Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Karhu, A.
Right arrow Articles by Savolainen, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karhu, A.
Right arrow Articles by Savolainen, O.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Biology and Evolution 17:259-265 (2000)
© 2000 Society for Molecular Biology and Evolution


Articles

Rapid Expansion of Microsatellite Sequences in Pines

A. Karhu, J.-H. Dieterich1, and O. Savolainen

Department of Biology, University of Oulu, Oulu, Finland


    Abstract
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 
Microsatellite persistence time and evolutionary change was studied among five species of pines, which included a pair of closely related species (Pinus sylvestris and Pinus resinosa) in the subgenus Pinus, their relative Pinus radiata, and another closely related species pair (Pinus strobus and Pinus lambertiana) in the subgenus Strobus. The effective population sizes of these species are known to have ranged from the very small bottlenecks of P. resinosa to vast populations of P. sylvestris. This background allowed us to place the microsatellite evolution in a well-defined phylogenetic setting. Of 30 loci originating from P. strobus and P. radiata, we were able to consistently amplify 4 in most of the these pine species. These priming sites had been conserved for over 100 Myr. The four microsatellites were sequenced in the five species. Flanking sequences were compared to establish that the loci were orthologous. All microsatellites had persisted in these species, despite very different population sizes. We found a recent microsatellite duplication: a closely related pair of loci in P. strobus, where the other four species had just one locus. On two independent occasions, the repeat area of this same microsatellite (locus RPS 105a/b) had grown from a very low repeat number to 15 or 17 in the last 10–25 Myr. Other parts of the same compound microsatellite had remained virtually unchanged. Locus PR 4.6 is known to be polymorphic in both P. radiata and P. sylvestris, but the polymorphism in the two species is due to different motifs. The very large pine genomes are highly repetitive, and microsatellite loci also occur as gene families.


    Introduction
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 
The simplest models of microsatellite evolution assume evolution by addition and deletion of di- or trinucleotides, i.e., by the stepwise mutation model (Ohta and Kimura 1973Citation ). However, many empirical results suggest that the mutational mechanisms are more complex, including point mutations (e.g., Pépin et al. 1995Citation ). Recent theoretical work accommodates some of the complexities (Kruglyak et al. 1998Citation ).

There are several ways to examine the nature of the mutational process. Direct observation of mutations in the germ line has been possible in exceptional cases, such as for the hypermutable microsatellite HrU9 of barn swallows (Primmer et al. 1996Citation , 1998) or for some human microsatellites (Amos et al. 1996Citation ). Additions and deletions were found to be directional, and the rate depended on allelic size.

Another possible way to examine the nature of the mutational process is to examine mutations that took place in the past by studying in detail the sequences of the microsatellites and their flanking areas. This can be done within species (e.g., Grimaldi and Crouau-Roy 1997Citation ) or between species (e.g., Primmer and Ellegren 1998Citation ). It has been possible to amplify microsatellites using the same primers in species that have diverged tens of millions of years ago (e.g., Schlötterer, Amos, and Tautz 1991Citation ; Forbes et al. 1995Citation ; Whitton, Rieseberg, and Ungerer 1997Citation ; Peakall et al. 1998Citation ). We used this approach to study evolution at sites containing microsatellites over long evolutionary times: we examined the changes that have taken place in the repeats and the persistence of the loci themselves.

Microsatellite primer sequences were available from Pinus radiata (Smith and Devey 1994Citation ) and Pinus strobus (Echt et al. 1996Citation ). These primers were used to amplify microsatellites in those two species and in Pinus sylvestris, Pinus resinosa, and Pinus lambertiana. The genus Pinus is subdivided into two major groups, the subgenera Pinus (the hard pines) and Strobus (the soft pines). The fossil record shows that the genus was already differentiated into these groups during the early part of the Cretaceous, nearly 130 MYA (Mirov 1967Citation ). The hard pines P. sylvestris and P. resinosa belong to subsection Sylvestres of section Pinus. They are very closely related based on chloroplast DNA restriction site analysis (Krupkin, Liston, and Strauss 1996Citation ). Pinus radiata belongs to the subsection Attenuatae of section Pinus (Price, Liston, and Strauss 1998Citation ). According to the study of Krupkin, Liston, and Strauss (1996), subsections Sylvestres and Oocarpae diverged more than 100 MYA. Since subsections Attenuatae and Oocarpae are quite closely related (Price, Liston, and Strauss 1998Citation ), we can assume that the divergence of subsections Sylvestres and Attenuatae also occurred nearly 100 MYA. The soft pines P. strobus and P. lambertiana are members of section Strobus. Molecular studies show that species in this section are very similar to one another (Strauss and Doerksen 1990Citation ).

