Skip Navigation

This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Robinson-Rechavi*, M.
Right arrow Articles by Mouchiroud, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Robinson-Rechavi*, M.
Right arrow Articles by Mouchiroud, D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Biology and Evolution 17:1410-1412 (2000)
© 2000 Society for Molecular Biology and Evolution


Letter to the Editor

Nuclear Gene LCAT Supports Rodent Monophyly

Marc Robinson-Rechavi*2,, Loïc Ponger{dagger} and Dominique Mouchiroud{dagger}

*Laboratoire de Biologie Moleculaire et Cellulaire, Ecole Normale Superieure de Lyon, Lyon, France; and
{dagger}Laboratoire de Biométrie et Biologie Evolutive, Université Claude Bernard—Lyon 1, Villeurbanne cedex, France

Rodents (order Rodentia) have attracted much attention from molecular evolution studies. Rats and mice, and, to a lesser extent, guinea pigs and hamsters, are widely used models in molecular and cellular biology, which has made their sequences widely available. Strong focus has been on determining whether or not rodents are monophyletic (Graur, Hide, and Li 1991Citation ; Luckett and Hartenberger 1993Citation ; d'Erchia et al. 1996Citation ; Cao, Okada, and Hasegawa 1997Citation ), turning the question into a battleground of different approaches of mammalian phylogeny.

A large number of studies do not resolve the question of rodent monophyly, despite an abundance of data, including reanalyses of the data from Graur, Hide, and Li (1991)Citation with maximum likelihood (Hasegawa et al. 1992Citation ; Li, Hide, and Graur 1992Citation ; Cao et al. 1994Citation ), cytochrome b, cytochrome oxidase c, and 12S rRNA sequences from large samples of mammals (Ma et al. 1993Citation ; Catzeflis et al. 1995Citation ; Honeycutt et al. 1995Citation ; Nedbal, Honeycutt, and Schlitter 1996Citation ). Although the analysis of complete mitochondrial genomes seemed doomed to the same fate (d'Erchia et al. 1996Citation ; Cao, Okada, and Hasegawa 1997Citation ; Janke, Xu, and Arnason 1997Citation ; Cao et al. 1998), an analysis of 25 complete genomes, including those of four rodents, strongly supports rodent paraphyly (Reyes, Pesole, and Saccone 1998Citation ). On the other hand, analysis of several nuclear genes supported rodent monophyly (Stanhope et al. 1998Citation ), but without a noneutherian rooting except for the aquaporin-2 gene, and with low taxonomic sampling of rodents. The nuclear von Willebrand Factor gene from a large sampling of rodents and other mammals also retrieves rodent monophyly, but again with low support (Huchon, Catzeflis, and Douzery 1999Citation ).

The nuclear gene coding for lecithin:acetyl cholin transferase (gene LCAT) has previously proved to be informative for rodent phylogeny (Robinson et al. 1997Citation ). We added to the previous data set an indisputable marsupial outgroup, which allows reliable rooting of the tree and thus testing of rodent monophyly. We also added the guinea pig, to allow comparison with the many studies in which it represents hystricognaths, and a shrew, whose position in the eutherian tree is presently problematic (Stanhope et al. 1998Citation ; Mouchaty et al. 2000Citation ). Intron sequences were aligned and found to be informative for phylogeny.

DNA was extracted from 95% ethanol-preserved tissues from the Collection of Preserved Mammalian Tissues of the Institut des Sciences de l'Evolution, Montpellier (Catzeflis 1991Citation ). These tissues are those of a guinea pig (Cavia porcellus; Rodentia: Hystricognathi; tissue T-1575), a shrew (Crocidura russula; Insectivora: Soricidae; tissue T-1755), and an opossum (Didelphis marsupialis; Metatheria: Didelphidae; tissue T-1605). Two fragments of the lecithin : cholesterol acyl-transferase (LCAT) gene were amplified as in Robinson et al. (1997)Citation . Primers used for exon 6 were U749 (GTGACAACCAGGGCATCC) + L1210 (TGTGTTATTGCTGAAGACCAT). For exons 2–5, they were U213 (CTGGATGTGCTACCGAAAGAC) + L670d2 (GAAGCCATCAAT[A/G]AAGTGATC) in Cavia and Crocidura. In Didelphis, L670d2 was replaced by L670d1 (GAAGCCATCAAT[A/G]AAGCGGTC), and a nested PCR was done with internal primers U221 (GCTACCGAAAGACAGAGGACT) + L666 (CCATCAATGAAGTGGTCCTTC). New sequences were deposited in GenBank under accession numbers AF183896AF183901.

