the ratio of transitions to transversions in higher primates. Among nonprimates and Galago, the maximum-likelihood estimate of the transition/transversion ratio is 2.9, while it is 1.6 among human and rhesus monkey GH-like genes. This is almost a twofold difference in ratio, but it most likely is due simply to the higher number of amino acid replacements among the higher primate genes, most of which were transversions.

Paralogy of GH-like Genes and Timing of Duplications
The results reported here are based on the orthology of the single GH gene of Galago with the pituitary-expressed GH-N of humans and rhesus monkeys. There is strong evidence from the distribution of paralogous Alu elements (which are restricted to primates) that all the duplications giving rise to multiple GH-like genes in higher primates occurred after Galago diverged. The published human growth hormone locus contains over 40 Alu elements, most of which are related to each other via the gene duplications that gave rise to the five genes, rather than by unique transposition events (Toda and Tomita 1997Citation ). Based on both positional homology and phylogenetic analysis, it is clear that two AluSg elements inserted before the duplications of GH-N that gave rise to the other four GH-like genes. The approximate age of the AluSg family is 31 Myr (Kapitonov and Jurka 1996Citation ), placing an upper boundary on the age of all the gene duplications somewhere in the Oligocene, at least 20 Myr after Galago diverged from the higher primate line of descent. Correspondingly, all human and rhesus monkey GH-like genes form a single cluster in phylogenetic analysis (results not shown).

At any rate, the results of this study are not altered regardless of which higher primate gene is chosen for comparison with Galago and nonprimates. Galago GH exhibits 61 and 63 amino acid differences from human and rhesus monkey GH-N, respectively, but 66–77 differences from the placental GH-like hormones of humans and rhesus monkeys. Additionally, human GH-like genes appear to be undergoing concerted evolution via gene conversion (Giordano et al. 1997Citation ) that artificially increases their similarity, and the same may be true of rhesus monkey genes.


    Acknowledgements
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Acknowledgements
 literature cited
 
This research was supported by NIH grants to W.-H.L. and by a Faculty Research Grant to R.M.A.


    Footnotes
 
Naruya Saitou, Reviewing Editor

1 Keywords: growth hormone primates rate acceleration gene duplication Galago Back

2 Address for correspondence and reprints: Wen-Hsiung Li, Department of Ecology and Evolution, University of Chicago, 1101 East 57th Street, Chicago, Illinois 60637. E-mail: whli{at}uchicago.edu Back


    literature cited
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Acknowledgements
 literature cited
 

    Behncken, S. N., S. W. Rowlinson, J. E. Rowland, B. L. Conway-Campbell, T. A. Monks, and M. J. Waters. 1997. Aspartate 171 is the major primate-specific determinant of human growth hormone. J. Biol. Chem. 272:27077–27083.[Abstract/Free Full Text]

    Chen, E. Y., Y.-C. Liao, D. H. Smith, H. A. Barrera-Saldana, R. E. Gelinas, and P. H. Seeburg. 1989. The human growth hormone locus: nucleotide sequence, biology, and evolution. Genomics 4:479–497.

    Devos, A. M., M. Ultsch, and A. A. Kossiakoff. 1992. Human growth hormone and extracellular domain of its receptor: crystal structure of the complex. Science 255:306–312.

    Felsenstein, J. 1993. PHYLIP (phylogeny inference package). Version 3.572c. Distributed by the author, Department of Genetics, University of Washington, Seattle.

    Giordano, M., C. Marchetti, E. Chiorboli, G. Bona, and P. M. Richiardi. 1997. Evidence for gene conversion in the generation of extensive polymorphism in the promoter of the growth hormone gene. Hum. Genet. 100:249–255.[Web of Science][Medline]

    Golos, T. G., M. Durning, J. M. Fisher, and P. D. Fowler. 1993. Cloning of four growth hormone/chorionic somatomammotropin-related complementary deoxyribonucleic acids differentially expressed during pregnancy in the rhesus monkey placenta. Endocrinology 133:1744–1752.

    Graur, D. 1985. Amino acid composition and the evolutionary rates of protein-coding genes. J. Mol. Evol. 22:53–63.[Web of Science][Medline]

    Honeycutt, R. L., and R. M. Adkins. 1993. Higher level systematics of eutherian mammals: an assessment of molecular characters and phylogenetic hypotheses. Annu. Rev. Ecol. Syst. 24:279–305.[Web of Science]

    Hughes, A., and M. Nei. 1988. Pattern of nucleotide substitution at major histocompatibility complex class I loci reveals overdominant selection. Nature 335:167–170.