The phylogenetic relationship of four of these pine species can be further clarified using the rDNA sequence data of Liston et al. (1999) (GenBank accession numbers AF037003, AF037002, AF036990, and AF036982). A neighbor-joining phylogenetic tree based on their sequences is shown in figure 1 (constructed with the MEGA phylogenetic program by Kumar, Tamura, and Nei [1993Citation ]). We used these rDNA sequences to estimate the divergence times between the species pairs P. sylvestris/P. resinosa and P. strobus/P. lambertiana. As the Pinus-Strobus subgenus divergence occurred more than 100 MYA, this leads to an estimate of about 10 Myr for the divergence between both closely related species pairs. We also used additional data from the chloroplast rbcL and matK genes (R. Price, personal communication). These sequences resulted in divergence time estimates of 27 Myr (rbcL) and 3.6 Myr (matK) for P. sylvestris and P. resinosa, respectively. The matK gene is known to deviate from clocklike behavior (Civeyrel et al 1998Citation ), and it shows smaller distances among closely related pine species when compared with the more slowly changing gene rbcL (R. Price, personal communication).



View larger version (6K):
[in this window]
[in a new window]
 
Fig. 1.—Neighbor-joining tree of four pine species based on rDNA sequences of Liston et al. (1999). The scale is given in Jukes-Cantor distances

 
Levels of genetic variability in these species at isozyme loci are known, which allows us to make inferences on their long-term effective population sizes. Pinus sylvestris is among the most variable organisms, with expected heterozygosity of 0.283 in a set of 13 loci (Muona and Harju 1989Citation ). Its close relative, P. resinosa, is known to be completely devoid of isozyme variation (Fowler and Morris 1977Citation ) and to have very low variation at the DNA level (deVerno and Mosseler 1997), despite a current large range. Thus, the two species probably have very different effective population sizes. The other species pair, P. strobus and P. lambertiana, both have high levels of variation (0.330 and 0.260, respectively) (Hamrick, Mitton, and Linhart 1981Citation ) and large effective population sizes. Pinus radiata has low variability (He = 0.095) and is known to have historically rather small population sizes (Moran, Bell, and Eldridge 1988Citation ).

This information allowed us to examine the evolution of the microsatellites in a well-defined phylogenetic setting. We examine the timescales of expansion of microsatellite repeat regions in pines versus birds and mammals. Further, we examine the persistence of microsatellites by comparing the two closely related species pairs: P. sylvestris/P. resinosa, with very large population size differences, and P. strobus/P. lambertiana, with hardly any difference.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 
DNA Material and Microsatellite Primers
DNA was isolated from diploid embryos and haploid megagametophytes of P. sylvestris, P. radiata, P. resinosa, P. strobus, and P. lambertiana by slightly modifying the method of Doyle and Doyle (1990). Pinus sylvestris samples were from southern Finland, and P. resinosa and P. lambertiana seed samples were from standard forests from the United States. DNA from P. strobus and P. radiata was kindly provided by C. S. Echt and G. F. Moran, respectively. Twenty-eight primer pairs developed for P. strobus (Research Genetics) (Echt et al. 1996Citation ) and two primer pairs developed for P. radiata (Smith and Devey 1994Citation ) were used to amplify microsatellites from genomic DNA of P. sylvestris. For sequence analysis across species, we chose primers which generated one PCR product of approximately the same size as in the source species. One primer pair was from P. radiata, PR 4.6 (F: 5'GAAAAAAAGGCAAAAAAAAGGAG'3 and R: 5'ACCCAAGGCTACATAACTCG'3), and three were from P. strobus, RPS 105 (F: 5'TGGACATCCTAGTCGGAACC'3 and R: 5'AAAATCATTTCTGTATCAGAACAA'3), RPS 150 (F: 5'TCCATCAGTGAGCAGTGG'3 and R: 5'CACTTGGGCTTCCTCTTC'3), and RPS 160 (F: 5'ACTAAGAACTCTCCCTCTCACC'3 and R: 5'TCATTGTTCCCCAAATCAT'3).

PCR Amplification
Amplification of the microsatellites was tested using four to six individuals from P. sylvestris, P. resinosa, and P. lambertiana and two individuals from P. radiata and P. strobus. The PCR protocol was as described by Karhu et al. (1996), with slight modifications. With P. strobus primers, PCR conditions were as follows: 94°C for 3 min followed by a multistep touchdown decreasing by 1°C each annealing step; 93°C for 45 s, 60°C to 55–50°C (depending on the locus) for 45 s, and 70°C for 45 s (30 cycles altogether); and, finally, one cycle of 10 min at 72°C. For P. radiata primers, the amplification profile was exactly as described by Karhu et al. (1996).