Protein-coding sequences were aligned by hand using SEAVIEW (Galtier, Gouy, and Gautier 1996Citation ). Intron sequences were automatically aligned using DIALIGN (Morgenstern et al. 1998Citation ) and checked by hand. Positions with gaps were excluded from all analyses. We did not use Rhizomys pruinosus because of the loss of sites implied by the shorter LCAT sequence available.

All phylogenetic reconstruction was done using PHYLO_WIN (Galtier, Gouy, and Gautier 1996Citation ), modified to implement the distance KAS (Robinson et al. 1997Citation ). This distance, which sums the information from synonymous and nonsynonymous coding sites, was used to infer phylogeny from coding sequences by neighbor joining (Saitou and Nei 1987Citation ). For noncoding sequences, the distance of Galtier and Gouy (1995)Citation was used, allowing different GC contents of sequences. Maximum-likelihood reconstruction used the two-parameter model of Kimura (1980), with a transition/transversion ratio of 1.82 estimated from the data by Puzzle (Strimmer and von Haeseler 1996Citation ). Parsimony was unweighted. The significance of nodes was investigated (1) by 2,000 bootstrap replicates for neighbor joining and parsimony; (2) by the test of Kishino and Hasegawa (1989)Citation , as implemented in Puzzle (Strimmer and von Haeseler 1996Citation ), with the "mixed" model (1 invariable + 8 gamma rates); and (3) by Hadamard spectral analysis (Hendy and Penny 1993Citation ), as implemented in Spectrum (Charleston 1998Citation ), with the LogDet distance (Steel, Lockhart, and Penny 1993Citation ). Exact probabilities associated with the Kishino-Hasegawa test were computed using integration by parts (program available from M.R.-R.).

The rooted neighbor-joining tree of coding sequences (fig. 1 ) supports rodent monophyly, although it does not resolve the relative positions of rodents, primates, rabbits, and shrews. Within rodents, relations are similar to those obtained and discussed previously (Robinson et al. 1997Citation ), notably without any resolution of the relations between four main rodent lineages: murids, sciurids, glirids, and hystricognaths. Guinea pig (Cavia) groups clearly with hystricognaths and appears quite divergent from Octodon and Myocastor. Monophyly is also recovered by parsimony and maximum likelihood, despite not taking into account the codon structure. Monophyly is also recovered from aligned intron sequences with neighbor joining (distance of Galtier and Gouy 1995Citation ), maximum likelihood (model of Kimura 1980Citation ), or parsimony. The distances of Galtier and Gouy (1995)Citation and LogDet (Steel, Lockhart, and Penny 1993Citation ) are not adapted to the codon structure, but excluding invariant sites gives an approximation of rate variation between sites (Penny et al. 1999Citation ). In this case, both distances allow recovery of a monophyletic Rodentia with coding sequences. This indicates that the clade is not biased due to variable base content of LCAT sequences between mammals.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1.—Rooted phylogeny of exons 2–6 of gene LCAT from 24 mammals, of which 19 are rodents. The tree was obtained using neighbor joining (Saitou and Nei 1987Citation ) with the KAS distance (Robinson et al. 1997Citation ). Above nodes are bootstrap values for Didelphis. On branches supported by <50% bootstrap, no value is reported. All values were obtained with 2,000 repetitions, bootstrapping codons. The measure bar represents 0.05 substitutions per site. The branch supporting rodent monophyly is shown in bold

 
Bootstrap support is weaker with intron sequences (57% for neighbor joining, 76% for parsimony), probably due to the lower number of sites (252 bp instead of 651 bp in the coding sequence).

With the test of Kishino and Hasegawa (1989)Citation , the fully resolved neighbor-joining tree of figure 1 is not significantly better than the tree obtained by collapsing nodes supported by less than 50% bootstrap into polytomies ({Delta}lnL = 6.25 ± 4.08 [SE]; P = 0.12). However, the difference becomes highly significant ({Delta}lnL = 31.3 ± 11.0; P = 0.004) when the branch defining rodents (in bold in fig. 1 ) is also collapsed. The neighbor-joining tree is also significantly better than previously suggested trees for rodent paraphyly, with murids basal as in d'Erchia et al. (1996)Citation ({Delta}lnL = 29.9 ± 11.3; P = 0.008) or with hystricognaths basal as in Graur, Hide, and Li (1991)Citation ({Delta}lnL = 31.3 ± 11.0; P = 0.004). This is robust to modification in the position of the shrew.

The program Spectrum (Charleston 1998Citation ) did not allow use of our complete data set, so we tested 19 taxa subsets of coding sequences, excluding various murid sequences. The "Manhattan" tree, minimizing conflicts between splits in the tree, always included rodent monophyly. Although this edge was always supported by an expected 0.004 changes per site, normalized contradiction ranges from 0.002 to 0.005, with two or three contradicting splits. This edge was more supported than any edge grouping different orders. All splits making rodents paraphyletic had very high contradiction and no support. Thus, spectrum analysis shows that rodent monophyly reflects the structure of our LCAT data.