    Kapitonov, V., and J. Jurka. 1996. The age of Alu subfamilies. J. Mol. Evol. 42:59–65.[Web of Science][Medline]

    Kay, R. F., C. Ross, and B. A. Williams. 1997. Anthropoid origins. Science 275:797–804.

    Li, W.-H. 1993. Unbiased estimation of the rates of synonymous and nonsynonymous substitution. J. Mol. Evol. 36:96–99.[Web of Science][Medline]

    Li, W.-H., D. L. Ellsworth, J. Krushkal, B. H.-J. Chang, and D. Hewett-Emmett. 1996. Rates of nucleotide substitution in primates and rodents and the generation-time hypothesis. Mol. Phylogenet. Evol. 5:182–187.[Web of Science][Medline]

    Li, W.-H., M. Gouy, P. M. Sharp, C. O'Huigin, and Y.-W. Yang. 1990. Molecular phylogeny of rodentia, lagomorpha, primates, artiodactyla, and carnivora and molecular clocks. Proc. Natl. Acad. Sci. USA 87:6703–6707.

    Li, W.-H., M. Tanimura, and P. M. Sharp. 1988. Rates and dates of divergence between AIDS virus nucleotide sequences. Mol. Biol. Evol. 5:313–330.[Abstract]

    Li, W.-H., C.-I. Wu, and C.-C. Luo. 1985. A new method for estimating synonymous and nonsynonymous rates of nucleotide substitution considering the relative likelihood of nucleotide and codon changes. Mol. Biol. Evol. 2:150–174.[Abstract]

    Messier, W., and C.-B. Stewart. 1997. Episodic adaptive evolution of primate lysozymes. Nature 385:151–154.

    Mouchiroud, D., C. Gauthier, and G. Bernardi. 1995. Frequencies of synonymous substitutions in mammals are gene specific and correlated with frequencies of nonsynonymous substitutions. J. Mol. Evol. 40:107–113.[Web of Science][Medline]

    Pickford, M. 1986. The geochronology of Miocene higher primate faunas of East Africa. Pp. 19–23 in J. G. Else and P. C. Lee, eds. Primate evolution. Cambridge University Press, Cambridge, England.

    Souza, S. C., G. P. Frick, X. Wang, J. J. Kopchick, R. B. Lobo, and H. M. Goodman. 1995. A single arginine residue determines species specificity of the human growth hormone receptor. Proc. Natl. Acad. Sci. USA 92:959–963.

    Stewart, C.-B., and A. C. Wilson. 1987. Sequence convergence and functional adaptation of stomach lysozymes from foregut fermentors. Cold Spring Harb. Symp. Quant. Biol. 52:891–899.[Abstract/Free Full Text]

    Swofford, D. L. 1993. PAUP: phylogenetic analysis using parsimony. Version 3.1.1. Illinois Natural History Survey, Champaign.

    Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673–4680.

    Toda, Y., and M. Tomita. 1997. Alu elements as an aid in deciphering genome rearrangements. Gene 205:173–176.

    Wallis, M. 1994. Variable evolutionary rates in the molecular evolution of mammalian growth hormones. J. Mol. Evol. 38:619–627.[Web of Science][Medline]

    ———. 1996. The molecular evolution of vertebrate growth hormones: a pattern of near-stasis interrupted by sustained bursts of rapid change. J. Mol. Evol. 43:93–100.[Web of Science][Medline]

    Wells, J. A. 1996. Binding in the growth hormone receptor complex. Proc. Natl. Acad. Sci. USA. 93:1–6.[Abstract/Free Full Text]

    Wu, C.-I., and W.-H. Li. 1985. Evidence for higher rates of nucleotide substitution in rodents than in man. Proc. Natl. Acad. Sci. USA 82:1741–1745.

Accepted for publication September 24, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
Y. Li, C. Ye, P. Shi, X.-J. Zou, R. Xiao, Y.-Y. Gong, and Y.-P. Zhang
Independent origin of the growth hormone gene family in New World monkeys and Old World monkeys/hominoids
J. Mol. Endocrinol., October 1, 2005; 35(2): 399 - 409.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
J.-C. Liu, K. D. Makova, R. M. Adkins, S. Gibson, and W.-H. Li
Episodic Evolution of Growth Hormone in Primates and Emergence of the Species Specificity of Human Growth Hormone Receptor
Mol. Biol. Evol., June 1, 2001; 18(6): 945 - 953.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Adkins, R. M.
Right arrow Articles by Li, W.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adkins, R. M.
Right arrow Articles by Li, W.-H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?