Cloning and Sequencing of PCR Products
For cloning, we selected bands that were monomorphic and thus gave one sharp amplification product. These bands were isolated from agarose gel and then cloned using the TA vector pCRII (Invitrogen Corp.). At least three separate clones from each individual were sequenced for each microsatellite locus, and the consensus sequences are given in figure 2 . DNA sequencing was performed using an automated sequencer, model 377, from Perkin Elmer/ABI, and dye terminator sequencing reagents (Perkin Elmer, ABI). The sequences were aligned using either the SeqEd alignment program, version 1.0.3 (Perkin Elmer, ABI), or Dnasis (Hitachi Software Engineering Co.). The original sequences were from GenBank (accession numbers AF043496, U60257, and U60256) or were kindly provided by C. S. Echt and G. F. Moran.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 2.—Alignment of nucleotide sequences between five pine species for four microsatellite loci of the study. The first sequences are always from the source species. RPS 105a and RPS 105b refer to the two separate loci we found in Pinus strobus. Primers are excluded from the sequences. Gaps (–) have been placed to increase the similarity. Dots (·) show identical nucleotides. N = A/C/G/T. The repeat regions are shown in bold. Numbers next to aligned sequences indicate the positions of the first and last nucleotides in the row when repeat areas are excluded

 
Comparing Substitution Rates in Different Parts of the Flanking Sequence
We tested for dependence of the mutation rate on distance from the microsatellite region using log-likelihood ratio tests separately for point mutations and indels. For the constrained model (L0), we assumed a uniform distribution of mutation rate independent of distance from the microsatellite region. For the unconstrained model (L1), we fitted a model linear in the logarithm of the distance (in base pairs) from the microsatellite region. As one parameter is fitted with the constrained model and two are fitted with the unconstrained model, the test statistic of the log-likelihood ratio test (i.e., the deviance) is approximately chi-square–distributed with one degree of freedom.


    Results
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 
PCR Amplifications
Nine of 28 (32%) P. strobus primer pairs resulted in amplification in P. sylvestris. Both tested P. radiata primer pairs amplified in P. sylvestris. For further analysis, we chose four primer pairs which gave a repeatable amplification product in most species, three from P. strobus and one from P. radiata. We were not able to amplify microsatellites from P. lambertiana and P. resinosa using the PR 4.6 primers. RPS 150 primers in P. radiata revealed on amplification a product that, upon sequencing of flanking regions, was found to be a different, closely related microsatellite locus RPS 140 (sequence of locus from C. S. Echt, personal communication).

Altogether, these primers demanded quite high stringency of PCR to produce only amplification products of expected size, in both the source and the target species. Relaxation of the stringency of PCR resulted in additional PCR products or total lack of amplification. For instance, at locus RPS 105 in P. strobus, there were two separate amplification products of different sizes when a slightly lower annealing temperature and higher MgCl2 concentrations were used.

Assessment of Homology
We chose PCR products derived from potentially homologous loci in different genomes by selecting for similar size products and comparing the flanking sequences to the known phylogeny of these species. Below, the homology is assessed locus by locus.

We obtained two amplification products in P. strobus for locus RPS 105, as decribed above. The repeat structure of the main product (RPS 105a) in P. strobus was very different from that obtained in the other species with this set of primers, so we also sequenced the other fragment (GenBank accession numbers AF091373AF091377). The sequence of the flanking area in the main product, RPS 105a, was the same as that published by Echt et al. (1996) (GenBank accession number AF043496). The flanking sequence of the fainter PCR product, RPS 105b, had high nucleotide similarity with both RPS 105a and the other pine species (over 90%) (table 1 ). The two P. strobus sequences (a and b) are set apart from the other sequences by a shared deletion at flanking sites 64–75 and two other one-base indels (at sites 1 and 79; fig. 2 ). We conclude that locus RPS 105 duplicated in P. strobus after P. lambertiana and P. strobus diverged.


View this table:
[in this window]
[in a new window]
 
Table 1 Proportions of Similar Nucleotides in the Flanking Sequences Between Pairs of Pinus Species

 
We tried to amplify the locus RPS 105a also in the other species, using primers which were designed so that they were specific only for locus RPS 105a, but had no success. This lends further support to the conclusion that the other locus came about after the divergence. Table 1 shows the proportions of identical nucleotides (excluding areas with insertions and deletions) in the AT-rich flanking area of locus PR 4.6 (GenBank accession numbers AF091371 and AF091372). We were able to amplify this locus in only three species. All had similar flanking regions, with base-pair identities over 90%. Furthermore, the three different species pairs also shared similar numbers of indels; all of them had six indel differences (fig. 2 ). As all these species are assumed to have separated about 100 MYA, the short sequences do not easily distinguish the order of divergence.