Support of rodent monophyly by LCAT sequences is consistently recovered by independent coding and noncoding sequences with different types of methods and models. This result takes information from all types of sites into account and is not biased due to GC content. It was obtained from a large sampling of rodent families.

It is interesting that the only other published study sampling a nuclear protein-coding gene, the von Willebrand Factor gene, in many rodents also recovers rodent monophyly, although with low support (Huchon, Catzeflis, and Douzery 1999Citation ). An overview of all available protein sequences relevant to the question (unpublished data) also shows that, despite a great amount of contradiction between sequences, the monophyly of rodents is slightly favored. Although complete mitochondria support paraphyly (d'Erchia et al. 1996Citation ; Reyes, Pesole, and Saccone 1998Citation ), results appear very sensitive to the methods used, making it possible to recover rodent monophyly from the same data (Penny et al. 1999Citation ).

Some molecular phylogenetic studies on eutherian mammals lack outgroups (Stanhope et al. 1998Citation ), while others use reptiles (including birds), which are very distant compared with the scale of divergence between eutherian orders. Here, use of a marsupial sequence allowed not only recovery of rodent monophyly, but also, for the first time, statistical support. This also allowed use of synonymous and intron sites, both of which were informative. Resolution of other open questions in mammal phylogeny may thus depend on use of all sites and relevant outgroups.


    Acknowledgements
 TOP
 Acknowledgements
 literature cited
 
We thank Jerôme Briolay for help with experimental work, François Catzeflis for providing tissue samples, Dorothée Huchon for communicating her manuscript before publication, and Manolo Gouy, Vincent Laudet, Masami Hasegawa, and an anonymous referee for critical reading and useful comments. Part of this work was done when M.R.-R. was funded by a Lavoisier grant from the French Ministry of Foreign Affairs at Tel Aviv University.


    Footnotes
 
Masami Hasegawa, Reviewing Editor

1 Keywords: insectivore intron marsupial phylogeny rodent Back

2 Address for correspondence and reprints: Marc Robinson-Rechavi, Laboratoire de Biologie Moleculaire et Cellulaire, Ecole Normale Superieure de Lyon, 46, allee d'Italie, 69364 Lyon cedex 07, France. E-mail: marc.robinson{at}ens-lyon.fr Back


    literature cited
 TOP
 Acknowledgements
 literature cited
 

    Cao, Y., J. Adachi, T. Yano, and M. Hasegawa. 1994. Phylogenetic place of Guinea pigs: no support of the rodent-polyphyly hypothesis from maximum-likelihood analyses of multiple protein sequences. Mol. Biol. Evol. 11:593–604.[Abstract]

    Cao, Y., A. Janke, P. J. Waddel, M. Westerman, O. Takenaka, S. Murata, N. Okada, S. Pääbo, and M. Hasegawa. 1998. Conflict among individual mitochondrial proteins in resolving the phylogeny of eutherian orders. J. Mol. Evol. 47:307–322.[Web of Science][Medline]

    Cao, Y., N. Okada, and M. Hasegawa. 1997. Phylogenetic position of Guinea pigs revisited. Mol. Biol. Evol. 14:461–464.[Web of Science][Medline]

    Catzeflis, F. M. 1991. Animal tissue collections for molecular genetics and Systematics. Trends Ecol. Evol. 6:168.

    Catzeflis, F. M., C. Hanni, P. Sourouille, and E. Douzery. 1995. Re: Molecular systematics of Hystricognath rodents: the contribution of Sciurognath mitochondrial 12S rRNA sequences. Mol. Phylogenet. Evol. 4:357–360.[Web of Science][Medline]

    Charleston, M. 1998. Spectrum. Available from http://taxonomy.zoology.gla.ac.uk/~mac/spectrum/.

    d'Erchia, A. M., C. Gissi, G. Pesole, C. Saccone, and U. Arnasson. 1996. The guinea pig is not a rodent. Nature 381:597–600.

    Galtier, N., and M. Gouy. 1995. Inferring phylogenies from DNA sequences of unequal base compositions. Proc. Natl. Acad. Sci. USA 92:11317–11321.

    Galtier, N., M. Gouy, and C. Gautier. 1996. SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny. Comput. Appl. Biosci. 12:543–548.[Abstract/Free Full Text]

    Graur, D., A. H. Hide, and W. H. Li. 1991. Is the guinea-pig a rodent? Nature 351:649–652.