The flanking sequences at loci RPS 150 and RPS 160 were concordant with the known pine phylogeny (fig. 2 ) (GenBank accession numbers U60256, AF091382AF091384, U60257, and AF091386AF091389). The rate of change in the flanking sequence of RPS 150 had been much faster than those for the other loci (table 1 ), with the lowest nucleotide identity being just 85.1%.

Stability of Sequences Next to Repeats
The flanking sequences are situated between the highly conserved priming sites and the unstable repeat areas. We tested whether the repeat area destabilizes and thus increases the evolutionary rate in the immediately adjacent flanking sequence. For the point substitutions, we observed a slight, nonsignificant decrease in substitutions with distance from the microsatellite region. For the indels, there was a slight but not significant increase in mutations with distance from the microsatellite region. Hence, there was no evidence of dependence of mutation rates on distance from the microsatellite region.

Persistence of Microsatellites
All of the studied microsatellite loci were compound and imperfect, except locus RPS 105a in P. strobus, for which the repeat did not have any interruptions (fig. 2 ). The microsatellite repeat sequences had persisted in all evolutionary lineages. We performed a specific comparison of microsatellite lengths between the two closely related species pairs, P. sylvestris/P. resinosa and P. strobus/P. lambertiana. Pinus resinosa, with the small population sizes, could have been liable to lose the repeat sequences if population size and drift had been important. Thus, the length differences between the first pair should be larger those between the second pair. We examined the shared motifs in microsatellites for length differences. For RPS 105, the four species had eight, five, four, and six AT repeats, and P. radiata also had five. The differences in repeat numbers between the pairs were very small, only three and two. Thus, the shared repeats in these microsatellites do not provide any evidence for the dependence of microsatellite persistence and population size. This result is in accordance with the results of Stephan and Kim (1998), who showed that microsatellites should persist independently of population size. Recently, the role of point mutations in reduction in size and death of microsatellites has been examined by Kruglyak et al. (1998) and Taylor, Durkin, and Breden (1999).

Changes in Repeat Composition
The most striking changes were at locus RPS 105 in P. strobus. Almost the entire repeat structure was different between P. strobus RPS 105a and RPS 105b. RPS 105a had the 17 AC repeats, whereas in RPS 105b there was only one CA unit. All species had several AT repeats. The RPS 105b repeat had more overall similarities with the other species (fig. 2 ). These repeat structure changes, together with flanking sequence data, support the conclusion that locus RPS 105 was duplicated in P. strobus. This duplication and the rapid increase in the number of CA repeats must have taken place after the P. strobus/P. lambertiana divergence (10–25 MYA). Presumably, a small number of CA units has served as the initial basis for extension.

In P. sylvestris, we found a similar rapid expansion of the GT repeats at locus RPS 105b. This species had 15 units, whereas in the other species there were at most 2 GT units (fig. 2 ). Again, the expansion was based on a low initial number of repeats and occurred rapidly after the P. resinosa/P. sylvestris divergence (10–25 MYA). Note that the rapid expansions in the two lineages involved different subrepeats.

At locus PR 4.6, the repeat area was shorter in two other species than in the source species (P. radiata), and there were considerable differences between species in the repeat structure. The main repeat type was different in each of the three species. In P. radiata, there were 21 CA repeats, while P. sylvestris and P. strobus had only three. The number of TA motifs varied from three to eight. Pinus radiata and P. sylvestris also had stretches of TAA repeats. The locus PR 4.6 is known to be polymorphic at least in P. radiata (Smith and Devey 1994Citation ) and in P. sylvestris (Karhu et al. 1996Citation ). In P. radiata, the polymorphism is probably based on variation in number of CA repeats (Smith and Devey 1994Citation ), but according to our sequence data, the polymorphism in P. sylvestris is based on a different motif, the TAA repeats.

RPS 150 is a highly complex microsatellite. At RPS 150, all species shared similar motifs in about equal numbers at the beginning and end of the sequence. In the middle of the repeat area, there were components of similar repeats earlier, but they were very degenerate, perhaps due to point mutations. Otherwise, the phylogenetic affinities of the repeat area were as those of the flanking sequences. While many changes have taken place overall, the two closely related species pairs each had nearly identical repeat areas.

At locus RPS 160, the basic repeat structure (AG)n(ACAG)n contained interruptions (fig. 2 ). This repeat might have had a perfect (ACAG) composition earlier, but the middle parts may have degenerated due to many base substitutions and indels in all species. For instance, there is an extra G after the (ACAG) repeat in all species (except in P. radiata), which interrupts the perfect (ACAG) structure (fig. 2 ).


    Discussion
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 
Highly Conserved Areas in the Genome Were Studied
Our choice of microsatellites to be studied was governed by the possibility of amplifying homologous areas in species which had diverged more than 100 MYA. Thus, we studied only 4 of the 30 loci we initially tried to amplify. Based on this study, the repeat areas evolve somewhat independently of the evolutionary rate of the adjacent single-copy areas. The conservative flanking areas may still have led us to study more slowly evolving microsatellite areas. Our analysis of the flanking sequence area showed that the microsatellites did not impose instability between the repeats and the priming sites.

The probability of successful cross-species amplification of microsatellite primers depends on the relatedness between species (Primmer, Møller, and Ellegren 1996Citation ; Fields and Scribner 1997Citation ). For instance, between humans and chimpanzees (Garza, Slatkin, and Freimer 1995Citation ) or between Arabidopsis thaliana and Arabis species (van Treuren et al. 1997Citation ), for which the divergence times were less than 10 Myr, the amplification success was quite high. Whitton, Rieseberg, and Ungerer (1997), however, found a much lower rate of success over evolutionary distances of 15–29 Myr. There are also some examples where microsatellite loci have been conserved over longer evolutionary distances, such as in cetaceans over 35–40 Myr (Schlötterer, Amos, and Tautz 1991Citation ), in different genera of turtles over 300 Myr (FitzSimmons, Moritz, and Moore 1995Citation ), or in fish species over 450 Myr (Rico, Rico, and Hewitt 1996Citation ). Our amplification over more than 100 Myr belongs to this higher range of evolutionary distances. Amplification over long evolutionary times may be attempted to study microsatellite evolution or to provide an easy way to obtain microsatellites for the target species. However, the long evolutionary time will impose limits on the comparative use of such microsatellites.

Rapid Expansion of the Repeat Area
The locus RPS 105 had undergone rapid expansion in both P. sylvestris and P. strobus. The expansion of the TG repeat took place independently in P. sylvestris and this occurred after the divergence of P. sylvestris and P. resinosa (10–25 MYA). In P. strobus, the expansion of the AC repeat at the duplicated RPS 105a locus occurred after the divergence of P. strobus and P. lambertiana (10–25 MYA). Before the duplication of the locus, there was only one AC repeat unit in all species. In both cases, a low number of repeat units has served as the basis for expansions. It is possible that base substitutions provided material for replication slippage or some other inserting mechanism and thus enabled the further expansion. At the duplicated locus RPS 105a in P. strobus T-C and at RPS 105 in P. sylvestris A-G, substitutions could have taken place and created short perfect arrays (fig. 2 ). Note that the number of AT repeats adjacent to the expanded P. sylvestris GT repeat also was higher than those in other species. Primmer and Ellegren (1998) found that a limited number of repeats (NN)2–4 was sufficient for further expansion through slippage in avian microsatellites. Messier, Li, and Stewart (1996) showed that in a complex primate, microsatellite point mutations initially led to generation of a run of two tetranucleotides and, in the lineage where this occurred, to a later expansion to four tetranucleotides. In another lineage in the same microsastellite, a point mutation led to a run of five dinucleotides, which was later expanded by one dinucleotide in tens of millions of years. It has also been proposed that Alu elements could be the source for genesis of primate microsatellite repeats (Arcot et al. 1995Citation ). Even if our available divergence time estimates are variable between loci, evolution in pines has been very rapid compared with that in primates. We cannot infer whether the increase occurred one step at a time or through larger additions. If such expansions can occur through larger additions, these loci would cause extensive overestimation of genetic distances based on the stepwise mutation model (Slatkin 1995Citation ; Goldstein et al. 1995Citation ).

Thus, overall, the patterns of microsatellite evolution are quite variable, and the simple stepwise mutation model will not necessarily hold over the time of divergence between closely related species. Furthermore, the evolutionary rates at different microsatellite loci, or even in different parts of the same complex microsatellites, are highly variable. The molecular mechanisms for these different rates are not understood. Both cases of expansion took place in the species that presumably had the largest population sizes. Earlier studies of compound microsatellites also showed that indels and base substitutions which can influence subsequent evolutionary rates are common even between close relatives (e.g., Estoup et al. 1995Citation ; Angers and Bernatchez 1997Citation ; Gonzáles-Cabo et al. 1999Citation ).