    Hasegawa, M., Y. Cao, J. Adachi, and T. Yano. 1992. Rodent polyphyly? Nature 355:595.

    Hendy, M. D., and D. Penny. 1993. Spectral analysis of phylogenetic data. J. Classif. 10:5–24.

    Honeycutt, R. L., M. A. Nedbal, R. M. Adkins, and L. L. Janecek. 1995. Mammalian mitochondrial DNA evolution: a comparison of the cytochrome b and cytochrome c oxidase II genes. J. Mol. Evol. 40:260–272.[Web of Science][Medline]

    Huchon, D., F. M. Catzeflis, and E. J. Douzery. 1999. Molecular evolution of the nuclear von Willebrand Factor gene in mammals and the phylogeny of rodents. Mol. Biol. Evol. 16:577–589.[Abstract]

    Janke, A., X. Xu, and U. Arnason. 1997. The complete mitochondrial genome of the wallaroo (Macropus robustus) and the phylogenetic among Monotremata, Marsupialia, and Eutheria. Proc. Natl. Acad. Sci. USA 94:1276–1281.

    Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16:111–120.[Web of Science][Medline]

    Kishino, H., and M. Hasegawa. 1989. Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in Hominoidea. J. Mol. Evol. 29:170–179.[Web of Science][Medline]

    Li, W. H., W. A. Hide, and D. Graur. 1992. Origin of rodents and guinea-pigs. Nature 359:277–278.

    Luckett, W. P., and J. L. Hartenberger. 1993. Monophyly or polyphyly of the order Rodentia: possible conflict between morphological and molecular interpretations. J. Mamm. Evol. 1:127–147.

    Ma, D. P., A. Zharkikh, D. Graur, J. L. Vandeberg, and W. H. Li. 1993. Structure and evolution of opossum, guinea pig, and porcupine cytochrome b genes. J. Mol. Evol. 36:327–334.[Web of Science][Medline]

    Morgenstern, B., K. Frech, A. Dress, and T. Werner. 1998. DIALIGN: finding local similarities by multiple sequence alignment. Bioinformatics 14:290–294.

    Mouchaty, S. K., A. Gullberg, A. Janke, and U. Arnason. 2000. The phylogenetic position of the Talpidae within eutheria based on analysis of complete mitochondrial sequences. Mol. Biol. Evol. 17:60–67.[Abstract/Free Full Text]

    Nedbal, M. A., R. L. Honeycutt, and D. A. Schlitter. 1996. Higher-level systematics of rodents (Mammalia, Rodentia): evidence from the mitochondrial 12S rRNA gene. J. Mamm. Evol. 3:201–237.

    Penny, D., M. Hasegawa, P. J. Waddel, and M. D. Hendy. 1999. Mammalian evolution: timing and implications from using the LogDeterminant transform for proteins of differing amino acid composition. Syst. Biol. 48:76–93.

    Reyes, A., G. Pesole, and C. Saccone. 1998. Complete mitochondrial DNA sequence of the fat dormouse, Glis glis: further evidence of rodent paraphyly. Mol. Biol. Evol. 15:499–505.[Abstract]

    Robinson, M., F. M. Catzeflis, J. Briolay, and D. Mouchiroud. 1997. Molecular phylogeny of rodents, with special emphasis on murids: evidence from nuclear gene LCAT. Mol. Phylogenet. Evol. 8:423–434.[Web of Science][Medline]

    Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406–425.[Abstract]

    Stanhope, M. J., V. G. Waddell, O. Madsen, W. de Jong, S. B. Hedges, G. C. Cleven, D. Kao, and M. S. Springer. 1998. Molecular evidence for multiple origins of Insectivora and for a new order of endemic African insectivore mammals. Proc. Natl. Acad. Sci. USA 95:9967–9972.

    Steel, M. A., P. J. Lockhart, and D. Penny. 1993. Confidence in evolutionary trees from biological sequence data. Nature 364:440–442.

    Strimmer, K., and A. von Haeseler. 1996. Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies. Mol. Biol. Evol. 13:964–969.[Web of Science]

Accepted for publication May 16, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Biol EvolHome page
D. Huchon, O. Madsen, M. J. J. B. Sibbald, K. Ament, M. J. Stanhope, F. Catzeflis, W. W. de Jong, and E. J. P. Douzery
Rodent Phylogeny and a Timescale for the Evolution of Glires: Evidence from an Extensive Taxon Sampling Using Three Nuclear Genes
Mol. Biol. Evol., July 1, 2002; 19(7): 1053 - 1065.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Robinson-Rechavi*, M.
Right arrow Articles by Mouchiroud, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Robinson-Rechavi*, M.
Right arrow Articles by Mouchiroud, D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?