Comparisons of allele distributions or general polymorphism comparisons between species are inappropriate, at least between distantly related species. Length variation and homoplasy due to indels in the flanking regions is common. This has also been noticed between more closely related species (Blanquer-Maumont and Crouau-Roy 1995Citation ; FitzSimmons, Moritz, and Moore 1995Citation ; Steinkellner et al. 1997Citation ; van Treuren et al. 1997Citation ). It is also evident that the rate of evolution in the microsatellite pair RPS105a and RPS105b has been quite fast in the two lineages of the closely related species pairs, which could invalidate between-species comparisons.

The Large Pine Genome Contains Families of Microsatellites
We were able to show that the locus RPS 105 was duplicated at least in P. strobus. The duplication of locus RPS 105 in P. strobus could be verified because both the flanking sequences and the repeat area indicated that the duplication had occurred within P. strobus. Also, the finding that RPS 150 primers amplified a related microsatellite in P. radiata provides further evidence of families of microsatellites.

Earlier studies on conifers have also shown that even species-specific primers can amplify multiple microsatellites (Smith and Devey 1994Citation ; Kostia et al. 1995Citation ; Pfeiffer, Olivieri, and Morgante 1997Citation ). Smith and Devey (1994) concluded that microsatellite regions are often embedded within repetitive DNA sequences in P. radiata. This was also noticed in Picea abies (Pfeiffer, Olivieri, and Morgante 1997Citation ).


    Acknowledgements
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 
We would like to thank Dr. Craig Echt and Dr. Gavin Moran, who kindly provided P. strobus and P. radiata DNA samples and sequence data. We also thank Dr. R. Price, who let us use unpublished chloroplast data, and special thanks go to Dr. Claus Vogl for help with statistical analysis and useful comments. We further thank Dr. Craig Primmer and two anonymous reviewers for comments on the manuscript. This research was financially supported by the Environment and Natural Resources Research Council and the Graduate School of Forest Tree Biotechnology and Biology.


    Footnotes
 
Wolfgang Stephan,

1 Present address: Department of Applied Genetics, University of Hannover, Hannover, Germany. Back

2 Keywords: microsatellite Pinus, stepwise mutation model persistence time Back

3 Address for correspondence and reprints: Outi Savolainen, Department of Biology, University of Oulu, P.O. Box 3000, FIN-90401 Oulu, Finland. E-mail: outi.savolainen{at}oulu.fi Back


    literature cited
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 literature cited
 

    Amos, W., S. J. Sawcer, R. W. Feakes, and D. C. Rubinsztein. 1996. Microsatellites show mutational bias and heterozygote instability. Nat. Genet. 13:390–391.[Web of Science][Medline]

    Angers, B., and L. Bernatchez. 1997. Complex evolution of a salmonid microsatellite locus and its consequences in inferring allelic divergence from size information. Mol. Biol. Evol. 14:230–238.[Abstract]

    Arcot, S. S., Z. Wang, J. L. Weber, P. L. Deininger, and A. Batzer. 1995. Alu repeats: a source for the genesis of primate microsatellites. Genomics 29:136–144.

    Blanquer-Maumont, A., and B. Crouau-Roy. 1995. Polymorphism, monomorphism, and sequences in conserved microsatellites in primate species. J. Mol. Evol. 41:492–497.[Web of Science][Medline]

    Civeyrel, L., A. Le Thomas, K. Ferguson, and M. Chase. 1998. Critical reexamination of palynological characters used to delimit Asclepiadaceae in comparison to the molecular phylogeny obtained from plastid matK sequences. Mol. Phylogenet. Evol. 9:517–527.[Web of Science][Medline]

    Deverno, L., and A. Mosseler. 1997. Genetic variation in red pine (Pinus resinosa Ait.) revealed by RAPD and RAPD/RFLP analysis. Can. J. For. Res. 27:1316–1320.

    Doyle, J. J., and J. L. Doyle. 1990. Isolation of plant DNA from fresh tissue. BRL Focus 12:13–15.

    Echt, C. S., P. May-Marquardt, M. Hseih, and R. Zahorchak. 1996. Characterization of microsatellite markers in eastern white pine. Genome 39:1002–1008.

    Estoup, A., L. Garnery, M. Solignac, and J.-M. Cornuet. 1995. Microsatellite variation in honey bee (Apis melifera L.) populations: hierarchical genetic structure and test of the infinite allele and stepwise mutation models. Genetics 140:679–695.

    Fields, R. L., and K. T. Scribner. 1997. Isolation and characterization of novel waterfowl microsatellite loci: cross-species comparisons and research applications. Mol. Ecol. 6:199–202.[Medline]

    FitzSimmons, N. N., C. Moritz, and S. S. Moore. 1995. Conservation and dynamics of microsatellite loci over 300 million years of marine turtle evolution. Mol. Biol. Evol. 12:432–440.[Abstract]

    Forbes, S. H., J. T. Hogg, F. C. Buchanan, A. M. Crawford, and F. W. Allendorf. 1995. Microsatellite evolution congeneric mammals: domestic and bighorn sheep. Mol. Biol. Evol. 12:1106–1113.[Abstract]

    Fowler, D. P., and R. W. Morris. 1977. Genetic diversity in red pine: evidence for low genic heterozygosity. Can. J. For. Res. 15:343–347.

    Garza, J. C., M. Slatkin, and N. B. Freimer. 1995. Microsatellite allele frequencies in humans and chimpanzees, with implications for constrains on allele size. Mol. Biol. Evol. 12:592–603.

    Goldstein, D. B., A. R. Linares, L. L. Cavalli-Sforza, and M. W. Feldman. 1995. An evaluation of genetic distances for use with microsatellite loci. Genetics 139:463–471.

    Gonzáles-Cabo, P., M. I. Sánchez, J. Cañizares, J. M. Blanca, R. NartÍnaz-Arias, M. De Castro, J. Bertranpetit, F. Palau, M. D. Molto, and R. De Frutos. 1999. Incipient GAA repeats in the primate friedreich ataxia homologous genes. Mol. Biol. Evol. 16:880–883.[Medline]

    Grimaldi, M. C., and B. Crouau-Roy. 1997. Microsatellite allelic homoplasy due to variable flanking sequences. J. Mol. Evol. 44:336–340.[Web of Science][Medline]

    Hamrick, J. L., J. B. Mitton, and Y. B. Linhart. 1981. Levels of genetic variation in trees: influence of life history characteristics. Pp. 35–41 in M. T. Conkle, ed. Proceedings of a symposium on isozymes of North American forest trees and forest insects. USDA Forest Service General Technical Report PSW 48. Pacific Southwest Forest and Range Experimental Station, Berkeley, Calif.

    Karhu, A., P. Hurme, M. Karjalainen, P. Karvonen, K. Kärkkäinen, D. Neale, and O. Savolainen. 1996. Do molecular markers reflect patterns of differentiation in adaptive traits of conifers? Theor. Appl. Genet. 93:215–221.

    Kostia, S., S.-L. Varvio, P. Vakkari, and P. Pulkkinen. 1995. Microsatellite sequences in a conifer, Pinus sylvestris. Genome 38:1244–1248.

    Kruglyak, S., R. T. Durrett, M. D. Schug, and C. F. Aquadro. 1998. Equilibrium distributions of microsatellite repeat length resulting from a balance between slippage events and point mutations. Proc. Natl. Acad. Sci. USA 95:10774–10778.

    Krupkin, A. B., A. Liston, and S. H. Strauss. 1996. Phylogenetic analysis of hard pines (Pinus subgenus Pinus, Pinaceae) from chloroplast DNA restriction site analysis. Am. J. Bot. 83:489–498.

    Kumar, S., K. Tamura, and M. Nei. 1993. MEGA: molecular evolutionary genetics analysis. Version 1.0. Pennsylvania State University, University Park.

    Liston, A., W. A. Robinson, D. Piñero, and E. R. Alvarez-Buylla. 1999. Phylogenetics of Pinus (Pinaceae) based on nuclear ribosomal DNA internal transcribed spacer region sequences. Mol. Phylogenet. Evol. 11:95–109.[Web of Science][Medline]

    Messier, W., S.-H. Li, and C.-B. Stewart. 1996. The birth of microsatellites. Nature 381:483.

    Mirov, N. T. 1967. The genus Pinus. Ronald Press, New York.

    Moran, G. F., J. C. Bell, and K. G. Eldridge. 1988. The genetic structure and conservation of five natural populations of Pinus radiata. Can. J. For. Res. 18:506–514.

    Muona, O., and A. Harju. 1989. Effective population sizes, genetic variability and mating system in natural stands and seed orchards of Pinus sylvestris. Silvae Genet. 38:221–228.

    Ohta, T., and M. Kimura. 1973. A model of mutation appropriate to estimate the number of electrophoretically detectable alleles in a finite population. Genet. Res. 22:201–204.[Web of Science][Medline]

    Peakall, R., S. Gilmore, W. Keys, M. Morgante, and A. Rafalski. 1998. Cross-species amplification of soybean (Glycine max) simple sequence repeats (SSRs) within the genus and other legume genera: implications for the transferability of SSRs in plants. Mol. Biol. Evol. 15:1275–1287.[Abstract]

    Pépin, L., Y. Amigues, A. Lépingle, J.-L. Berthier, A. Bensaids, and D. Vaiman. 1995. Sequence conservation of microsatellites between Bos taurus (cattle), Capra hircus (goat) and related species. Examples of use in parentage testing and phylogeny analysis. Heredity 74:53–61.

    Pfeiffer, A., A. M. Olivieri, and M. Morgante. 1997. Idenfication and characterization of microsatellites in Norway spruce (Picea abies K.). Genome 40:411–419.

    Price, R. A., A. Liston, and S. H. Strauss. 1998. Phylogeny and systematics of Pinus. Pp. 49–68 in D. M. Richardson, ed. Ecology and biogeography of Pinus. Cambridge University Press, Cambridge, England.

    Primmer, C. R., and H. Ellegren. 1998. Patterns of molecular evolution in avian microsatellites. Mol. Biol. Evol. 15:997–1008.[Abstract]

    Primmer, C. R., H. Ellegren, N. Saino, and A. P. Møller. 1996. Directional evolution in germline microsatellite mutations. Nat. Genet. 13:391–393.[Web of Science][Medline]

    Primmer, C. R., A. P. Møller, and H. Ellegren. 1996. A wide-range survey of cross-species microsatellite amplification in birds. Mol. Ecol. 5:365–378.[Medline]

    Primmer, C. R., N. Saino, A. P. Møller, and H. Ellegren. 1998. Unraveling the processes of microsatellite evolution through analysis of germ line mutations in barn swallows Hirundo rustica. Mol. Biol. Evol. 15:1047–1054.[Web of Science]

    Rico, C., I. Rico, and G. Hewitt. 1996. 470 million years of conservation of microsatellite loci among fish species. 1996. Proc. R. Soc. Lond. B. Biol. Sci. 263:549–557.[Medline]

    Schlötterer, C., B. Amos, and D. Tautz. 1991. Conservation of polymorphic simple sequence loci in cetacean species. Nature 354:63–65.

    Slatkin, M. 1995. A measure of population subdivision based on microsatellite allele frequencies. Genetics 139:457–462.

    Smith, D. N., and M. E. Devey. 1994. Occurrence and inheritance of microsatellites in Pinus radiata. Genome 37:977–983.

    Steinkellner, H., C. Lexer, E. Turetschek, and J. Glössl. 1997. Conservation of (GA)n microsatellite loci between Quercus species. Mol. Ecol. 6:1189–1194.

    Stephan, W., and Y. Kim. 1998. Persistence of microsatellite arrays in finite populations. Mol. Biol. Evol. 15:1332–1336.[Abstract]

    Strauss, S. H., and A. H. Doerksen. 1990. Restriction fragment analysis of Pine phylogeny. Evolution 44:1081–1096.

    Taylor, J. S., J. M. H. Durkin, and F. Breden. 1999. The death of a microsatellite: a phylogenetic perspective on microsatellite interruptions. Mol. Biol. Evol. 16:567–572.[Web of Science][Medline]

    van Treuren, R., H. Kuittinen, K. Kärkkäinen, E. Baena-Gonzalez, and O. Savolainen. 1997. Evolution of microsatellites in Arabis lyrata, outcrossing relatives of Arabidopsis thaliana. Mol. Biol. Evol. 14:220–229.[Abstract]

    Whitton, J., L. H. Rieseberg, and M. C. Ungerer. 1997. Microsatellite loci are not conserved across the Asteraceae. Mol. Biol. Evol. 14:204–209.[Web of Science][Medline]

Accepted for publication November 1, 1999.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J HeredHome page
L. D. Shepherd and D. M. Lambert
Mutational Bias in Penguin Microsatellite DNA
J. Hered., September 1, 2005; 96(5): 566 - 571.
[Abstract] [Full Text] [PDF]


Home page
J HeredHome page
B. L. Kutil and C. G. Williams
Triplet-Repeat Microsatellites Shared Among Hard and Soft Pines
J. Hered., July 1, 2001; 92(4): 327 - 332.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
M. A. F. Noor, R. M. Kliman, and C. A. Machado
Evolutionary History of Microsatellites in the Obscura Group of Drosophila
Mol. Biol. Evol., April 1, 2001; 18(4): 551 - 556.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Karhu, A.
Right arrow Articles by Savolainen, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karhu, A.
Right arrow Articles by Savolainen, O.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?